* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download FGF1 inhibits p53-dependent apoptosis and cell cycle arrest via an
Signal transduction wikipedia , lookup
Extracellular matrix wikipedia , lookup
Cytokinesis wikipedia , lookup
Cell growth wikipedia , lookup
Tissue engineering wikipedia , lookup
Cell encapsulation wikipedia , lookup
Organ-on-a-chip wikipedia , lookup
Cell culture wikipedia , lookup
Programmed cell death wikipedia , lookup
Cellular differentiation wikipedia , lookup
Oncogene (2005) 24, 7839–7849 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc FGF1 inhibits p53-dependent apoptosis and cell cycle arrest via an intracrine pathway Sylvina Bouleau1,2, Hélène Grimal1,2, Vincent Rincheval1,2, Nelly Godefroy1,2, Bernard Mignotte1,2, Jean-Luc Vayssière1,2 and Flore Renaud*,1,2 1 Laboratoire de Génétique et Biologie Cellulaire, Université de Versailles/Saint Quentin-en Yvelines, CNRS FRE 2445, France; Laboratoire de Génétique Moléculaire et Physiologique, Ecole Pratique des Hautes Etudes, 45 Avenue des Etats-Unis, 78035 Versailles Cedex, France 2 We analysed the relationships between p53-induced apoptosis and the acidic fibroblast growth factor 1 (FGF1) survival pathway. We found that p53 activation in rat embryonic fibroblasts induced the downregulation of FGF1 expression. These data suggest that the fgf1 gene is a repressed target of p53. Unlike extracellular FGF1, which has no effect on p53-dependent pathways, intracellular FGF1 inhibits both p53-dependent apoptosis and cell growth arrest via an intracrine pathway. FGF1 increases MDM2 expression at both mRNA and protein levels. This increase is associated with an acceleration of p53 degradation, which may partly account for the ability of endogenous FGF1 to counteract p53 pathways. In the presence of FGF1, p53 was unable to transactivate bax, but no modification of p21 gene transactivation was observed. As Bax is an essential component of the p53dependent apoptosis pathway, this suggests that intracellular FGF1 inhibits p53 pathways not only by decreasing the stability of p53, but also by modifying some of its transactivation properties. In conclusion, we showed that p53 and FGF1 pathways may interact in the cell to determine cell fate. Deregulation of one of these pathways modifies the balance between cell proliferation and cell death and may lead to tumor progression. Oncogene (2005) 24, 7839–7849. doi:10.1038/sj.onc.1208932; published online 1 August 2005 Keywords: FGF1; P53; apoptosis Introduction Apoptosis is a type of programmed cell death essential for embryogenesis, development, and homeostasis in multicellular organisms. Deregulation (up- or downregulation) of this process is involved in different pathologies like neurodegenerative diseases or oncogenesis. Apoptosis may be induced by extra- or intracellular *Correspondence: F Renaud, Laboratoire de Génétique et Biologie cellulaire and Ecole Pratique des Hautes Etudes, 45 Avenue des EtatsUnis, 78035 Versailles, Cedex, France; E-mail: [email protected] Received 31 January 2005; revised 23 May 2005; accepted 10 June 2005; published online 1 August 2005 stimuli: the addition of death factors (TNF, TGFb, Fas ligand), the absence of survival factors (fibroblast growth factors (FGFs), IGF-I, and neurotrophins), genotoxic stresses and activation of the oncosuppressor p53. Whatever the original death signal, most apoptotic pathways converge on activation of the caspase cascade, which leads to cell degradation. Caspase activation can be regulated by the anti- and/or proapoptotic members of the Bcl-2 family and by the endogenous inhibitors of apoptosis, the IAPs (Kaufmann and Hengartner, 2001; Ashe and Berry, 2003). The p53 protein is a key regulator of cell growth and apoptosis (Vogelstein et al., 2000). It is a transcription factor that activates the expression of genes encoding proteins involved in cell cycle arrest, such as p21, GADD45 and 14-3-3s, or in the induction of apoptosis, such as fas, bax, noxa, killer/dr5 and PTEN (Singh et al., 2002). p53 can also induce apoptosis by transrepression and transcription-independent mechanisms (Caelles et al., 1994; Sabbatini et al., 1995; Haupt et al., 1997; Godefroy et al., 2004). Indeed, p53 represses the transcription of a number of genes encoding proteins involved in cell survival and/or cell proliferation, such as Bcl-2, cyclin B, FGF2 (a survival factor), IGF1R (a survival factor receptor), p100aPI3K (a key element in survival factor signal transduction) (Singh et al., 2002). The transrepression activity of p53 clearly shows that crosstalk between apoptosis signaling and survival factor signal transduction is important in determining cell fate. FGF1, one of the 23 members of the FGF family, is a multipotent factor involved in proliferation, differentiation and cell survival (Ornitz and Itoh, 2001). FGF activities are usually transduced in cells by tyrosine kinase receptors. Exogenous FGF induces FGF-R phosphorylation, which may initiate various intracellular transduction pathways, such as those involving Ras/ MAP kinases, PLC-g and PI3K/Akt pathways (Johnson and Williams, 1993; Powers et al., 2000; Ong et al., 2001; Hashimoto et al., 2002). However, FGF1, like FGF2, lacks a secretion signal peptide, suggesting that neither of these factors are secreted by the classical secretion mechanism, consistent with their primarily intracellular distribution. Furthermore, FGF1, which has been detected in the nuclei of various types of