Download FGF1 inhibits p53-dependent apoptosis and cell cycle arrest via an

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Signal transduction wikipedia , lookup

Extracellular matrix wikipedia , lookup

Cytokinesis wikipedia , lookup

Cell growth wikipedia , lookup

Tissue engineering wikipedia , lookup

Cell cycle wikipedia , lookup

Mitosis wikipedia , lookup

Cell encapsulation wikipedia , lookup

Organ-on-a-chip wikipedia , lookup

Apoptosis wikipedia , lookup

SULF1 wikipedia , lookup

Cell culture wikipedia , lookup

Programmed cell death wikipedia , lookup

Cellular differentiation wikipedia , lookup

Apoptosome wikipedia , lookup

List of types of proteins wikipedia , lookup

P53 wikipedia , lookup

Amitosis wikipedia , lookup

Transcript
Oncogene (2005) 24, 7839–7849
& 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00
www.nature.com/onc
FGF1 inhibits p53-dependent apoptosis and cell cycle arrest via an
intracrine pathway
Sylvina Bouleau1,2, Hélène Grimal1,2, Vincent Rincheval1,2, Nelly Godefroy1,2, Bernard Mignotte1,2,
Jean-Luc Vayssière1,2 and Flore Renaud*,1,2
1
Laboratoire de Génétique et Biologie Cellulaire, Université de Versailles/Saint Quentin-en Yvelines, CNRS FRE 2445, France;
Laboratoire de Génétique Moléculaire et Physiologique, Ecole Pratique des Hautes Etudes, 45 Avenue des Etats-Unis, 78035
Versailles Cedex, France
2
We analysed the relationships between p53-induced
apoptosis and the acidic fibroblast growth factor 1
(FGF1) survival pathway. We found that p53 activation
in rat embryonic fibroblasts induced the downregulation of
FGF1 expression. These data suggest that the fgf1 gene is
a repressed target of p53. Unlike extracellular FGF1,
which has no effect on p53-dependent pathways, intracellular FGF1 inhibits both p53-dependent apoptosis and cell
growth arrest via an intracrine pathway. FGF1 increases
MDM2 expression at both mRNA and protein levels. This
increase is associated with an acceleration of p53
degradation, which may partly account for the ability of
endogenous FGF1 to counteract p53 pathways. In the
presence of FGF1, p53 was unable to transactivate bax,
but no modification of p21 gene transactivation was
observed. As Bax is an essential component of the p53dependent apoptosis pathway, this suggests that intracellular FGF1 inhibits p53 pathways not only by decreasing
the stability of p53, but also by modifying some of its
transactivation properties. In conclusion, we showed that
p53 and FGF1 pathways may interact in the cell to
determine cell fate. Deregulation of one of these pathways
modifies the balance between cell proliferation and cell
death and may lead to tumor progression.
Oncogene (2005) 24, 7839–7849. doi:10.1038/sj.onc.1208932;
published online 1 August 2005
Keywords: FGF1; P53; apoptosis
Introduction
Apoptosis is a type of programmed cell death essential
for embryogenesis, development, and homeostasis in
multicellular organisms. Deregulation (up- or downregulation) of this process is involved in different
pathologies like neurodegenerative diseases or oncogenesis. Apoptosis may be induced by extra- or intracellular
*Correspondence: F Renaud, Laboratoire de Génétique et Biologie
cellulaire and Ecole Pratique des Hautes Etudes, 45 Avenue des EtatsUnis, 78035 Versailles, Cedex, France;
E-mail: [email protected]
Received 31 January 2005; revised 23 May 2005; accepted 10 June 2005;
published online 1 August 2005
stimuli: the addition of death factors (TNF, TGFb,
Fas ligand), the absence of survival factors (fibroblast
growth factors (FGFs), IGF-I, and neurotrophins),
genotoxic stresses and activation of the oncosuppressor
p53. Whatever the original death signal, most apoptotic
pathways converge on activation of the caspase cascade,
which leads to cell degradation. Caspase activation can
be regulated by the anti- and/or proapoptotic members
of the Bcl-2 family and by the endogenous inhibitors of
apoptosis, the IAPs (Kaufmann and Hengartner, 2001;
Ashe and Berry, 2003).
The p53 protein is a key regulator of cell growth and
apoptosis (Vogelstein et al., 2000). It is a transcription
factor that activates the expression of genes encoding
proteins involved in cell cycle arrest, such as p21,
GADD45 and 14-3-3s, or in the induction of apoptosis,
such as fas, bax, noxa, killer/dr5 and PTEN (Singh et al.,
2002). p53 can also induce apoptosis by transrepression
and transcription-independent mechanisms (Caelles
et al., 1994; Sabbatini et al., 1995; Haupt et al., 1997;
Godefroy et al., 2004). Indeed, p53 represses the
transcription of a number of genes encoding proteins
involved in cell survival and/or cell proliferation, such as
Bcl-2, cyclin B, FGF2 (a survival factor), IGF1R (a
survival factor receptor), p100aPI3K (a key element in
survival factor signal transduction) (Singh et al., 2002).
The transrepression activity of p53 clearly shows that
crosstalk between apoptosis signaling and survival
factor signal transduction is important in determining
cell fate.
FGF1, one of the 23 members of the FGF family, is a
multipotent factor involved in proliferation, differentiation and cell survival (Ornitz and Itoh, 2001). FGF
activities are usually transduced in cells by tyrosine
kinase receptors. Exogenous FGF induces FGF-R
phosphorylation, which may initiate various intracellular transduction pathways, such as those involving Ras/
MAP kinases, PLC-g and PI3K/Akt pathways (Johnson
and Williams, 1993; Powers et al., 2000; Ong et al., 2001;
Hashimoto et al., 2002). However, FGF1, like FGF2,
