* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetic Investigation Technologies
DNA sequencing wikipedia , lookup
Gene expression wikipedia , lookup
List of types of proteins wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Molecular evolution wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Community fingerprinting wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic Technologies — Lecture V • Dr. Steven J. Pittler • WORB 658 • Office 4-6744 • Cell 612-9720 Suggested Reading: Lewis 7th Edition Human Genetics: Concepts and Applications Chapter 19 Genetic Technologies F E T A L T E S T I N G Amniocentesis In 1966 the first fetal karyotype was constructed Ultrasound is used to follow the needle’s movement Takes a few minutes and causes a feeling of pressure The sampled aminotic fluid is examined for deficient, excess, or abnormal biochemicals that could indicated inborn errors of metabolism Most common chromosomal abnormality is trisomy Usually performed during weeks 14-16 of gestation Amniocentesis Indicated when The risk that a fetus has a detectable condition that exceeds the risk that the procedure will cause a miscarriage (1 in 350) Pregnant woman over the age of 35 If a couple has had several spontaneous abortions If a couple has had a child with birth defects or a known chromosome abnormality Amniocentesis Is Indicated If the blood test on the pregnant woman reveals low levels of fetal liver protein (AFP) and high levels of human chorionic gonadotropin (hCG) Indicates a fetus with a small liver which may reflect a condition caused by an extra chromosome Additionally These maternal serum marker tests may assess a third or fourth biochemical marker as well The pregnancy-associated plasma protein A test (PAPP) is detectable only during the first trimester Chorionic Villus Sampling • In the 10th through the 12th week of pregnancy cells can be obtained from the chorionic villi- the structures that will develop into the placenta • The advantage over amniocentesis is that you do not have to culture cells and the results can be obtained in days • Cells from the chorionic villi descend from the fertilized ovum and therefore they should be identical to the embryo and fetus • Occasionally one can have a chromosomal aberration that usually occurs either in the embryo or chronic villi – Known as chromosomal mosaicism the karyotype of a villus cell differs from that of an embryo cell (potential error) Fetal Cell Sampling • • • • Safer than either of the other two procedures Separates fetal cells from mother’s bloodstream Technique originated in 1957 Using a device called a fluorescence-activated cell sorter (FACS) fetal cells can be distinguished from maternal cells Most genetic technologies are based on four properties of DNA 1. DNA can be cut at specific sites (motifs) by restriction enzymes 2. Different lengths of DNA can be size-separated by gel electrophoresis 3. A single strand of DNA will stick to its complement (hybridization) 4. DNA can be copied by a polymerase enzyme • DNA sequencing • Polymerase chain reaction (PCR) DNA can be cut at specific sites (motifs) by an enzyme • Restriction enzymes cut double-stranded DNA at specific sequences (motifs) • E.g. the enzyme Sau3AI cuts at the sequence GATC • Most recognition sites are palindromes: e.g. the reverse complement of GATC is GATC • Restriction enzymes evolved as defense against foreign DNA Sau3AI GATC CTAG DNA can be cut at specific sites (motifs) by an enzyme ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme Sau3AI GATC ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT CTAG TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme Sau3AI ACTGTCGATGTCGTCGTCGTAGCTGCT GATC GATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAG CTAG CATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme ACTGTCGATGTCGTCGTCGTAGCTGCT-3’ TGACAGCTACAGCAGCAGCATCGACGACTAG-’5 5’-GATCGTAGCTAGCT 3’-CATCGATCGA ACTGTCGATGTCGTCGTCGTAGCTGCTGA TGACAGCTACAGCAGCAGCATCGACGACT TCGTAGCTAGCT AGCATCGATCGA Different lengths of DNA can be separated by gel electrophoresis • DNA is negatively charged and will move through a gel matrix towards a positive electrode • Shorter lengths move faster Different lengths of DNA can be separated by gel electrophoresis Slow: 41 bp ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA Medium: 27 bp ACTGTCGATGTCGTCGTCGTAGCTGCT TGACAGCTACAGCAGCAGCATCGACGACTAG S M Fast: 10 bp GATCGTAGCTAGCT CATCGATCGA F Different lengths of DNA can be separated by gel electrophoresis Recessive disease allele D is cut by Sma3AI: ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA Healthy H allele is not cut: ACTGTCGATGTCGTCGTCGTAGCTGCTGAGCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTCGCATCGATCGA HH HD DD Different lengths of DNA can be separated by gel electrophoresis