cell, contains FGF1 inhibits p53 activity S Bouleau et al 7840 a nuclear localization sequence (NLS) (KKPK), which has been shown to be essential for FGF1 activity in various cell models (Imamura et al., 1990). Finally, various studies have shown that FGF1 may act via an independent FGF-R pathway (Wiedlocha et al., 1994). These data strongly suggest that FGF1 activities are mediated by several pathways, including classical FGF receptor-dependent pathways and an original intracrine pathway, about which little is known. FGF1 acts as a survival factor both in vivo and in vitro, in various types of cell, from neuronal (Walicke et al., 1986; Renaud et al., 1996a; Desire et al., 1998; Raguenez et al., 1999) and epithelial cells (Renaud et al., 1994) to fibroblasts (Tamm et al., 1991). As p53 is a key regulator of proliferation and cell death mechanisms, we hypothesized that FGF1 might affect p53-dependent apoptosis. We investigated the relationships between the FGF1 and p53 pathways using a cell line derived from rat embryo fibroblasts (REtsAF), in which p53 activity is temperature dependent. In this cell model, we found that FGF1 mRNA levels decreased significantly after p53 activation. This result, which was confirmed in primary fibroblast cells, suggests that fgf1 is a target for p53 repression. The overexpression of FGF1 in REtsAF inhibited p53-dependent apoptosis and cell growth arrest. Only intracellular FGF1 modulated the activity of p53, suggesting the involvement of an intracrine pathway. FGF1 increases mdm2 gene expression and accelerates p53 degradation. We also showed that the p53 transactivation of bax was reduced in cells expressing FGF1. These data suggest that FGF1 modulates p53 activity by decreasing the stability of p53 and by regulating some of its transactivation activities. Results p53 induces a decrease in fgf1 gene expression We investigated whether p53 modulated fgf1 gene expression. We used semiquantitative RT–PCR to analyse levels of fgf1 mRNA after various time courses of p53 activation in several rat embryonic fibroblast (RE) cell lines (Figure 1a): REtsAF, in which p53 induces apoptosis; REtsA15, in which p53 induces cell growth arrest and a senescence-like phenotype; and REtsAF/Bcl-2, in which p53-dependent apoptosis is inhibited by the overproduction of Bcl-2 (Guenal et al., 1997). At permissive temperature (331C), p53 is inactivated by binding to the temperature sensitive mutant form (tsA58) of the simian virus 40 large tumor antigen (LT). The various cell lines proliferate at similar rates and fgf1 mRNA levels are similar, regardless of cell line or proliferation status. At restrictive temperature (39.51C), a change in LT conformation promotes p53 release and activation. In the three cell lines studied, fgf1 mRNA levels presented similar profiles after p53 activation. In the first few hours, fgf1 mRNA levels decreased significantly, by about 50%. This decrease was only transient, and was maximal 4–6 h after p53 induction. A similar transient decrease was observed in Oncogene these cell lines for the expression of bcl-2, a classical repressed target gene of p53 (Figure 1c). We tried to confirm that FGF1 mRNA regulation was p53-dependent by inducing p53 activation in an independent manner, using etoposide in REtsAF cells. Etoposide, like temperature shift, induces the activation of p53, as confirmed by p21 and bax transactivation (Figure 1c and f), and leads to similar transient repression of fgf1 gene expression (Figure 1b and e). We checked that the repressive activity of p53 was independent of the presence of T antigen, by performing the same experiment with primary RE cells. As expected, etoposide treatment induced a decrease in FGF1 mRNA level in RE cells (Figure 1b and e) and an increase of p21 and bax mRNA levels (Figure 1d and f). Thus, FGF1 mRNA level is downregulated following p53 activation in RE, suggesting that the fgf1 gene is a target of p53 transrepressive activity. FGF1 inhibits p53-dependent apoptosis We investigated the relevance of fgf1 gene repression in the p53 pathway by assessing the impact of this factor on p53-dependent apoptosis and cell growth arrest. We transfected REtsAF cells with a pSVL-FGF1 expression vector (p267 (Jaye et al., 1988; Renaud et al., 1996a)). The overproduction, by transient transfection, of FGF1 in REtsAF cells protected about 50% of the cells against p53-dependent cell death (Figure 2a). This effect is similar to that for the transient overproduction of Bcl-2. We sought to confirm these results and to analyse FGF1 survival activity further by isolating stable FGF1transfected cell lines (REtsAF/FGF1) and the corresponding control cell lines, transfected with pSVL-Neo (REtsAF/Neo). As we obtained similar results with REtsAF/Neo cells and the parental REtsAF cells throughout the study (data not shown), we present only the data obtained with REtsAF/Neo cells, for the sake of simplicity. RT–PCR (Figure 2b) and Western blotting (Figure 4a) confirmed that the level of fgf1 expression was higher in REtsAF/FGF1 cells than in REtsAF/Neo cells. At permissive temperature (331C), REtsAF/FGF1 and REtsAF/Neo cells were morphologically similar (Figure 2c). Following a shift to 39.51C, inducing p53 activity, REtsAF/Neo cells died rapidly whereas REtsAF/FGF1 cells survived for long periods. The protective activity of FGF1 was observed by microscopy (Figure 2c), cell counting (Figure 3b) and flow cytometry, using fluorescein diacetate (FDA) and