lacks a secretion signal peptide, suggesting that neither
of these factors are secreted by the classical secretion
mechanism, consistent with their primarily intracellular
distribution. Furthermore, FGF1, which has been
detected in the nuclei of various types of cell, contains
FGF1 inhibits p53 activity
S Bouleau et al
7840
a nuclear localization sequence (NLS) (KKPK), which
has been shown to be essential for FGF1 activity in
various cell models (Imamura et al., 1990). Finally,
various studies have shown that FGF1 may act via an
independent FGF-R pathway (Wiedlocha et al., 1994).
These data strongly suggest that FGF1 activities are
mediated by several pathways, including classical FGF
receptor-dependent pathways and an original intracrine
pathway, about which little is known.
FGF1 acts as a survival factor both in vivo and in
vitro, in various types of cell, from neuronal (Walicke
et al., 1986; Renaud et al., 1996a; Desire et al., 1998;
Raguenez et al., 1999) and epithelial cells (Renaud et al.,
1994) to fibroblasts (Tamm et al., 1991). As p53 is a key
regulator of proliferation and cell death mechanisms, we
hypothesized that FGF1 might affect p53-dependent
apoptosis. We investigated the relationships between the
FGF1 and p53 pathways using a cell line derived from
rat embryo fibroblasts (REtsAF), in which p53 activity
is temperature dependent. In this cell model, we found
that FGF1 mRNA levels decreased significantly after
p53 activation. This result, which was confirmed in
primary fibroblast cells, suggests that fgf1 is a target for
p53 repression. The overexpression of FGF1 in REtsAF
inhibited p53-dependent apoptosis and cell growth
arrest. Only intracellular FGF1 modulated the activity
of p53, suggesting the involvement of an intracrine
pathway. FGF1 increases mdm2 gene expression and
accelerates p53 degradation. We also showed that the
p53 transactivation of bax was reduced in cells expressing FGF1. These data suggest that FGF1 modulates
p53 activity by decreasing the stability of p53 and by
regulating some of its transactivation activities.
Results
p53 induces a decrease in fgf1 gene expression
We investigated whether p53 modulated fgf1 gene
expression. We used semiquantitative RT–PCR to
analyse levels of fgf1 mRNA after various time courses
of p53 activation in several rat embryonic fibroblast
(RE) cell lines (Figure 1a): REtsAF, in which p53
induces apoptosis; REtsA15, in which p53 induces cell
growth arrest and a senescence-like phenotype; and
REtsAF/Bcl-2, in which p53-dependent apoptosis is
inhibited by the overproduction of Bcl-2 (Guenal et al.,
1997). At permissive temperature (331C), p53 is inactivated by binding to the temperature sensitive mutant
form (tsA58) of the simian virus 40 large tumor antigen
(LT). The various cell lines proliferate at similar rates
and fgf1 mRNA levels are similar, regardless of cell line
or proliferation status. At restrictive temperature
(39.51C), a change in LT conformation promotes p53
release and activation. In the three cell lines studied, fgf1
mRNA levels presented similar profiles after p53
activation. In the first few hours, fgf1 mRNA levels
decreased significantly, by about 50%. This decrease
was only transient, and was maximal 4–6 h after p53
induction. A similar transient decrease was observed in
Oncogene
these cell lines for the expression of bcl-2, a classical
repressed target gene of p53 (Figure 1c). We tried to
confirm that FGF1 mRNA regulation was p53-dependent by inducing p53 activation in an independent
manner, using etoposide in REtsAF cells. Etoposide,
like temperature shift, induces the activation of p53, as
confirmed by p21 and bax transactivation (Figure 1c
and f), and leads to similar transient repression of fgf1
gene expression (Figure 1b and e). We checked that the
repressive activity of p53 was independent of the
presence of T antigen, by performing the same experiment with primary RE cells. As expected, etoposide
treatment induced a decrease in FGF1 mRNA level in
RE cells (Figure 1b and e) and an increase of p21 and
bax mRNA levels (Figure 1d and f). Thus, FGF1
mRNA level is downregulated following p53 activation
in RE, suggesting that the fgf1 gene is a target of p53
transrepressive activity.
FGF1 inhibits p53-dependent apoptosis
We investigated the relevance of fgf1 gene repression in
the p53 pathway by assessing the impact of this factor
on p53-dependent apoptosis and cell growth arrest. We
transfected REtsAF cells with a pSVL-FGF1 expression
vector (p267 (Jaye et al., 1988; Renaud et al., 1996a)).
The overproduction, by transient transfection, of FGF1
in REtsAF cells protected about 50% of the cells against
p53-dependent cell death (Figure 2a). This effect is
similar to that for the transient overproduction of Bcl-2.
We sought to confirm these results and to analyse FGF1
survival activity further by isolating stable FGF1transfected cell lines (REtsAF/FGF1) and the corresponding control cell lines, transfected with pSVL-Neo
(REtsAF/Neo). As we obtained similar results with
REtsAF/Neo cells and the parental REtsAF cells
throughout the study (data not shown), we present only
the data obtained with REtsAF/Neo cells, for the sake
of simplicity. RT–PCR (Figure 2b) and Western blotting
(Figure 4a) confirmed that the level of fgf1 expression
was higher in REtsAF/FGF1 cells than in REtsAF/Neo
cells. At permissive temperature (331C), REtsAF/FGF1
and REtsAF/Neo cells were morphologically similar
(Figure 2c). Following a shift to 39.51C, inducing
p53 activity, REtsAF/Neo cells died rapidly whereas
