Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download "PCR-based Species Identification and Gene Tagging"
Document related concepts
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetically modified organism containment and escape wikipedia , lookup
Non-coding DNA wikipedia , lookup
Pathogenomics wikipedia , lookup
DNA barcoding wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Designer baby wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Metagenomics wikipedia , lookup
Genomic library wikipedia , lookup
Genetically modified crops wikipedia , lookup
SNP genotyping wikipedia , lookup
Genome editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Helitron (biology) wikipedia , lookup
Transcript
"PCR-based Species Identification and Gene Tagging" Clint Magill, Ramasamy Perumal, C-L Yao Department of Plant Pathology & Microbiology TAMU The Species to ID • Downy Mildews – Peronosclerospora sorghi – P. maydis – P. sacchari – P. philippinensis* – Sclerospora graminicola – Peronospora sparsa Primary Host Sorghum Maize Sugarcane all the above pearl millet rose Common Characteristics of these Pathogens • • • Oomycetes-not true fungi Asexual conidia if dew Oospores from sexual reproduction in crop residue • Obligate parasites – Can’t grow in pure culture – Can’t cross on demand • • • Species differ in host preference and size of asexual “conidia” Unknown genome size No “marker” mutants or gene maps P. sorghi • conidia-asexual spores • antheridum and oogonium forming in leaf tissue • Chenglin Yao, PhD – China quarantine service – Protect against P. philippinensis – Classify via average spore size in grain samples? – We have P. sorghi Can we use pathogen DNA to detect the pathogen ? Detection of infected progeny from a systemically infected maize plant via dot-blot hybridization using genomic P. sorghi gDNA Can we use DNA to differentiate closely related species? Peronosclerosporsa DNA PvuI digests sorghi-Thailand sorghi-Thailand maydis sacchari-G-maize leaf sacchari-Y-maize leaf philip/cane leaf sacchari/cane leaf sorghi/maize leaf sorghi-3 leaf sorghi pt1/leaf srghi pt-3 srghi pt-1 Probe: P. maydis gDNA Probe Development- P. sorghi Repeated Sequence Clones, Hybridized to P. sorghi gDNA Probe Development- P. sorghi Repeated Sequence Clones, Hybridized to P. maydis gDNA Peronosclerosporsa DNA PvuI digests sorghi-Thailand sorghi-Thailand maydis sacchari-G-maize leaf sacchari-Y-maize leaf philip/cane leaf sacchari/cane leaf sorghi/maize leaf sorghi-3 leaf sorghi pt1/leaf srghi pt-3 srghi pt-1 Probe: pMLY987 Peronosclerosporsa DNA PvuI digests sorghi-Thailand sorghi-Thailand maydis sacchari-G-maize leaf sacchari-Y-maize leaf philip/cane leaf sacchari/cane leaf sorghi/maize leaf sorghi-3 leaf sorghi pt1/leaf srghi pt-3 srghi pt-1 Probe: pCLY83 Dot-blot sensitivity test-probe pMLY12 ng of DNA P. sorghi pathotype 1 P. sorghi pathotype 3 pt1-Infected sorghum leaf pt3-Infected sorghum leaf “Botswana”-Infected maize leaf Dot-Blot Hybridizations; proble pMLY12 P. sorghi Colletotrichm graminicola Infected seed, with glume Acremonium strictum Healthy seed, with glume Fusarium moniliforme Infected seed, no glume Infected seed, glumes 40d Healthy seed, no glume Infected seed, no glumes 40d How about converting clones to sequences for PCR? P sorghi/Thailand-2 P sorghi/Thailand-1 P. maydis P. sacchari/maize leaf P. sacchari/maize leaf P. phillip.//cane leaf P. sacchari/cane leaf maize leaf _Bots infected leaf pt3 infected leaf pt1 P sorghi pt3 P sorghi pt1 Marker 1 kb PCR using pCLY83 based primers P sorghi/Thailand-2 P sorghi/Thailand-1 P. maydis P. sacchari/maize leaf P. sacchari/maize leaf P. phillip.