propidium iodide (PI) staining (Figure 2d). FDA is cleaved by intracellular esterases to generate fluorescein in living cells. All the methods used showed that REtsAF/FGF1 cells survived for longer than control cells. We compared the survival of REtsAF/FGF1 and REtsAF/Neo cells after temperature shift or etoposide treatment to confirm that FGF1 overproduction protected cells from p53-dependent apoptosis, independently of LT. FDA analysis clearly showed that REtsAF/FGF1 cell survival was similar after both treatments, confirming that FGF1 is a survival factor protecting against p53-dependent apoptosis (Figure 2e). FGF1 inhibits p53 activity S Bouleau et al 7841 Figure 1 p53 induces a decrease in fgf1 expression. Study of fgf1 mRNA levels after p53 activation by temperature shift in REtsAF, REtsAF/Bcl2 and REtsA15 cell lines (a, b) and by etoposide treatment in REtsAF cells and in primary rat embryonic fibroblasts (RE) (b). Study of p21, bax, bcl-2 mRNA levels in REtsAF cells after temperature shift (c) and in RE cells after etoposide treatment (d). Comparison of the levels of fgf1 (e) p21 and bax (f) mRNA in REtsAF (39.51C, etoposide) and in RE (etoposide) after 4 h of p53 activation. fgf1, p21, bax, bcl-2 and gapdh mRNAs were amplified by RT–PCR and quantified using ImageQuant software as described in the Materials and methods FGF1 partially inhibits p53-dependent growth arrest As p53 also induces cell cycle arrest, we investigated the relationship between FGF1 and p53 activities in terms of cell proliferation. In the absence of p53 induction (331C), the overproduction of FGF1 in REtsAF/FGF1 did not affect the rate of cell proliferation (Figure 3a). FGF1 is not a mitogenic factor for REtsAF cells. If p53 was activated by temperature shift, the cell fate of REtsAF/FGF1 cells completely diverged from that of REtsAF/Neo cells. Even after a long period at restrictive temperature (39.51C), some mitotic REtsAF/FGF1 cells were detected by microscopy, suggesting that these cells have a lower level of antiproliferative p53 activity. We used the crystal violet nucleus staining method to analyse changes in the REtsAF/FGF1 and REtsAF/Neo populations (Figure 3b). The number of REtsAF/Neo cells decreased rapidly after temperature shift, consistent with the ability of p53 to induce cell cycle arrest and apoptosis. In contrast, REtsAF/FGF1 cells continued to proliferate slowly after p53 induction, suggesting that FGF1 overproduction inhibits both p53dependent apoptosis and p53-dependent cell growth arrest. We carried out cell cycle analysis by means of flow cytometry, to confirm these findings (Figure 3c). At 331C, all the REtsAF-derived cell lines presented similar distributions in the cell cycle phases: 69–76% in G1, 9–12% in S and 12–16% in G2/M phases, corresponding to proliferative cells. We previously reported that the overproduction of Bcl-2 inhibits p53-dependent apoptosis but not p53-dependent cell cycle arrest (Rincheval et al., 2002). After p53 induction, REtsAF/Bcl-2 cells presented a senescent-like phenotype correlated with arrest of the cell cycle in G2. We used these cells as positive controls for p53-dependent cell cycle arrest. Comparison of the cytograms obtained with REtsAF/ Neo, REtsAF/Bcl-2 and REtsAF/FGF1 cells showed that FGF1 overproduction partly inhibited p53-dependent cell cycle arrest. Indeed, even after four days at restrictive temperature, only 42% of REtsAF/FGF1 Oncogene FGF1 inhibits p53 activity S Bouleau et al 7842 Figure 2 FGF1 inhibits p53-dependent apoptosis. (a) Comparative effect of transient transfection with the vectors pSVL-neo, pSVLFGF1 and pTRE-Bcl-2. Cells were cotransfected with GFP-encoding vector. At 24 h after transfection, REtsAF cells were incubated at 39.51C for 20 h. GFP-positive viable and apoptotic cells were counted under an epifluorescence microscope on the basis of morphological features. (b) Detection of fgf1 and gapdh mRNAs by RT–PCR in REtsAF/Neo and REtsAF/FGF1 cell lines (after stable transfections) with or without p53 activation. (c) Morphology of the REtsAF/Neo and REtsAF/FGF1 cell lines, at 331C and after 24 or 48 h at 39.51C, observed by light microscopy. (d) Survival of REtsAF/Neo and REtsAF/FGF1 cell lines after temperature shift was measured by flow cytometry (FDA þ , PI). (e) Survival of REtsAF/Neo and REtsAF/FGF1 cell lines after p53 activation by temperature increase or etoposide treatment (24 h). Survival was assessed by flow cytometry (FDA þ , PI) cells accumulated in G2/M, versus 73% of REtsAF/ Bcl-2 cells. Furthermore, a significant proportion of REtsAF/FGF1 cells (15%) were in S phase, suggesting that some cells proliferate even in the presence of p53, as shown by cell counts and microscopy. Our results show that FGF1 overproduction inhibits p53-dependent apoptosis and partly inhibits p53-dependent cell cycle arrest. FGF1 activity is mediated by an intracrine pathway in REtsAF cells We investigated whether FGF1 activity was mediated by an intracrine, autocrine or paracrine pathway by analysing the distribution of FGF1 in REtsAF cell lines. Although expression of the gene encoding FGF1 was detected by RT–PCR in REtsAF and REtsAF/Neo cells, FGF1 protein levels remained very low, at the Western blot detection limit, even after concentration by Oncogene heparin binding (Figure 4a). In contrast, FGF1 expression was detected at mRNA and protein level in REtsAF/FGF1 (Figures 2b and 4a). We investigated whether FGF1 was intra- or extracellular by using