Download 3` Untranslated Region in Mantle- Cell Lymphomas

From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Rearrangement of CCNDl (BCLI/PRADI) 3’ Untranslated Region in MantleCell Lymphomas and t(llql3)-Associated Leukemias
By Ruth Rimokh, FranGoise Berger, Christian Bastard, Bernard Klein, Martine French, Eric Archimbaud,
Jean Pierre Rouault, Benedicte Santa Lucia, Laurent Duret, Michele Vuillaume, Bertrand Coiffier,
Paul-Andre Bryon, and Jean Pierre Magaud
Rearrangement and overexpression
of
CCNDl iBCLl/
PRADl),a member of the cyclin G, gene family, are consistent features of t(llql31-bearing B-lymphoidtumors (particularly mantle-cell lymphoma [MCL]). lts deregulationis
thought to perturb the G,-S transition of the cell cycle and
thereby to contribute to tumor development. As suggested
by previously published studies, rearrangement of the 3‘
untranslated region (3’ UTR) of CCNDl may contribute to
its activation in some lymphoid tumors. To define further
the prevalence ofsuch rearrangements, we report here the
result of the molecular study of 34 MCL and six t(llq13)associated leukemias using a set of probes specific to the
different parts of the CCNDl transcript. We also sequenced
the entire cDNA of the overexpressed CCNDl transcripts in
A
MAJORITY OF HUMAN hematopoietic malignancies
carry nonrandom chromosomal alterations; experimental evidence indicates that genes located at recurring
chromosomal breakpoints are directly involved in tumor
pathogenesis.’ The t(l1; 14)(q13;q32) translocation and its
molecular counterpart, bcl-l rearrangement, are consistent
features of the subtype of non-Hodgkin’s lymphoma designated centrocytic lymphoma or the similar intermediate
lymphocytic lymphoma:” now referred to as mantle-cell
lymphoma (MCL).’ As a result of this translocation, the
putative BCLUPRADI proto-oncogene, on chromosome 11,
is juxtaposed to an IgH-enhancer sequence located on chromosome 14.9 The BCLUPRADI gene is known under different names (PRADI, cyclin D l , BCLI, DllS287E). We will
refer to it as CCNDI, in accordance with the official nomenclature.” Chromosomal breakpoints are widely scattered on
chromosome 1lq13, but three hot spots have been individualized: the major translocation cluster (MTC)9lying approximately 110 kb centromeric of the CCNDl gene, and two
minor translocation clusters (mTCs), which are less frequently involved: mTCl and mTC2.I’ mTCl is localized
approximately 22 kb telomeric of MTC,” andmTC2,”.’’
which has been recently identified, maps to the 5’ flanking
region of the CCNDl gene (probe B as described by Williams et all’). CCNDl is a member of the cyclin G, familyI4-l7;its deregulation is thought to perturb the G,-S transition of the cell cycle and thereby to contribute to human
tumor development. This hypothesis is in agreement with
the finding that CCNDl is overexpressed in the vast majority
of the MCL and t( 1lql3)-associated leukemias analyzed
so far.ll.18-20
With regard to the mechanisms of activation of CCNDl
in lymphoid tumors, one can consider several possibilities.
It has beenfirst postulated that activation of CCNDl in
t( 11; 14)-carrying tumors is a consequence of its juxtaposition to an immunoglobulin &-acting sequence. According
to another hypothesis, CCNDI activation might occur at the
posttranscriptional level through rearrangement of its 3’ untranslated region (3’ UTR). In fact, in primary tumors and in
Blood, Vol 83, No 12 (June 15). 1994: pp 3689-3696
a t(llql3)-associated leukemia. DNA from four of these 40
patients showed rearrangement of the 3’ UTRof CCNDl
coexisting with major
translocation
cluster
(MTC) rearrangement. Southernblot and sequence analyses showed
the 3’ AU-rich
that, as a result of these rearrangements,
region containingsequences involved in mRNA stabilii and
in translational control is eliminated. Moreover,the finding
that the CCNDl mRNA half-life was greater than 3 hours
(normal tissues, 0.5 hours) in three t(llql3)-associated cell
linesstresses the importanceofposttranscriptional
derangement in the activation of CCNDl.Finally, we did not
observe any mutation in the coding frame of the CCNDl
cDNA analyzed.
0 1994 by The American
Society of Hematology.
cell lines with chromosome 1lq13 structural abnormalities, a
1S-kb mRNA can be detected in addition to the normal 4.5kb mRNA. Sequencing of CCNDl cDNA in a few cell lines
has shown that the smaller transcript corresponds to a shortened form of the normal 4.5-kb transcript as a result of the
use of different polyadenylation signals or of deletions of
the 3’ end of the gene.’5,’6,’9
These data suggested that, in
some cases, activation of CCNDl might result from the loss
of 3‘ regulatory sequences, which are known tobe implicated
in mRNA stability and in translational control. Finally, sequence analysis of the CCNDl coding region in primary
human tumors has shown that amino acid sustitutions are
not required for CCNDl’s oncogenic effects.”
The aim of the present study was to determine the incidence and the consequences on the transcription rate of rearrangement of the 3’ UTR of CCNDl in primary human
tumors. For this purpose, we first sequenced the coding region and the 3’ UTR ofthe overexpressed CCNDl transcripts
in one t(llql3)-associated leukemia. Wenext
analyzed
breakpoints that map to the CCNDI 3’ UTR in a large series
of MCL and t(l lql3)-associated leukemias by using a set
Fromthe Luboratoire de CytoginitiqueMoliculaire andthe
Laboratoire d’Anatomie Pathologique, Hbpital Edouard Herriot,
Lyon, France; Laboratoire deCytoginitique, CRTS, Bois Guillaume, France: and Dipartement d’Himatologie, Centre Hospitalier
Lyon Sud, Lyon, France.