REtsAF/FGF1 cells survived for long periods. The
protective activity of FGF1 was observed by microscopy
(Figure 2c), cell counting (Figure 3b) and flow
cytometry, using fluorescein diacetate (FDA) and
propidium iodide (PI) staining (Figure 2d). FDA is
cleaved by intracellular esterases to generate fluorescein
in living cells. All the methods used showed that
REtsAF/FGF1 cells survived for longer than control
cells. We compared the survival of REtsAF/FGF1 and
REtsAF/Neo cells after temperature shift or etoposide
treatment to confirm that FGF1 overproduction protected cells from p53-dependent apoptosis, independently of LT. FDA analysis clearly showed that
REtsAF/FGF1 cell survival was similar after both
treatments, confirming that FGF1 is a survival factor
protecting against p53-dependent apoptosis (Figure 2e).
FGF1 inhibits p53 activity
S Bouleau et al
7841
Figure 1 p53 induces a decrease in fgf1 expression. Study of fgf1 mRNA levels after p53 activation by temperature shift in REtsAF,
REtsAF/Bcl2 and REtsA15 cell lines (a, b) and by etoposide treatment in REtsAF cells and in primary rat embryonic fibroblasts (RE)
(b). Study of p21, bax, bcl-2 mRNA levels in REtsAF cells after temperature shift (c) and in RE cells after etoposide treatment (d).
Comparison of the levels of fgf1 (e) p21 and bax (f) mRNA in REtsAF (39.51C, etoposide) and in RE (etoposide) after 4 h of p53
activation. fgf1, p21, bax, bcl-2 and gapdh mRNAs were amplified by RT–PCR and quantified using ImageQuant software as
described in the Materials and methods
FGF1 partially inhibits p53-dependent growth arrest
As p53 also induces cell cycle arrest, we investigated the
relationship between FGF1 and p53 activities in terms
of cell proliferation. In the absence of p53 induction
(331C), the overproduction of FGF1 in REtsAF/FGF1
did not affect the rate of cell proliferation (Figure 3a).
FGF1 is not a mitogenic factor for REtsAF cells.
If p53 was activated by temperature shift, the cell
fate of REtsAF/FGF1 cells completely diverged from
that of REtsAF/Neo cells. Even after a long period
at restrictive temperature (39.51C), some mitotic
REtsAF/FGF1 cells were detected by microscopy, suggesting that these cells have a lower level of antiproliferative
p53 activity. We used the crystal violet nucleus staining
method to analyse changes in the REtsAF/FGF1 and
REtsAF/Neo populations (Figure 3b). The number of
REtsAF/Neo cells decreased rapidly after temperature
shift, consistent with the ability of p53 to induce cell
cycle arrest and apoptosis. In contrast, REtsAF/FGF1
cells continued to proliferate slowly after p53 induction,
suggesting that FGF1 overproduction inhibits both p53dependent apoptosis and p53-dependent cell growth
arrest. We carried out cell cycle analysis by means of
flow cytometry, to confirm these findings (Figure 3c). At
331C, all the REtsAF-derived cell lines presented similar
distributions in the cell cycle phases: 69–76% in G1,
9–12% in S and 12–16% in G2/M phases, corresponding to proliferative cells. We previously reported that the
overproduction of Bcl-2 inhibits p53-dependent apoptosis but not p53-dependent cell cycle arrest (Rincheval
et al., 2002). After p53 induction, REtsAF/Bcl-2 cells
presented a senescent-like phenotype correlated with
arrest of the cell cycle in G2. We used these cells as
positive controls for p53-dependent cell cycle arrest.
Comparison of the cytograms obtained with REtsAF/
Neo, REtsAF/Bcl-2 and REtsAF/FGF1 cells showed
that FGF1 overproduction partly inhibited p53-dependent cell cycle arrest. Indeed, even after four days at
restrictive temperature, only 42% of REtsAF/FGF1
Oncogene
FGF1 inhibits p53 activity
S Bouleau et al
7842
Figure 2 FGF1 inhibits p53-dependent apoptosis. (a) Comparative effect of transient transfection with the vectors pSVL-neo, pSVLFGF1 and pTRE-Bcl-2. Cells were cotransfected with GFP-encoding vector. At 24 h after transfection, REtsAF cells were incubated at
39.51C for 20 h. GFP-positive viable and apoptotic cells were counted under an epifluorescence microscope on the basis of
morphological features. (b) Detection of fgf1 and gapdh mRNAs by RT–PCR in REtsAF/Neo and REtsAF/FGF1 cell lines (after
stable transfections) with or without p53 activation. (c) Morphology of the REtsAF/Neo and REtsAF/FGF1 cell lines, at 331C and
after 24 or 48 h at 39.51C, observed by light microscopy. (d) Survival of REtsAF/Neo and REtsAF/FGF1 cell lines after temperature
shift was measured by flow cytometry (FDA þ , PI). (e) Survival of REtsAF/Neo and REtsAF/FGF1 cell lines after p53 activation by
temperature increase or etoposide treatment (24 h). Survival was assessed by flow cytometry (FDA þ , PI)
cells accumulated in G2/M, versus 73% of REtsAF/
Bcl-2 cells. Furthermore, a significant proportion of
REtsAF/FGF1 cells (15%) were in S phase, suggesting
that some cells proliferate even in the presence of p53, as
shown by cell counts and microscopy. Our results show
that FGF1 overproduction inhibits p53-dependent
apoptosis and partly inhibits p53-dependent cell cycle
arrest.
FGF1 activity is mediated by an intracrine pathway in
REtsAF cells
We investigated whether FGF1 activity was mediated
by an intracrine, autocrine or paracrine pathway by
analysing the distribution of FGF1 in REtsAF cell lines.
Although expression of the gene encoding FGF1 was
detected by RT–PCR in REtsAF and REtsAF/Neo
cells, FGF1 protein levels remained very low, at the
Western blot detection limit, even after concentration by
Oncogene