HH S M F HD DD A single strand of DNA will stick to its complement ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A single strand of DNA will stick to its 60°C complement ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A single strand of DNA will stick to its 95°C complement ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A single strand of DNA will stick to its 60°C complement ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A single strand of DNA will stick to its complement 1. Begin with genomic DNA 2. Digest with restriction enzyme 3. Separate on agarose gel 4. Stain with EtBr 5. Transfer to solid support 6. Probe with labeled DNA A single strand of DNA will stick to its complement Southern blotting (named after Ed Southern) A single strand of DNA will stick to its complement A single strand of DNA will stick to its complement 1 2 DNA can copied by a polymerase enzyme ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA can copied by a polymerase enzyme G A G A C C DNA polymerase T A G T G G ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A A G T C A C C A G A C T T A G T G DNA can copied by a polymerase enzyme G A G A C C DNA polymerase T A G T G G ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA A A G T C A C C A G A C T T A G T G DNA can copied by a polymerase enzyme ACTGTCGATGTCGT DNA can copied by a polymerase enzyme ACTGT ACTGTCGAT ACTGTCGATGT ACTGTCGATGTCGT ACTGTCGATGTCGTCGT ACTGTCGATGTCGTCGTCGT ACTGTCGATGTCGTCGTCGTAGCT ACTGTCGATGTCGTCGTCGTAGCTGCT ACTGTCGATGTCGTCGTCGTAGCTGCTGAT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT DNA can copied by a polymerase enzyme DNA can copied by a polymerase enzyme DNA can copied by a polymerase enzyme Polymerase chain reaction (PCR) • A method for producing large (and therefore analysable) quantities of a specific region of DNA from tiny quantities • PCR works by doubling the quantity of the target sequence through repeated cycles of separation and synthesis of DNA strands DNA can copied by a polymerase enzyme DNA can copied by a polymerase enzyme G A C T A thermal cycler (PCR machine) Forward Reverse G, A, C, T primer Heat resistant DNA DNA template primer bases polymerase DNA can copied by a polymerase enzyme DNA can copied by a polymerase enzyme Increase in DNA quantity in PCR 1.0E+11 Quantity of DNA relative to initial sample 1.0E+10 1.0E+09 Theory Practice 1.0E+08 1.0E+07 1.0E+06 1.0E+05 1.0E+04 1.0E+03 1.0E+02 1.0E+01 1.0E+00 0 5 10 15 20 Cycle number 25 30 35 DNA can copied by a polymerase enzyme Taq DNA polymerase Thermus Aquaticus Hot springs DNA can copied by a polymerase enzyme In the words of its inventor, Kary Mullis… • • • • PCR can generate 100 billion copies from a single DNA molecule in an afternoon PCR is easy to execute The DNA sample can be pure, or it can be a minute part of an extremely complex mixture of biological materials The DNA may come from – a hospital tissue specimen – a single human hair – a drop of dried blood at the scene of a crime – the tissues of a mummified brain – a 40,000-year-old wooly mammoth frozen in a glacier. DNA can copied by a polymerase enzyme Microarrays Gene expression • Transcription: – DNA gene → mRNA – in nucleus • Translation: – mRNA → protein – in cytoplasm • Microarrays use mRNA as a marker of gene expression Nucleus Cytoplasm What are microarrays? • A microarray is a DNA “chip” which holds 1000s of different DNA sequences • Each DNA sequence might represent a different gene • Microarrays are useful for measuring differences in gene expression between two cell types • They can also be used to study chromosomal aberrations in cancer cells Principles behind microarray analysis • Almost every cell in the body contains all ~35,000 genes • Only a fraction is switched on (expressed) at any time in any cell type • Gene expression involves the production of specific messenger RNA (mRNA) • Presence and quantity of mRNA can be detected by hybridization to known RNA (or DNA) sequences What can microarray analysis tell us? • Which genes are involved in – disease? – drug response? • Which genes are – switched off/underexpressed? – switched on/overexpressed? Microarray analysis: probe preparation Microarray analysis: target preparation 50 x 50 array = 2500 genes sampled Microarrays can be used to diagnose and stage tumours, and to find genes involved in tumorigenesis • Copy number changes are common in tumours • Loss or duplication of a gene can be a critical stage in tumour development Chromosome 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 202122 BMC Cancer 2006, 6:96 Problems of microarray analysis • • • • Gene expression ≠ mRNA concentration Easy to do, difficult to interpret Standardization between labs Lots of noise, lots of genes (parameters) – e.g. p = 10,000 • low sample size – e.g. n = 3