Western blots to assess FGF1 levels in the cells and in the conditioned medium of REtsAF/Neo and REtsAF/ FGF1 (Figure 4a). FGF1 was not detected in the conditioned medium for either cell type, even after concentration on heparin–sepharose and high salt washing of the cell surface, whereas it was detected in cell extracts whatever the culture temperature. In REtsAF/FGF1, FGF1 was detected only in cells, suggesting that it was not secreted. We investigated whether the overproduction of FGF1 induced the secretion of another survival factor by assessing the effects of conditioned medium from REtsAF, REtsAF/ Neo and REtsAF/FGF1 cells on the survival of REtsAF cells. In all cases, the cells died after p53 activation, demonstrating that none of these conditioned media FGF1 inhibits p53 activity S Bouleau et al 7843 a REtsAF/Neo REtsAF/FGF1 300 250 % of living cells 800 600 400 200 200 150 100 50 1 2 3 4 days at 33°C c 5 0 6 33°C 4 5 4 days at 39.5°C S 18 % G2/M 54 % B C D Count Count G1 26 % All the cells died 0 0 1024 0 PI 1024 PI 104 Count G1 69 % S 12 % G2/M B C D 18 % 0 PI 160 Count 104 G1 S 37 % 14 % B C D 0 1024 0 PI G2/M 48 % S 9% G2/M 16 % C D 0 S 14 % G2/M G1 42 % 44 % B C D 0 0 1024 PI 0 PI G2/M 73 % 1024 160 Count Count G1 75 % B S G1 8% 19 % B C D 0 1024 152 176 REtsAF/FGF1 3 2 days at 39.5°C G1 76 % S 12 % G2/M B C D 12 % 0 2 20 0 REtsAF/Bcl-2 1 days at 39.5°C 600 REtsAF/Neo 0 Count 0 0 1024 PI S G1 15.5 % G2/M 42 % 42 % B C D Count 0 39.5°C REtsAF/Neo REtsAF/FGF1 1000 Cell number x 103 b 33°C 0 0 1024 PI Figure 3 FGF1 partially inhibits p53-dependent growth arrest. Evolution of REtsAF/Neo and REtsAF/FGF1 cellular population at 331C (a) and 39.51C (b) as assessed by crystal violet method. Distribution of REtsAF/Neo, REtsAF/Bcl-2 and REtsAF/FGF1 cells in the various phases of the cell cycle at 331C and at 39.51C (days 2 and 4), as assessed by flow cytometry after DNA staining with PI (c) protect the cells from apoptosis (Figure 4b). A coculture study of REtsAF/GFP cells with REtsAF or REtsAF/ FGF1 cells confirmed that the apoptosis process induced by p53 in REtsAF cells was not modified by the presence of REtsAF/FGF1 cells (data not shown). All these data suggest that FGF1 protects REtsAF/ FGF1 cells via an intracrine pathway. We then assessed the effects of exogenous FGF1 on REtsAF-derived cell lines after p53 activation (Figure 4c and d). Surprisingly, the addition of recombinant FGF1 (1–100 ng/ml) in the culture medium, in the presence or absence of heparin (5–10 mg/ml), had no effect on p53-dependent apoptosis, whether induced by temperature shift (Figure 4c) or etoposide treatment (Figure 4d). This absence of activity was not due to a defect in the recombinant protein, because we showed that the same pool of factors induced rat PC12 cell differentiation and serum-free survival (data not shown). Endogenous FGF1 clearly protected REtsAF-derived cell lines from p53-dependent apoptosis whereas exogenous factor did not (Figure 4c and d). Furthermore, exogenous FGF1 did not interfere with endogenous factor, as no modification of the protection by endogenous factor was detected in the presence of exogenous factor. These data suggest that FGF1 protects REtsAF cells against p53-dependent apoptosis via an intracrine pathway. FGF1 activates mdm2 gene expression, decreasing the stability of p53 Many mechanisms for the regulation of p53 activity have been reported. The most basic concerns control over the amount of oncosuppressor in the cell. p53 activates the synthesis of MDM2, which binds to the oncosuppressor, and stimulates the addition of ubiquitin groups to the C-terminus of p53, thereby promoting the Oncogene FGF1 inhibits p53 activity S Bouleau et al 7844 Figure 4 FGF1 activity is mediated by an intracrine pathway in REtsAF cells. (a) Western blot detection of FGF1 in REtsAF/Neo and REtsAF/FGF1 cells and in their respective culture media, after 2 days at 33 or 39.51C. FGF1 levels were below the detection limit in control REtsAF/Neo cells and in culture medium, even after concentration on heparin–sepharose. (b) Culture media were recovered from REtsAF, REtsAF/Neo and REtsAF/FGF1 cells and added to REtsAF cells. After 24 h at 39.51C, the survival of REtsAF cells cultured with these media was assessed by flow cytometry (FDA þ , PI). Study of the effect of recombinant FGF1 (Ext FGF1, 100 ng/ ml) and heparin (Ext Hep, 10 mg/ml) on the survival of REtsAF/Neo and REtsAF/FGF1 cells after p53 activation by temperature increase (c) or etoposide treatment (d) for 24 h. In this experiment, cells were treated with FGF1 and heparin 8 h before the temperature switch or etoposide treatment. Survival was assessed by flow cytometry (FDA þ , PI) degradation of this protein by the proteasome (Momand et al., 2000). A p53-responsive element and a serumresponsive element have been characterized in the mdm2 promoter (Ries et al., 2000). We investigated whether FGF1 modulated the activity of p53 via this pathway, by comparing mdm2 gene expression in REtsAF/Neo and REtsAF/FGF1 cells (Figure 5a and c). In REtsAF/ Neo cells, mdm2 mRNA level increased following the induction of p53 by temperature shift, consistent with the presence of a p53-responsive element in the mdm2 promoter. In REtsAF/FGF1 cells, an increase in mdm2 mRNA levels was detected even in the absence of p53 activation, suggesting that endogenous FGF1 activates mdm2 gene transcription. The activation of p53 in REtsAF/FGF1 amplified this increase, showing a