heparin binding (Figure 4a). In contrast, FGF1 expression was detected at mRNA and protein level in
REtsAF/FGF1 (Figures 2b and 4a). We investigated
whether FGF1 was intra- or extracellular by using
Western blots to assess FGF1 levels in the cells and in
the conditioned medium of REtsAF/Neo and REtsAF/
FGF1 (Figure 4a). FGF1 was not detected in the
conditioned medium for either cell type, even after
concentration on heparin–sepharose and high salt
washing of the cell surface, whereas it was detected in
cell extracts whatever the culture temperature. In
REtsAF/FGF1, FGF1 was detected only in cells,
suggesting that it was not secreted. We investigated
whether the overproduction of FGF1 induced the
secretion of another survival factor by assessing the
effects of conditioned medium from REtsAF, REtsAF/
Neo and REtsAF/FGF1 cells on the survival of REtsAF
cells. In all cases, the cells died after p53 activation,
demonstrating that none of these conditioned media
FGF1 inhibits p53 activity
S Bouleau et al
7843
a
REtsAF/Neo
REtsAF/FGF1
300
250
% of living cells
800
600
400
200
200
150
100
50
1
2
3
4
days at 33°C
c
5
0
6
33°C
4
5
4 days at 39.5°C
S
18 % G2/M
54 %
B C D
Count
Count
G1
26 %
All the cells
died
0
0
1024
0
PI
1024
PI
104
Count
G1
69 %
S
12 % G2/M
B C D 18 %
0
PI
160
Count
104
G1
S
37 % 14 %
B C D
0
1024
0
PI
G2/M
48 %
S
9%
G2/M
16 %
C D
0
S
14 % G2/M
G1
42 %
44 %
B
C D
0
0
1024
PI
0
PI
G2/M
73 %
1024
160
Count
Count
G1
75 %
B
S
G1
8%
19 %
B C D
0
1024
152
176
REtsAF/FGF1
3
2 days at 39.5°C
G1
76 %
S
12 % G2/M
B C D 12 %
0
2
20
0
REtsAF/Bcl-2
1
days at 39.5°C
600
REtsAF/Neo
0
Count
0
0
1024
PI
S
G1 15.5 %
G2/M
42 %
42 %
B
C D
Count
0
39.5°C
REtsAF/Neo
REtsAF/FGF1
1000
Cell number x 103
b
33°C
0
0
1024
PI
Figure 3 FGF1 partially inhibits p53-dependent growth arrest. Evolution of REtsAF/Neo and REtsAF/FGF1 cellular population at
331C (a) and 39.51C (b) as assessed by crystal violet method. Distribution of REtsAF/Neo, REtsAF/Bcl-2 and REtsAF/FGF1 cells in
the various phases of the cell cycle at 331C and at 39.51C (days 2 and 4), as assessed by flow cytometry after DNA staining with PI (c)
protect the cells from apoptosis (Figure 4b). A coculture
study of REtsAF/GFP cells with REtsAF or REtsAF/
FGF1 cells confirmed that the apoptosis process
induced by p53 in REtsAF cells was not modified by
the presence of REtsAF/FGF1 cells (data not shown).
All these data suggest that FGF1 protects REtsAF/
FGF1 cells via an intracrine pathway. We then assessed
the effects of exogenous FGF1 on REtsAF-derived cell
lines after p53 activation (Figure 4c and d). Surprisingly,
the addition of recombinant FGF1 (1–100 ng/ml) in the
culture medium, in the presence or absence of heparin
(5–10 mg/ml), had no effect on p53-dependent apoptosis,
whether induced by temperature shift (Figure 4c) or
etoposide treatment (Figure 4d). This absence of activity
was not due to a defect in the recombinant protein,
because we showed that the same pool of factors
induced rat PC12 cell differentiation and serum-free
survival (data not shown). Endogenous FGF1 clearly
protected REtsAF-derived cell lines from p53-dependent apoptosis whereas exogenous factor did not
(Figure 4c and d). Furthermore, exogenous FGF1 did
not interfere with endogenous factor, as no modification
of the protection by endogenous factor was detected in
the presence of exogenous factor. These data suggest
that FGF1 protects REtsAF cells against p53-dependent
apoptosis via an intracrine pathway.
FGF1 activates mdm2 gene expression, decreasing the
stability of p53
Many mechanisms for the regulation of p53 activity
have been reported. The most basic concerns control
over the amount of oncosuppressor in the cell. p53
activates the synthesis of MDM2, which binds to the
oncosuppressor, and stimulates the addition of ubiquitin
groups to the C-terminus of p53, thereby promoting the
Oncogene
FGF1 inhibits p53 activity
S Bouleau et al
7844
Figure 4 FGF1 activity is mediated by an intracrine pathway in REtsAF cells. (a) Western blot detection of FGF1 in REtsAF/Neo
and REtsAF/FGF1 cells and in their respective culture media, after 2 days at 33 or 39.51C. FGF1 levels were below the detection limit
in control REtsAF/Neo cells and in culture medium, even after concentration on heparin–sepharose. (b) Culture media were recovered
from REtsAF, REtsAF/Neo and REtsAF/FGF1 cells and added to REtsAF cells. After 24 h at 39.51C, the survival of REtsAF cells
cultured with these media was assessed by flow cytometry (FDA þ , PI). Study of the effect of recombinant FGF1 (Ext FGF1, 100 ng/
ml) and heparin (Ext Hep, 10 mg/ml) on the survival of REtsAF/Neo and REtsAF/FGF1 cells after p53 activation by temperature
increase (c) or etoposide treatment (d) for 24 h. In this experiment, cells were treated with FGF1 and heparin 8 h before the temperature
switch or etoposide treatment. Survival was assessed by flow cytometry (FDA þ , PI)
degradation of this protein by the proteasome (Momand
et al., 2000). A p53-responsive element and a serumresponsive element have been characterized in the mdm2
promoter (Ries et al., 2000). We investigated whether
FGF1 modulated the activity of p53 via this pathway,
by comparing mdm2 gene expression in REtsAF/Neo
and REtsAF/FGF1 cells (Figure 5a and c). In REtsAF/
Neo cells, mdm2 mRNA level increased following the
induction of p53 by temperature shift, consistent with
the presence of a p53-responsive element in the mdm2
promoter. In REtsAF/FGF1 cells, an increase in mdm2
mRNA levels was detected even in the absence of p53