//cane leaf P. sacchari/cane leaf maize leaf _Bots infected leaf pt3 infected leaf pt1 P sorghi pt3 P sorghi pt1 Marker 1 kb PCR using pMLY12 based primers This sequence has been used to develop Real Time PCR primers & probe for rapid detection of SDM Are other regions useful for species comparisons? How about rDNA? -present in many copies per genome -extremely conserved in LS and SS regions -sequences maintained by “concerted evolution” -nontranscribed spacers between units -internal spacers cut out after transcription -data from other species suggest these represent species-specific sequences 16s rDNA 5 1 26s rDNA 3 ITS1 2 ITS2 4 5.8s Primer sites for conserved fungal ITS primers as described by White, Lee, Bruns and Taylor P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 Marker Cfo I Hpa II MspI Sau 3AI flanking PCR Fragments detected with P. sorghi rRNA probe P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 P. sacchari P. maydis P. sorghi Thai2 P. sorghi Thai1 P. sorghi pt1 ITS 2 & 5.8s ITS 1 M M PCR using conserved ITS primers Peronosopora sparsa • “downy mildew of roses” QuickTime™ and a Photo - JPEG decompressor are needed to see this picture. • Imported from California? • MS Thesis, Sharon Ross QuickTime™ and a Photo - JPEG decompressor are needed to see this picture. RDM ITS1+5.8+2 Sgr5 .8fo r1 DMITS2For ITS3 Sgr5 .8fo r2 RDMF1 16 srRNA Fu n5.8 For synITS2f 20 0 30 0 ITS-1 ITS1 DMITS2REV 5.8s rRNA RDMF7 10 0 synITS2rev RDMR4 40 0 28 s rRNA RDMR2 50 0 ITS6 60 0 70 0 80 0 90 0 10 00 11 00 ITS-2 ITS2 fu n5.8 rev DMITS1REV ITS-4 Sg2 8srev 28 sco nsrev2 12 00 Peronospora sparsa-specific ITS primers F1 Peronospora sparsa TGGCTGGCTGCTACTGGGC Peronospora tabacini---------A--G---A-A Phytophthora megakaya --- --T----G-----A Chladosporium sp G--- --GG--- -C---T Botrytis sp A-A-CTC- -CCT--T-T F7 Peronospora sparsa TATCGCGAGCGTTTGGGCCC Peronospora tabacini-----T-------CT-A-ATG Phytophthora megakaya ------------------T Chladosporium sp - --AAACT-T-GC-TAABotrytis sp -T-T-T T--T --- --G Nested Primer PCR for Peronospara sparsa ITS Sclerospora graminicola • “pearl millet downy mildew” QuickTime™ and a Photo - JPEG decompressor are needed to see this picture. • Joint project with ICRISAT • Aparna Viswinathan, MS • Dale Hess, Bamako, Mali • Sivi Siviramakrisnan, India PCR Amplification of ITS-2 Using Standard Primers 1 1.5 2.5 Magnesium concentration (mM) ITS Amplification “Oomycete’ Primers OLD NEW BLAST RESULTS - S. GRAMINICOLA ITS-2 CLONES Sequences producing high -scoring segment pairs: P Value Mali sample 1 Cryptococcus flavus strain CBS 331 18S r Filobasidiella neoformans isolate 'ZG280 0 0 Nigeria sample 69 Pseudozyma paraantarctica genes... Ustilago cynodontis inter e-160 7e-40 Burkina Faso sample 16 (ITS 2 segment) Rhizopus homothallicus strain AT Verticillium fungicola is... 9e-06 6e-04 India isolates Peronospora sparsa internal trans... Phytophthora infestans strain 17. 2e-64 1e-56 Peronospora 100 Phytophthora 59 India44-5 100 Pythium Nigeria47 100 Nigeria93 100 98 Mali4 100 Mali12 India44-15 99 Niger8 100 Niger12 100 India44-6 98 Mali1 Nigeria40 Niger4 BFaso17 BFaso2 gi|21666952 361-510 other variable sequences potentially useful for probe development • “COX” spacer between mitochondrial cytochrome oxidase I and II subunits -tubulin (intron 3 region) (single copy) • Translational elongation factor-1 (intron 4 region) COX spacer Consensus (P. sorghi) (hits are all Oomycetes) COX spacers ClustalW (v1.4) Multiple Alignment Parameters: Open Gap Penalty = 10.0; Extend Gap Penalty = 5.0; Delay Divergent = 40% Transitions: Weighted 0.055 FtDetBtudmaydis8 FtDetBtubSacchisol2 0.465 FtDetBtubsacchis4 0.065 0.048 0.057 FtDetBtubsacchis3 FtDetBtubmaydis10 FtDetBtubmaydis7 FtDetBtubmaydsi6 0.046 0.057 FTDetBtubmaydis5 FtDetBtubmaydis9 0.1 -tubulin sequence comparisons for maize vs sugarcane isolates ClustalW (v1.4) Multiple Alignment Parameters: Open Gap Penalty = 10.0; Extend