combination of both effects. Similar protein profiles were obtained (Figure 5b and c). The overproduction of FGF1 or activation of p53 separately induced an increase in MDM2 levels, which was amplified if both effects were combined. We then analysed the effects of Oncogene this regulation on the amount of p53. In REtsAF/Neo cells, as previously described in REtsAF cells (Godefroy et al., 2004), the release and activation of p53 at restrictive temperature increased MDM2 levels, rapidly followed by p53 degradation. In REtsAF/FGF1 cells, a similar profile was obtained except that p53 degradation was accelerated, consistent with the higher level of MDM2 detected in these cells (Figure 5b and d). FGF1 modifies p53 transactivation activities We assessed the effect of FGF1 on p53 transactivation activities by analysing the expression patterns of two classical p53-target genes, bax and p21, in REtsAF/Neo and REtsAF/FGF1 cells, after p53 activation (Figure 6). In REtsAF/Neo cells, as in REtsAF cells, the levels of bax and p21 mRNA (Figure 6a), and of the corresponding proteins (Figure 6b), increased rapidly after temperature shift. In REtsAF/FGF1 cells, a similar expression pattern was observed for p21. In contrast, FGF1 inhibits p53 activity S Bouleau et al 7845 Figure 5 FGF1 activates mdm2 expression, causing a decrease in p53 stability. (a) Study of the level of mdm2 mRNA in REtsAF/Neo and REtsAF/FGF1 cells after p53 activation by temperature increase (0, 24, 48, 96 h at 39.51C). Mdm2 and gapdh mRNAs were amplified by RT–PCR. (b) Western blot detection of MDM2, p53 and tubulin in REtsAF/Neo and REtsAF/FGF1 cells after temperature shift, in the same conditions as in (a). Quantification with ImageQuant software of mdm2 mRNA and MDM2 protein levels (c), and of p53 protein levels (d). Hatched bars correspond to quantifications in REtsAF/Neo cells and black bars to REtsAF/ FGF1 cells the overproduction of FGF1 inhibited p53-dependent bax transactivation. As Bax is a key element in p53dependent apoptosis, FGF1 inhibition of the p53dependent transactivation of bax may account for the protective activity of this endogenous survival factor. Discussion We show here, for the first time, that p53 can regulate fgf1 gene expression, suggesting the existence of interactions between the FGF1 and p53 pathways. In rat embryo fibroblasts, the level of FGF1 mRNA significantly decreases following the activation of p53 by temperature shift or etoposide treatment, suggesting that fgf1 gene expression is under the control of p53. The repression of the fgf1 and bcl-2 expression is maximal from 4 to 8 h after p53 activation by temperature shift or etoposide treatment. As p53 also rapidly activates the transcription of mdm2, whose product promotes p53 degradation, the transient repressive activity of p53 may be accounted for the rapid p53 level decrease in cells. High levels of p53 seem to be required for sustained fgf1 and bcl-2 repression in rat fibroblasts. The mechanism underlying the transrepressive activity of p53 is not clearly understood. P53 repression involves p53-DNA-binding consensus sequences (survivin, 202 promoters) (D’Souza et al., 2001; Hoffman et al., 2002), TATA box sequence (bcl-2 promoter) (Seto et al., 1992; Wu et al., 2001) or none of these sequences. Within the FGF family, p53 has been shown to inhibit fgf2 gene expression at the transcriptional level, but the fgf2 promoter does not contain either a typical TATA box or a p53-DNA-binding consensus sequence (Ueba et al., 1994). It has also been reported that p53 inhibits fgf2 expression at posttranscriptional levels, by blocking the initiation of translation of human fgf2 mRNA (Galy et al., 2001a, b). fgf1 expression is mainly regulated at the transcriptional level: different promoters, alternative splicing and multiple polyadenylation signals generate different fgf1 transcripts (Crumley et al., 1989; Philippe et al., 1992, 1996; Renaud et al., 1992; Chiu et al., 2001). The complexity of the fgf1 gene (100 kb in human) is thought to be required for regulation of its expression during development (Philippe et al., 1996), in a tissue and/ or cell-specific manner (Renaud et al., 1996b; Chiu et al., Oncogene FGF1 inhibits p53 activity S Bouleau et al 7846 Figure 6 FGF1 modifies p53 transactivation activities. (a) Levels of bax and p21 mRNA in REtsAF/Neo and REtsAF/FGF1 cells after p53 activation by an increase of temperature to 39.51C (0, 24, 48, 96 h). Gels and quantifications are presented. (b) Western blot detection of BAX and p21 in the same conditions. Gels and quantifications were also presented. Hatched bars correspond to quantifications in REtsAF/Neo cells and black bars to REtsAF/ FGF1 cells Oncogene 2001) and depending on proliferation and/or differentiation status (Renaud et al., 1994, 1996a). Characterization of the mechanism by which p53 represses fgf1 gene expression requires examination of the four rat fgf1 promoters (Ing-Ming Chiu, personal communication) in order to determine whether the observed regulation is specific to one or several of these promoters, and whether a TATA-binding protein or another cotranscription factor are required for this regulation. Whatever the mechanism involved, our results suggest that p53 may repress fgf1 expression, to counteract the proliferative and/or the survival activities of this factor. We therefore examined the effect of FGF1 on the proapoptotic and antiproliferative activities of p53. We found that the overproduction