activation, suggesting that endogenous FGF1 activates
mdm2 gene transcription. The activation of p53 in
REtsAF/FGF1 amplified this increase, showing a
combination of both effects. Similar protein profiles
were obtained (Figure 5b and c). The overproduction of
FGF1 or activation of p53 separately induced an
increase in MDM2 levels, which was amplified if both
effects were combined. We then analysed the effects of
Oncogene
this regulation on the amount of p53. In REtsAF/Neo
cells, as previously described in REtsAF cells (Godefroy
et al., 2004), the release and activation of p53 at
restrictive temperature increased MDM2 levels, rapidly
followed by p53 degradation. In REtsAF/FGF1 cells, a
similar profile was obtained except that p53 degradation
was accelerated, consistent with the higher level of
MDM2 detected in these cells (Figure 5b and d).
FGF1 modifies p53 transactivation activities
We assessed the effect of FGF1 on p53 transactivation
activities by analysing the expression patterns of two
classical p53-target genes, bax and p21, in REtsAF/Neo
and REtsAF/FGF1 cells, after p53 activation (Figure 6).
In REtsAF/Neo cells, as in REtsAF cells, the levels
of bax and p21 mRNA (Figure 6a), and of the corresponding proteins (Figure 6b), increased rapidly after
temperature shift. In REtsAF/FGF1 cells, a similar
expression pattern was observed for p21. In contrast,
FGF1 inhibits p53 activity
S Bouleau et al
7845
Figure 5 FGF1 activates mdm2 expression, causing a decrease in p53 stability. (a) Study of the level of mdm2 mRNA in REtsAF/Neo
and REtsAF/FGF1 cells after p53 activation by temperature increase (0, 24, 48, 96 h at 39.51C). Mdm2 and gapdh mRNAs were
amplified by RT–PCR. (b) Western blot detection of MDM2, p53 and tubulin in REtsAF/Neo and REtsAF/FGF1 cells after
temperature shift, in the same conditions as in (a). Quantification with ImageQuant software of mdm2 mRNA and MDM2 protein
levels (c), and of p53 protein levels (d). Hatched bars correspond to quantifications in REtsAF/Neo cells and black bars to REtsAF/
FGF1 cells
the overproduction of FGF1 inhibited p53-dependent
bax transactivation. As Bax is a key element in p53dependent apoptosis, FGF1 inhibition of the p53dependent transactivation of bax may account for the
protective activity of this endogenous survival factor.
Discussion
We show here, for the first time, that p53 can regulate
fgf1 gene expression, suggesting the existence of interactions between the FGF1 and p53 pathways. In rat
embryo fibroblasts, the level of FGF1 mRNA significantly decreases following the activation of p53 by
temperature shift or etoposide treatment, suggesting
that fgf1 gene expression is under the control of p53.
The repression of the fgf1 and bcl-2 expression is
maximal from 4 to 8 h after p53 activation by
temperature shift or etoposide treatment. As p53 also
rapidly activates the transcription of mdm2, whose
product promotes p53 degradation, the transient repressive activity of p53 may be accounted for the rapid
p53 level decrease in cells. High levels of p53 seem to
be required for sustained fgf1 and bcl-2 repression in
rat fibroblasts. The mechanism underlying the transrepressive activity of p53 is not clearly understood.
P53 repression involves p53-DNA-binding consensus
sequences (survivin, 202 promoters) (D’Souza et al.,
2001; Hoffman et al., 2002), TATA box sequence (bcl-2
promoter) (Seto et al., 1992; Wu et al., 2001) or none of
these sequences. Within the FGF family, p53 has been
shown to inhibit fgf2 gene expression at the transcriptional level, but the fgf2 promoter does not contain
either a typical TATA box or a p53-DNA-binding
consensus sequence (Ueba et al., 1994). It has also been
reported that p53 inhibits fgf2 expression at posttranscriptional levels, by blocking the initiation of
translation of human fgf2 mRNA (Galy et al.,
2001a, b). fgf1 expression is mainly regulated at the
transcriptional level: different promoters, alternative
splicing and multiple polyadenylation signals generate
different fgf1 transcripts (Crumley et al., 1989; Philippe
et al., 1992, 1996; Renaud et al., 1992; Chiu et al., 2001).
The complexity of the fgf1 gene (100 kb in human) is
thought to be required for regulation of its expression
during development (Philippe et al., 1996), in a tissue and/
or cell-specific manner (Renaud et al., 1996b; Chiu et al.,
Oncogene
FGF1 inhibits p53 activity
S Bouleau et al
7846
Figure 6 FGF1 modifies p53 transactivation activities. (a) Levels
of bax and p21 mRNA in REtsAF/Neo and REtsAF/FGF1 cells
after p53 activation by an increase of temperature to 39.51C (0, 24,
48, 96 h). Gels and quantifications are presented. (b) Western blot
detection of BAX and p21 in the same conditions. Gels and
quantifications were also presented. Hatched bars correspond to
quantifications in REtsAF/Neo cells and black bars to REtsAF/
FGF1 cells
Oncogene
2001) and depending on proliferation and/or differentiation status (Renaud et al., 1994, 1996a). Characterization of the mechanism by which p53 represses fgf1 gene
expression requires examination of the four rat fgf1
promoters (Ing-Ming Chiu, personal communication) in
order to determine whether the observed regulation is
specific to one or several of these promoters, and
whether a TATA-binding protein or another cotranscription factor are required for this regulation.
Whatever the mechanism involved, our results suggest
that p53 may repress fgf1 expression, to counteract the
proliferative and/or the survival activities of this factor.
We therefore examined the effect of FGF1 on the