Gap Penalty = 5.0; Delay Divergent = 40% Transitions: Weighted 0.281 FtDetmaydis10 0.25 FTDetsacchari3 FtDetphillEF1B 0.27 FtDetphilipEF2A FtDetphilEF1A FtDetsacch5 0.24 FTDetmaydis6 0.025 0.3 FtDetmaydis5 Phytophthpra 0.05 • EF-1 base sequence comparisons Tagging and mapping disease resistance genes in sorghum -Ramasamy Perumal -Seriba Katilé -Clint Magill Anthracnose resistance Objective: Identify DNA-based markers that co-segregate with gene “Cg1” that confers resistance to Colletotrichum graminicola Tools: AFLP & SSR markers (from BAC contig sequences) Cross: SC748-5 (resistant) by BTx 635 (susceptible) The AFLP Technique 1 2 3 4 5 6 7 8 9 10 11 12 13 14 300bp 250bp 200 &204bp 150bp 100bp 50bp ABI Genetic Capillary System EcoRI-ac/MseI-ca LI-COR system EcoRI-acc/MseI-caa AFLP amplification products from 14 Peronosclerospora sorghi isolates Lanes: 1. P1(A), 2. P3(A), 3.WHAR.01(A), 4. WHAR.01(B), 5. FUCIK(A), 6. FUCIK(B), 7. CR360(A), 8. CR360(B). 9. CR459(A), 10. CR459(B), 11. MERTA(A), 12. MERTA(B), 13. WES.(A), 14. P NEW Segregation for anthracnose resistance and susceptibility in F2 population from a cross between BTx623 (susceptible parent) and SC748-5 (resistant parent) Pedigree Year Resistant Ratio Susceptible fit 2value Resistant 235 60 3:1 3.41 Resistant 105 41 3:1 0.73 F1 reaction F2 BTx623*SC748-5 1999 2000 population This is a subset of the population tested by Mehta et al. (2005) F2 progeny selected for DNA analysis Parents: BTx 623 x (Susceptible) SC 748-5 (Resistant) F1 self pollinations Homozygous Resistant (29) Homozygous Susceptible (29) Heterozygous Segregating (13) Disease genotypes of F2 individuals verified in F3/F4 for use in gene tagging These must be correct!! Disease Scoring: College Station 1999 & 2000 College Station Georgia 2003 College Station 2004 - 4 consecutive weeks data (Dr. L. Prom, USDA) 2003 Cosegregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands. Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1 allele was 152 bp (BTx623) or 155 bp (SC748-5) Relative positions of amplified fragment length polymorphism (AFLP) and Simple Sequence repeats (SSRs) markers linked to gene cg1 in the off-end of linkage group J in a segregating population derived from the cross BTx623*SC748-5 Conclusions SC748-5 - major dominant gene AFLP - Xtxa6227 - linked in coupling phase 1.8 cM from cg1 (LG 5) SSR1- (CT)8 repeat motif - 3.5 cM [5’CCATGAATGGACTCGCTGT3’ & 5’CGGAACAGTAAAACCAACGA3’] BAC clone [117e5_04 that contains txa455(05)] First report placing a gene for resistance to Colletotrichum graminicola on the sorghum molecular marker map Identification, chromosome location, and diagnostic markers for a new gene (Shs1) for resistance to sorghum head smut Objectives: Determining the inheritance and chromosomal location of the of sorghum head smut (Sporisorium reilianum) resistance gene Shs1 from BTx635 Identification of markers linked to the Shs1 using high throughput AFLP technology Conversion of dominant AFLP marker into STSs/SCARs marker derived by cloning and sequencing specific AFLP marker Co-segregation of AFLP marker Xtxa 3450 and the Shs locus in F2:3 families derived from B1 and BTx635. The arrow to the left indicates the position of AFLP marker Xtxa 3450 (168.7bp) Segregation ratio of the F 2:3 families (B1 * BTx635) Total F 2:3 families Resistant families Susceptible families Segregation ratio 2 value 161 134 (85 – Resistant 49 –Heterozygous) 27 3:1 5.82 Markers linked to Shs locus in LG 03 AFLP marker* Designation Size of the Marker (bp) Primer Combination Map Distance (cM) Xtxa 3450 168.7 Ectg + Mccc 5.8 Xtxa 2058 279.7 Egga + Mccg 7.9 Xtxa 3823 293.9 Etac + Mctc 9.6 * http://sorgblast.tamu.edu QTL mapping of downy mildew resistance in maize QuickTime™ and a decompressor are needed to see this picture.