of FGF1, by means of the transient or stable transfection of rat fibroblasts, inhibited the apoptosis and cell cycle arrest induced by p53. The activity of endogenous FGF1 is mediated by an intracrine pathway. Indeed, FGF1 was almost exclusively located within cells, with no secretion of FGF1 detected in conditioned medium. The secretion of FGF1 after heat shock treatment has been reported in NIH3T3 cells (Jackson et al., 1992; Prudovsky et al., 2002). However, in rat cell lines, increasing the culture temperature (from 33 to 39.51C) had no effect on the distribution of this protein. Furthermore, the addition of conditioned medium from REtsAF/FGF1 cells maintained at each of these temperatures had no effect on the survival of parental REtsAF cells, suggesting that FGF1 does not induce the secretion of other survival factors, whatever the culture temperature. We also show that the addition of recombinant FGF1 to the culture medium has no effect on p53-dependent apoptosis, confirming the presence of an intracrine pathway induced by endogenous FGF1. As a means of characterizing this new pathway, we assessed the status of p53 and of some of its classical targets in REtsAF/FGF1 cells. In rat fibroblast cells, the overproduction of FGF1 induced an increase of mdm2 gene expression, confirmed at both mRNA and protein levels. This regulation was observed in the absence of p53 activation, suggesting that mdm2 expression is induced by endogenous FGF1 via a p53-independent mechanism. The increase in MDM2 levels in REtsAF/ FGF1 cells is associated with an acceleration of p53 degradation, which may partly account for the ability of endogenous FGF1 to counteract p53 pathways. We also found that p53 was unable to transactivate bax in the presence of FGF1, whereas FGF1 had no effect on p21 gene transactivation. As Bax is an essential element of the p53-dependent apoptosis pathway, these data suggest that endogenous FGF1 inhibits p53 pathways not only by decreasing the stability of p53, but also by modifying some of its transactivation abilities. Previous reports have shown that exogenous factors such as FGF2 and IGF-I, by binding to their corresponding receptors, activate mdm2 gene transcription and inhibit p53 activities by accelerating p53 degradation (Shaulian et al., 1997; Heron-Milhavet and Le Roith, 2002). In this study, we showed that endogenous FGF1 induced similar events but, unlike FGF1 inhibits p53 activity S Bouleau et al 7847 these other factors, it acted by means of an intracrine pathway that appears to be independent of its receptors. The FGF1 and IGF-I pathways diverge in two other ways. IGF-I induces the exclusion of p53 from the nucleus of NIH3T3 cells (Heron-Milhavet and Le Roith, 2002), whereas FGF1 had no effect on the primarily nuclear distribution of p53 in rat fibroblasts (data not shown). IGF-I has also been reported to activate p21 protein production in a p53-dependent manner, to inhibit UV-induced cell death in MCF-7 cells and mouse embryonic fibroblasts (MEF) (Murray et al., 2003). No change in p21 gene expression was observed in the presence of FGF1, but this factor inhibited p53dependent apoptosis and cell growth arrest. As endogenous FGF1 did not affect the proliferation of rat fibroblasts in the absence of p53 activation, our data also suggest that FGF1 inhibits p53-dependent cell cycle arrest in G2 phase by means of an as yet uncharacterized p21-independent mechanism. Previous studies of the activity of endogenous FGF1 have suggested that FGF1 must be present in the nucleus for this intracrine pathway. A mutant FGF1 lacking the NLS (residues 21–27) is not mitogenic in vitro (Imamura et al., 1990). Synthetic peptides containing this NLS, delivered to NIH3T3 cells by a cellpermeable peptide import technique, stimulated DNA synthesis in an FGF receptor-independent manner (Lin et al., 1996). In bovine epithelial lens cells, endogenous FGF1 is a survival factor whereas exogenous FGF1 is mitogenic (Renaud et al., 1994). In PC12 cells, FGF1 induces differentiation and serum-free survival via an intracrine pathway independent of MAP kinase activation (Renaud et al., 1996a), but dependent on the nuclear location of FGF1 (personal unpublished data). In this context, the results of ongoing experiments to establish the subcellular distribution of FGF1 in rat fibroblast cells as a function of p53 activation, apoptosis rate or cell growth arrest will undoubtedly be of interest. In conclusion, we show here that p53 represses fgf1 gene expression. We also demonstrate that FGF1 inhibits p53-dependent apoptosis and p53-dependent cell cycle arrest via an intracrine pathway. These data clearly show that the p53 and FGF1 pathways interact in the cell to determine cell fate. The deregulation of one of these pathways modifies the balance between cell growth arrest and cell death on the one hand, and cell proliferation and tumor progression on the other. Materials and methods Cell lines, cell culture and drugs Isolation of the primary RE, REtsAF and REtsA15 cell lines has been described elsewhere (Petit et al., 1983; Rincheval et al., 2002). The REtsAF/Bcl-2 (also named P1-bcl-2) cell line is derived from REtsAF cells and overexpresses the human bcl-2 gene (Guenal et al., 1997). Cells were cultured as previously described (Rincheval et al., 1999). Etoposide (Sigma, E1383) was used to induce p53-dependent cell death in RE and REtsAF cells, at a concentration of 50 mg/ml. The culture medium of REtsAF, REtsAF/Neo