proapoptotic and antiproliferative activities of p53. We
found that the overproduction of FGF1, by means of
the transient or stable transfection of rat fibroblasts,
inhibited the apoptosis and cell cycle arrest induced by
p53. The activity of endogenous FGF1 is mediated
by an intracrine pathway. Indeed, FGF1 was almost
exclusively located within cells, with no secretion of
FGF1 detected in conditioned medium. The secretion of
FGF1 after heat shock treatment has been reported in
NIH3T3 cells (Jackson et al., 1992; Prudovsky et al.,
2002). However, in rat cell lines, increasing the culture
temperature (from 33 to 39.51C) had no effect on the
distribution of this protein. Furthermore, the addition
of conditioned medium from REtsAF/FGF1 cells
maintained at each of these temperatures had no effect
on the survival of parental REtsAF cells, suggesting that
FGF1 does not induce the secretion of other survival
factors, whatever the culture temperature. We also show
that the addition of recombinant FGF1 to the culture
medium has no effect on p53-dependent apoptosis,
confirming the presence of an intracrine pathway
induced by endogenous FGF1.
As a means of characterizing this new pathway, we
assessed the status of p53 and of some of its classical
targets in REtsAF/FGF1 cells. In rat fibroblast cells, the
overproduction of FGF1 induced an increase of mdm2
gene expression, confirmed at both mRNA and protein
levels. This regulation was observed in the absence of
p53 activation, suggesting that mdm2 expression is
induced by endogenous FGF1 via a p53-independent
mechanism. The increase in MDM2 levels in REtsAF/
FGF1 cells is associated with an acceleration of p53
degradation, which may partly account for the ability of
endogenous FGF1 to counteract p53 pathways. We also
found that p53 was unable to transactivate bax in the
presence of FGF1, whereas FGF1 had no effect on p21
gene transactivation. As Bax is an essential element of
the p53-dependent apoptosis pathway, these data
suggest that endogenous FGF1 inhibits p53 pathways
not only by decreasing the stability of p53, but also by
modifying some of its transactivation abilities.
Previous reports have shown that exogenous factors
such as FGF2 and IGF-I, by binding to their
corresponding receptors, activate mdm2 gene transcription and inhibit p53 activities by accelerating p53
degradation (Shaulian et al., 1997; Heron-Milhavet
and Le Roith, 2002). In this study, we showed that
endogenous FGF1 induced similar events but, unlike
FGF1 inhibits p53 activity
S Bouleau et al
7847
these other factors, it acted by means of an intracrine
pathway that appears to be independent of its receptors.
The FGF1 and IGF-I pathways diverge in two other
ways. IGF-I induces the exclusion of p53 from the
nucleus of NIH3T3 cells (Heron-Milhavet and Le Roith,
2002), whereas FGF1 had no effect on the primarily
nuclear distribution of p53 in rat fibroblasts (data not
shown). IGF-I has also been reported to activate p21
protein production in a p53-dependent manner, to
inhibit UV-induced cell death in MCF-7 cells and
mouse embryonic fibroblasts (MEF) (Murray et al.,
2003). No change in p21 gene expression was observed
in the presence of FGF1, but this factor inhibited p53dependent apoptosis and cell growth arrest. As endogenous FGF1 did not affect the proliferation of rat
fibroblasts in the absence of p53 activation, our data
also suggest that FGF1 inhibits p53-dependent cell cycle
arrest in G2 phase by means of an as yet uncharacterized
p21-independent mechanism.
Previous studies of the activity of endogenous FGF1
have suggested that FGF1 must be present in the
nucleus for this intracrine pathway. A mutant FGF1
lacking the NLS (residues 21–27) is not mitogenic in
vitro (Imamura et al., 1990). Synthetic peptides containing this NLS, delivered to NIH3T3 cells by a cellpermeable peptide import technique, stimulated DNA
synthesis in an FGF receptor-independent manner (Lin
et al., 1996). In bovine epithelial lens cells, endogenous
FGF1 is a survival factor whereas exogenous FGF1 is
mitogenic (Renaud et al., 1994). In PC12 cells, FGF1
induces differentiation and serum-free survival via an
intracrine pathway independent of MAP kinase
activation (Renaud et al., 1996a), but dependent on
the nuclear location of FGF1 (personal unpublished
data). In this context, the results of ongoing experiments
to establish the subcellular distribution of FGF1
in rat fibroblast cells as a function of p53 activation,
apoptosis rate or cell growth arrest will undoubtedly be
of interest.
In conclusion, we show here that p53 represses fgf1
gene expression. We also demonstrate that FGF1
inhibits p53-dependent apoptosis and p53-dependent
cell cycle arrest via an intracrine pathway. These data
clearly show that the p53 and FGF1 pathways interact
in the cell to determine cell fate. The deregulation of one
of these pathways modifies the balance between cell
growth arrest and cell death on the one hand, and cell
proliferation and tumor progression on the other.
Materials and methods
Cell lines, cell culture and drugs
Isolation of the primary RE, REtsAF and REtsA15 cell lines
has been described elsewhere (Petit et al., 1983; Rincheval
et al., 2002). The REtsAF/Bcl-2 (also named P1-bcl-2) cell line
is derived from REtsAF cells and overexpresses the human
bcl-2 gene (Guenal et al., 1997). Cells were cultured as
previously described (Rincheval et al., 1999). Etoposide
(Sigma, E1383) was used to induce p53-dependent cell death