and REtsAF/FGF1 cells was recovered 2–48 h after medium replacement and temperature shift (when the cells were shifted to 39.51C). The medium was centrifuged for 5 min at 130 g to eliminate debris and was then used for the culture of REtsAF cells. Recombinant FGF1 (R&D Systems, 232-FA) was added to the culture medium (10–100 ng/ml) in the presence or absence of heparin (5–10 mg/ml, Sigma), 8 h before treatment. Cells were photographed under a Nikon TMS microscope equipped with a Nikon F601 camera. RT–PCR assay At 70% confluence, cells were incubated for various times at restrictive temperature (39.51C) or with etoposide. RNA was isolated by the guanidium isothiocyanate method (Chirgwin et al., 1979). We used RT–PCR to determine levels of fgf1, bcl-2, bax, p21 and mdm2 mRNAs, as previously described (Renaud et al., 1996a), with the specific primers listed in Table 1. We carried out 20–40 PCR cycles, depending on the amount of mRNA. Amplified products were separated in 8% acrylamide gels, which were then stained with ethidium bromide and photographed with a SynGene GeneStore system. The bands were quantified with ImageQuant software. Flow cytometry analysis Flow cytometry was performed with an XL3C flow cytometer (Beckham-Coulter, France). For cell viability, cells were incubated with FDA and PI, as previously described (Rincheval et al., 2002). FDA (Polysciences) is a compound that becomes fluorescent (free fluorescein) once cleaved by esterases in living cells. PI (Sigma) specifically penetrates necrotic cells, which Table 1 Sequences of the primers used in RT–PCR experiments Specificity Orientation Sequence (50 –30 ) bax ANTISENSE SENSE ANTISENSE SENSE ANTSENSE SENSE ANTISENSE SENSE ANTISENSE SENSE ANTISENSE SENSE TTCTTGGTGGATGCATCCT GGAGCAGCTCGGAGGCG TGAATGAAGGCTAAGGCAGAAGA AGGCAGACCAGCCTAACAGATT ATTCCACACTCTCGTCTTTGTC AGCATTGTTTATAGCAGCCAAGAA AAGCCCGTCGGTGTCCATGG GATGGCACAGTGGATGGGAC CACCACCGTGGCAAAGCGT AGCCCTGTGCCACCTGTGGT ATGGCATGGACTGTGGTCAT ATGCCCCCATGTTTGTGATG p21 mdm2 fgf1 bcl-2 gapdh PCR fragment size (bp) 158 146 75 134 143 164 Oncogene FGF1 inhibits p53 activity S Bouleau et al 7848 have lost their plasma membrane integrity. For cell cycle analysis, cells were fixed in 70% ethanol at 201C, rinsed with PBS and incubated with 100 mg/ml PI and RNase A (0.25 mg/ml) in PBS for 15 min. Cells debris (including sub-G1 cells) were excluded from cell cycle analysis. Crystal violet staining of the nucleus The percentage of surviving cells was evaluated by determining the proportion of attached cells, estimated by the crystal violet (0.1% crystal violet, 0.1 M citric acid) method, expressed as a percentage of the zero time population or as the number of cells in 1 ml. Cell transfections Transient transfection REtsAF cells were cultured on glass plates in 35 mm dishes. At 50–70% confluence, cells were cotransfected with a 1 : 4 dilution (0.4 mg total DNA per dish) of GFP-encoding vector (p-EGFP-N2, Clontech) and pSVLFGF1-encoding vector (p267 (Jaye et al., 1988)), Bcl-2encoding vector (Guenal et al., 1997) or pSVL-neomycin (pSVL-neo) resistance-encoding vector used as control (Renaud et al., 1996a), mixed with the Lipofectamine Plust reagent (Invitrogen), according to the manufacturer’s instructions. At 24 h after transfection, REtsAF apoptosis was induced by incubating cells at 39.51C. After 20 h at 39.51C, GFP-positive viable or apoptotic cells were counted with an epifluorescence microscope, on the basis of morphological features. Stable transfection REtsAF cells were cultured in 100 mm dishes. At 50–70% confluence, cells were cotransfected with pSVL-neo (1 mg) and pSVL-FGF1 (9 mg) or transfected with pSVL-neo (10 mg) alone used as control and mixed with Lipofectin (Invitrogen), according to the manufacturer’s recommendations. At 2 days after transfection, transfected cells were amplified and selected with neomycin (0.4 mg/ml geneticin, Invitrogen) at 331C. Western blot analysis At 70% confluence, cells were incubated for various times at restrictive temperature (39.51C). Cells were washed in PBS, collected with a scraper and frozen at 201C. Proteins (40–100 mg) were separated by SDS–PAGE (in 18% acrylamide for FGF1, in 15% acrylamide for Bax and p21, and in 7.5% acrylamide for p53 and MDM2) and transferred onto a PVDF membrane (Millipore). Blots were incubated with the primary antibody (see below) overnight at 41C, and were then incubated for 1 h, at room temperature, to horseradish peroxidase-conjugated anti-rabbit, anti-mouse or anti-goat immunoglobulin (Biosystem) for detection of the primary antibody. Immunoreactive bands were detected by the Amersham ECL kit. The antibodies used were rabbit polyclonal anti-FGF1 (1 : 500, AB-32-NA, R&D Systems), rabbit polyclonal anti-Bax (1 : 1000, N-20, Santa Cruz), goat polyclonal anti-p21 (1 : 250, C-19, Santa Cruz), mouse monoclonal anti-p53 (1 : 100, Pab 122, gift from Dr E May, IRSC, Villejuif, France), and mouse monoclonal anti-MDM2 (1 : 100, SMP40, Santa Cruz Biotechnology). All blots were normalized with respect to rat monoclonal antitubulin antibody (1 : 500, MAS078, Sera-Lab) binding. We used ImageQuant software for quantification. For FGF-1 detection, cell lysate proteins (1 mg) or culture medium (the volume used was proportional to the volume of protein lysate) were incubated with 150 ml of heparin–sepharose (Amersham Pharmacia) in PBS, 0.6 M NaCl. After one night of absorption at 41C, the heparin– sepharose was washed twice with the binding buffer, and