in RE and REtsAF cells, at a concentration of 50 mg/ml. The
culture medium of REtsAF, REtsAF/Neo and REtsAF/FGF1
cells was recovered 2–48 h after medium replacement and
temperature shift (when the cells were shifted to 39.51C). The
medium was centrifuged for 5 min at 130 g to eliminate debris
and was then used for the culture of REtsAF cells.
Recombinant FGF1 (R&D Systems, 232-FA) was added to
the culture medium (10–100 ng/ml) in the presence or absence
of heparin (5–10 mg/ml, Sigma), 8 h before treatment. Cells
were photographed under a Nikon TMS microscope equipped
with a Nikon F601 camera.
RT–PCR assay
At 70% confluence, cells were incubated for various times at
restrictive temperature (39.51C) or with etoposide. RNA was
isolated by the guanidium isothiocyanate method (Chirgwin
et al., 1979). We used RT–PCR to determine levels of fgf1,
bcl-2, bax, p21 and mdm2 mRNAs, as previously described
(Renaud et al., 1996a), with the specific primers listed in
Table 1. We carried out 20–40 PCR cycles, depending on the
amount of mRNA. Amplified products were separated in
8% acrylamide gels, which were then stained with ethidium
bromide and photographed with a SynGene GeneStore
system. The bands were quantified with ImageQuant software.
Flow cytometry analysis
Flow cytometry was performed with an XL3C flow cytometer
(Beckham-Coulter, France). For cell viability, cells were incubated with FDA and PI, as previously described (Rincheval
et al., 2002). FDA (Polysciences) is a compound that becomes
fluorescent (free fluorescein) once cleaved by esterases in living
cells. PI (Sigma) specifically penetrates necrotic cells, which
Table 1 Sequences of the primers used in RT–PCR experiments
Specificity
Orientation
Sequence (50 –30 )
bax
ANTISENSE
SENSE
ANTISENSE
SENSE
ANTSENSE
SENSE
ANTISENSE
SENSE
ANTISENSE
SENSE
ANTISENSE
SENSE
TTCTTGGTGGATGCATCCT
GGAGCAGCTCGGAGGCG
TGAATGAAGGCTAAGGCAGAAGA
AGGCAGACCAGCCTAACAGATT
ATTCCACACTCTCGTCTTTGTC
AGCATTGTTTATAGCAGCCAAGAA
AAGCCCGTCGGTGTCCATGG
GATGGCACAGTGGATGGGAC
CACCACCGTGGCAAAGCGT
AGCCCTGTGCCACCTGTGGT
ATGGCATGGACTGTGGTCAT
ATGCCCCCATGTTTGTGATG
p21
mdm2
fgf1
bcl-2
gapdh
PCR fragment size (bp)
158
146
75
134
143
164
Oncogene
FGF1 inhibits p53 activity
S Bouleau et al
7848
have lost their plasma membrane integrity. For cell cycle
analysis, cells were fixed in 70% ethanol at 201C, rinsed
with PBS and incubated with 100 mg/ml PI and RNase A
(0.25 mg/ml) in PBS for 15 min. Cells debris (including sub-G1
cells) were excluded from cell cycle analysis.
Crystal violet staining of the nucleus
The percentage of surviving cells was evaluated by determining
the proportion of attached cells, estimated by the crystal violet
(0.1% crystal violet, 0.1 M citric acid) method, expressed as a
percentage of the zero time population or as the number of
cells in 1 ml.
Cell transfections
Transient transfection REtsAF cells were cultured on glass
plates in 35 mm dishes. At 50–70% confluence, cells were
cotransfected with a 1 : 4 dilution (0.4 mg total DNA per dish)
of GFP-encoding vector (p-EGFP-N2, Clontech) and pSVLFGF1-encoding vector (p267 (Jaye et al., 1988)), Bcl-2encoding vector (Guenal et al., 1997) or pSVL-neomycin
(pSVL-neo) resistance-encoding vector used as control
(Renaud et al., 1996a), mixed with the Lipofectamine Plust
reagent (Invitrogen), according to the manufacturer’s instructions. At 24 h after transfection, REtsAF apoptosis was
induced by incubating cells at 39.51C. After 20 h at 39.51C,
GFP-positive viable or apoptotic cells were counted with an
epifluorescence microscope, on the basis of morphological
features.
Stable transfection REtsAF cells were cultured in 100 mm
dishes. At 50–70% confluence, cells were cotransfected
with pSVL-neo (1 mg) and pSVL-FGF1 (9 mg) or transfected
with pSVL-neo (10 mg) alone used as control and mixed with
Lipofectin (Invitrogen), according to the manufacturer’s
recommendations. At 2 days after transfection, transfected
cells were amplified and selected with neomycin (0.4 mg/ml
geneticin, Invitrogen) at 331C.
Western blot analysis
At 70% confluence, cells were incubated for various times at
restrictive temperature (39.51C). Cells were washed in PBS,
collected with a scraper and frozen at 201C. Proteins
(40–100 mg) were separated by SDS–PAGE (in 18% acrylamide for FGF1, in 15% acrylamide for Bax and p21, and in
7.5% acrylamide for p53 and MDM2) and transferred onto a
PVDF membrane (Millipore). Blots were incubated with the
primary antibody (see below) overnight at 41C, and were then
incubated for 1 h, at room temperature, to horseradish
peroxidase-conjugated anti-rabbit, anti-mouse or anti-goat
immunoglobulin (Biosystem) for detection of the primary
antibody. Immunoreactive bands were detected by the
Amersham ECL kit. The antibodies used were rabbit
polyclonal anti-FGF1 (1 : 500, AB-32-NA, R&D Systems),
rabbit polyclonal anti-Bax (1 : 1000, N-20, Santa Cruz), goat
polyclonal anti-p21 (1 : 250, C-19, Santa Cruz), mouse monoclonal anti-p53 (1 : 100, Pab 122, gift from Dr E May, IRSC,
Villejuif, France), and mouse monoclonal anti-MDM2 (1 : 100,
SMP40, Santa Cruz Biotechnology). All blots were normalized
with respect to rat monoclonal antitubulin antibody (1 : 500,
MAS078, Sera-Lab) binding. We used ImageQuant software
for quantification. For FGF-1 detection, cell lysate proteins
(1 mg) or culture medium (the volume used was proportional
to the volume of protein lysate) were incubated with 150 ml of
heparin–sepharose (Amersham Pharmacia) in PBS, 0.6 M
NaCl. After one night of absorption at 41C, the heparin–
sepharose was washed twice with the binding buffer, and
heparin-binding proteins were then eluted in Laemmli buffer
for 8 h at room temperature. They were then subjected to
electrophoresis in 18% SDS–polyacrylamide gels.
Acknowledgements
We thank the Conseil Régional d’Ile-de-France, the Association pour la Recherche Contre le Cancer, the Ligue Nationale
Contre le Cancer and the Fondation pour la Recherche
Médicale, all of which contributed financially to the equipment
used in our laboratories. Sylvina Bouleau is supported by a
scholarship from the Ministère de la Jeunesse, de l’Education
Nationale et de la Recherche.
References
Ashe PC and Berry MD. (2003). Prog. Neuropsychopharmacol.
Biol. Psychiatry, 27, 199–214.
Caelles C, Helmberg A and Karin M. (1994). Nature, 370,
220–223.
Chirgwin JM, Przybyla AE, MacDonald RJ and Rutter WJ.
(1979). Biochemistry, 18, 5294–5299.
Chiu IM, Touhalisky K and Baran C. (2001). Prog. Nucleic
Acid Res. Mol. Biol., 70, 155–174.
Crumley GR, Howk R, Ravera MW and Jaye M. (1989).
Gene, 85, 489–497.
Desire L, Courtois Y and Jeanny JC. (1998). Exp. Cell. Res.,
241, 210–221.
D’Souza S, Xin H, Walter S and Choubey D. (2001). J. Biol.
Chem., 276, 298–305.
Galy B, Creancier L, Prado-Lourenco L, Prats AC and Prats
H. (2001a). Oncogene, 20, 4613–4620.
Galy B, Creancier L, Zanibellato C, Prats AC and Prats H.
(2001b). Oncogene, 20, 1669–1677.
Godefroy N, Bouleau S, Gruel G, Renaud F, Rincheval V,
Mignotte B, Tronik-Le Roux D and Vayssiere JL. (2004).
Nucleic Acids Res., 32, 4480–4490. Print 2004.
Oncogene
Guenal I, Sidoti-de Fraisse C, Gaumer S and Mignotte B.
(1997). Oncogene, 15, 347–360.
Hashimoto M, Sagara Y, Langford D, Everall IP, Mallory M,
Everson A, Digicaylioglu M and Masliah E. (2002). J. Biol.
Chem., 277, 32985–32991. Epub 2002 Jul 02.
Haupt Y, Rowan S, Shaulian E, Kazaz A, Vousden K and
Oren M. (1997). Leukemia, 11, 337–339.
Heron-Milhavet L and Le Roith D. (2002). J. Biol. Chem.,
27, 27.
Hoffman WH, Biade S, Zilfou JT, Chen J and Murphy M.
(2002). J. Biol. Chem., 277, 3247–3257. Epub 2001 Nov 19.
Imamura T, Engleka K, Zhan X, Tokita Y, Forough R,
Roeder D, Jackson A, Maier JA, Hla T and Maciag T.
(1990). Science, 249, 1567–1570.
Jackson A, Friedman S, Zhan X, Engleka KA, Forough R
and Maciag T. (1992). Proc. Natl. Acad. Sci. USA, 89,
10691–10695.
Jaye M, Lyall RM, Mudd R, Schlessinger J and Sarver N.
(1988). EMBO J., 7, 963–969.
Johnson DE and Williams LT. (1993). Adv. Cancer Res.,
60, 1–41.
FGF1 inhibits p53 activity
S Bouleau et al
7849
Kaufmann SH and Hengartner MO. (2001). Trends Cell Biol.,
11, 526–534.
Lin YZ, Yao SY and Hawiger J. (1996). J. Biol. Chem., 271,
5305–5308.
Momand J, Wu HH and Dasgupta G. (2000). Gene, 242, 15–29.
Murray SA, Zheng H, Gu L and Jim Xiao ZX. (2003).
Oncogene, 22, 1703–1711.
Ong SH, Hadari YR, Gotoh N, Guy GR, Schlessinger J and
Lax I. (2001). Proc. Natl. Acad. Sci. USA, 98, 6074–6079.
Epub 2001 May 15.
Ornitz DM and Itoh N. (2001). Genome. Biol., 2,
reviews3005.1–3005.12.
Petit CA, Gardes M and Feunteun J. (1983). Virology, 127,
74–82.
Philippe JM, Renaud F, Courtois Y and Laurent M. (1996).
DNA Cell Biol., 15, 703–715.
Philippe JM, Renaud F, Desset S, Laurent M, Mallet J,
Courtois Y and Edwards JB. (1992). Biochem. Biophys. Res.
Commun., 188, 843–850.
Powers CJ, McLeskey SW and Wellstein A. (2000). Endocr.
Relat. Cancer, 7, 165–197.
Prudovsky I, Bagala C, Tarantini F, Mandinova A, Soldi R,
Bellum S and Maciag T. (2002). J. Cell Biol., 158, 201–208.
Epub 2002 Jul 22.
Raguenez G, Desire L, Lantrua V and Courtois Y. (1999).
Biochem. Biophys. Res. Commun., 258, 745–751.
Renaud F, Desset S, Bugra K, Halley C, Philippe JM,
Courtois Y and Laurent M. (1992). Biochem. Biophys. Res.
Commun., 184, 945–952.
Renaud F, Desset S, Oliver L, Gimenez-Gallego G, Van
Obberghen E, Courtois Y and Laurent M. (1996a). J. Biol.
Chem., 271, 2801–2811.
Renaud F, El Yazidi I, Boilly-Marer Y, Courtois Y and
Laurent M. (1996b). Biochem. Biophys. Res. Commun., 219,
679–685.
Renaud F, Oliver L, Desset S, Tassin J, Romquin N,
Courtois Y and Laurent M. (1994). J. Cell. Physiol., 158,
435–443.
Ries S, Biederer C, Woods D, Shifman O, Shirasawa S,
Sasazuki T, McMahon M, Oren M and McCormick F.
(2000). Cell, 103, 321–330.
Rincheval V, Renaud F, Lemaire C, Godefroy N, Trotot P,
Boulo V, Mignotte B and Vayssiere JL. (2002). Biochem.
Biophys. Res. Commun., 298, 282–288.
Rincheval V, Renaud F, Lemaire C, Mignotte B and Vayssiere
JL. (1999). FEBS Lett., 460, 203–206.
Sabbatini P, Chiou SK, Rao L and White E. (1995). Mol. Cell.
Biol., 15, 1060–1070.
Seto E, Usheva A, Zambetti GP, Momand J, Horikoshi N,
Weinmann R, Levine AJ and Shenk T. (1992). Proc. Natl.
Acad. Sci. USA, 89, 12028–12032.
Shaulian E, Resnitzky D, Shifman O, Blandino G, Amsterdam
A, Yayon A and Oren M. (1997). Oncogene, 15,
2717–2725.
Singh B, Reddy PG, Goberdhan A, Walsh C, Dao S, Ngai I,
Chou TC, O-Charoenrat P, Levine AJ, Rao PH and Stoffel
A. (2002). Genes Dev., 16, 984–993.
Tamm I, Kikuchi T and Zychlinsky A. (1991). Proc. Natl.
Acad. Sci. USA, 88, 3372–3376.
Ueba T, Nosaka T, Takahashi JA, Shibata F, Florkiewicz RZ,
Vogelstein B, Oda Y, Kikuchi H and Hatanaka M. (1994).
Proc. Natl. Acad. Sci. USA, 91, 9009–9013.
Vogelstein B, Lane D and Levine AJ. (2000). Nature, 408,
307–310.
Walicke P, Cowan WM, Ueno N, Baird A and Guillemin R.
(1986). Proc. Natl. Acad. Sci. USA, 83, 3012–3016.
Wiedlocha A, Falnes PO, Madshus IH, Sandvig K and Olsnes
S. (1994). Cell, 76, 1039–1051.
Wu Y, Mehew JW, Heckman CA, Arcinas M and Boxer LM.
(2001). Oncogene, 20, 240–251.
Oncogene