heparin-binding proteins were then eluted in Laemmli buffer for 8 h at room temperature. They were then subjected to electrophoresis in 18% SDS–polyacrylamide gels. Acknowledgements We thank the Conseil Régional d’Ile-de-France, the Association pour la Recherche Contre le Cancer, the Ligue Nationale Contre le Cancer and the Fondation pour la Recherche Médicale, all of which contributed financially to the equipment used in our laboratories. Sylvina Bouleau is supported by a scholarship from the Ministère de la Jeunesse, de l’Education Nationale et de la Recherche. References Ashe PC and Berry MD. (2003). Prog. Neuropsychopharmacol. Biol. Psychiatry, 27, 199–214. Caelles C, Helmberg A and Karin M. (1994). Nature, 370, 220–223. Chirgwin JM, Przybyla AE, MacDonald RJ and Rutter WJ. (1979). Biochemistry, 18, 5294–5299. Chiu IM, Touhalisky K and Baran C. (2001). Prog. Nucleic Acid Res. Mol. Biol., 70, 155–174. Crumley GR, Howk R, Ravera MW and Jaye M. (1989). Gene, 85, 489–497. Desire L, Courtois Y and Jeanny JC. (1998). Exp. Cell. Res., 241, 210–221. D’Souza S, Xin H, Walter S and Choubey D. (2001). J. Biol. Chem., 276, 298–305. Galy B, Creancier L, Prado-Lourenco L, Prats AC and Prats H. (2001a). Oncogene, 20, 4613–4620. Galy B, Creancier L, Zanibellato C, Prats AC and Prats H. (2001b). Oncogene, 20, 1669–1677. Godefroy N, Bouleau S, Gruel G, Renaud F, Rincheval V, Mignotte B, Tronik-Le Roux D and Vayssiere JL. (2004). Nucleic Acids Res., 32, 4480–4490. Print 2004. Oncogene Guenal I, Sidoti-de Fraisse C, Gaumer S and Mignotte B. (1997). Oncogene, 15, 347–360. Hashimoto M, Sagara Y, Langford D, Everall IP, Mallory M, Everson A, Digicaylioglu M and Masliah E. (2002). J. Biol. Chem., 277, 32985–32991. Epub 2002 Jul 02. Haupt Y, Rowan S, Shaulian E, Kazaz A, Vousden K and Oren M. (1997). Leukemia, 11, 337–339. Heron-Milhavet L and Le Roith D. (2002). J. Biol. Chem., 27, 27. Hoffman WH, Biade S, Zilfou JT, Chen J and Murphy M. (2002). J. Biol. Chem., 277, 3247–3257. Epub 2001 Nov 19. Imamura T, Engleka K, Zhan X, Tokita Y, Forough R, Roeder D, Jackson A, Maier JA, Hla T and Maciag T. (1990). Science, 249, 1567–1570. Jackson A, Friedman S, Zhan X, Engleka KA, Forough R and Maciag T. (1992). Proc. Natl. Acad. Sci. USA, 89, 10691–10695. Jaye M, Lyall RM, Mudd R, Schlessinger J and Sarver N. (1988). EMBO J., 7, 963–969. Johnson DE and Williams LT. (1993). Adv. Cancer Res., 60, 1–41. FGF1 inhibits p53 activity S Bouleau et al 7849 Kaufmann SH and Hengartner MO. (2001). Trends Cell Biol., 11, 526–534. Lin YZ, Yao SY and Hawiger J. (1996). J. Biol. Chem., 271, 5305–5308. Momand J, Wu HH and Dasgupta G. (2000). Gene, 242, 15–29. Murray SA, Zheng H, Gu L and Jim Xiao ZX. (2003). Oncogene, 22, 1703–1711. Ong SH, Hadari YR, Gotoh N, Guy GR, Schlessinger J and Lax I. (2001). Proc. Natl. Acad. Sci. USA, 98, 6074–6079. Epub 2001 May 15. Ornitz DM and Itoh N. (2001). Genome. Biol., 2, reviews3005.1–3005.12. Petit CA, Gardes M and Feunteun J. (1983). Virology, 127, 74–82. Philippe JM, Renaud F, Courtois Y and Laurent M. (1996). DNA Cell Biol., 15, 703–715. Philippe JM, Renaud F, Desset S, Laurent M, Mallet J, Courtois Y and Edwards JB. (1992). Biochem. Biophys. Res. Commun., 188, 843–850. Powers CJ, McLeskey SW and Wellstein A. (2000). Endocr. Relat. Cancer, 7, 165–197. Prudovsky I, Bagala C, Tarantini F, Mandinova A, Soldi R, Bellum S and Maciag T. (2002). J. Cell Biol., 158, 201–208. Epub 2002 Jul 22. Raguenez G, Desire L, Lantrua V and Courtois Y. (1999). Biochem. Biophys. Res. Commun., 258, 745–751. Renaud F, Desset S, Bugra K, Halley C, Philippe JM, Courtois Y and Laurent M. (1992). Biochem. Biophys. Res. Commun., 184, 945–952. Renaud F, Desset S, Oliver L, Gimenez-Gallego G, Van Obberghen E, Courtois Y and Laurent M. (1996a). J. Biol. Chem., 271, 2801–2811. Renaud F, El Yazidi I, Boilly-Marer Y, Courtois Y and Laurent M. (1996b). Biochem. Biophys. Res. Commun., 219, 679–685. Renaud F, Oliver L, Desset S, Tassin J, Romquin N, Courtois Y and Laurent M. (1994). J. Cell. Physiol., 158, 435–443. Ries S, Biederer C, Woods D, Shifman O, Shirasawa S, Sasazuki T, McMahon M, Oren M and McCormick F. (2000). Cell, 103, 321–330. Rincheval V, Renaud F, Lemaire C, Godefroy N, Trotot P, Boulo V, Mignotte B and Vayssiere JL. (2002). Biochem. Biophys. Res. Commun., 298, 282–288. Rincheval V, Renaud F, Lemaire C, Mignotte B and Vayssiere JL. (1999). FEBS Lett., 460, 203–206. Sabbatini P, Chiou SK, Rao L and White E. (1995). Mol. Cell. Biol., 15, 1060–1070. Seto E, Usheva A, Zambetti GP, Momand J, Horikoshi N, Weinmann R, Levine AJ and Shenk T. (1992). Proc. Natl. Acad. Sci. USA, 89, 12028–12032. Shaulian E, Resnitzky D, Shifman O, Blandino G, Amsterdam A, Yayon A and Oren M. (1997). Oncogene, 15, 2717–2725. Singh B, Reddy PG, Goberdhan A, Walsh C, Dao S, Ngai I, Chou TC, O-Charoenrat P, Levine AJ, Rao PH and Stoffel A. (2002). Genes Dev., 16, 984–993. Tamm I, Kikuchi T and Zychlinsky A. (1991). Proc. Natl. Acad. Sci. USA, 88, 3372–3376. Ueba T, Nosaka T, Takahashi JA, Shibata F, Florkiewicz RZ, Vogelstein B, Oda Y, Kikuchi H and Hatanaka M. (1994). Proc. Natl. Acad. Sci. USA, 91, 9009–9013. Vogelstein B, Lane D and Levine AJ. (2000). Nature, 408, 307–310. Walicke P, Cowan WM, Ueno N, Baird A and Guillemin R. (1986). Proc. Natl. Acad. Sci. USA, 83, 3012–3016. Wiedlocha A, Falnes PO, Madshus IH, Sandvig K and Olsnes S. (1994). Cell, 76, 1039–1051. Wu Y, Mehew JW, Heckman CA, Arcinas M and Boxer LM. (2001). Oncogene, 20, 240–251. Oncogene