Submitted August 2, 1993; accepted February 23, 1994.
Supported by grants from INSERM (CRE 92 0108,CJF 93-08),
CNRS, Hospices Civils de Lyon, Ligue Nationale Contre le Cancer
(Comiti du Rhbne, de la Haute-Savoie et de la Sabne et Loire).
Address reprint requests to RuthRimokh, PhD, Laboratoire de
Cytoginitique Moliculaire, Pavillon E, Hbpital Edouard Herriot,
69437 Lyon Cedex 03, France.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with I 8 U.S.C. section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
0006-4971/94/8312-0028$3.00/0
3689
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
3690
RIMOKH ET AL
of probes specific to the different parts of the CCNDl transcript. The results of MTC, mTC 1, and mTC2 rearrangement
analysis of most of the samples presented here have been
previously reported.” Finally, when material was available,
CCNDl protein level was assessed in these tumors by Westem blot analysis.
MATERIALS AND METHODS
Tissue samples and cell lines. Thirty-three cases ofMCLwith
available frozen material were analyzed (cases no. 1 to 33). Cytogenetic data were not available for any of these MCL cases. Each case
was classified by using histologic criteria previously
We also analyzed four cases of B-cell chronic lymphocytic leukemia (B-CLL), one case of plasma-cell leukemia carrying a
t(11;14)(q13;q32) (cases no. 34 to 38), and one case ofB-CLL
carrying a variant t(l1; 19)(q13;q13) translocation (case no. 39). All
cases (no. 1 to 39) were included in a previous report.”
Cell-suspension and frozen-section immunophenotypic studies
were performed as previously reported.26 The following markers
were used in this study: IgG, IgM, IgD, IgA, K and X light chains,
B1 (CDZO), B4 (CD19), Leu-l4 (CD22), TlOl (CD5), OKT3 (CD3),
Leu-9 (CD7), and JS(CDl0). AllMCL cases were monoclonal B
cells; 24 of the 30 tested showed CD5 expression and CD10 was
positive in only seven of the 31 cases tested. All B-cell leukemias
expressed monoclonal immunoglobulin and were positive for markers of the B-cell lineage.
The Gob. cell line was derived from the leukemic cells of patient
no. 39. Malignant cells continued to proliferate in RPM1 1640 with
20% fetal calf serum only in the presence of recombinant human
interleukin-2 (rIL-2,20 to 30 IUlmL; Boehringer Mannheim, Mannheim, Germany). After 3 months of culture, rIL-2 was no longer
necessary for the cells to proliferate. It is likely that, as a consequence
of its mitogenic effect, rIL-2 favored the occurrence of secondary
genetic changes leading to growth factor-independence. Cells from
the original culture have now been growing continuously for nearly
1 year. Immunophenotype and karyotype were identical to those
seen during the initial examination.
Two cell lines carrying a t(11;14)(q13;q32) translocation: Rec-l
(referred toas case 40) established from a MCL,”and XG5, a
human myeloma cell line”; Ramos, a Burkitt’s lymphoma cell line;
reactive lymph nodes, normal tonsils, andhuman fibroblasts were
also used in this study.
DNA and RNA isolation and analysis. High-molecular weight
DNA was extracted from fresh cells or from frozen material following standard procedures. After digestion with appropriate endonucleases as recommended by the suppliers (Boehringer Mannheim),
DNA fragments were electrophoresed on 0.8% agarose gels and
transferred onto nylon filters.
Total cellular RNA was isolated from cultured cell lines or from
frozen samples by the acid guanidium thiocyanate-phenol-chloroform method. For Northern blot analysis, poly(A+) or total RNA
was size fractionated in formaldehyde-1.2% agarose gels and transferred onto nylon filters.
DNA probes and hybridization procedures. A 2.3-kb Sac1 fragment representing the MTC on chromosome 1 lq13 was a gift from
Y. Tsujimoto (Philadelphia, PA). Probes “A” and “E” arepolymerase chain reaction (PCR)-amplified DNA fragments encompassing
nucleotides 148 to 310 and2,856to
3,091, respectively, on the
human PRADl cDNA sequence.14 Probes “B,” “C,” and “D”
correspond to CCNDl cDNA subclones (Fig 1). MYC exon 3 probe
was a gift from D. Stehelin (Lille, France). Alpha-”P-labeling, prehybridization, hybridization, andwashingwere performed aspreviously described.*’
Preparation and analysis of cDNA library. Poly(A+) RNA extracted from case no. 39 was used to construct an oligo-dT-primed
human cDNA library in the lambda gtl 1 vector as recommended by
the supplier (Pharmacia, Uppsala, Sweden).
Sequencingprocedure and sequence analysis. Overlapping deletions of CCNDl cDNA cloned into Bluescript. SK(-) (Stratagene,
La Jolla, CA) were obtained by the unidirectional exonuclease 111
digestion method (Erase-a-Base System; Promega, Madison, WI).
Deletion clones were sized on agarose gels, and the inserts ofthe
selected clones were sequenced using the double-stranded DNA sequencing technique (dideoxy chain termination procedure) with
Sequenase I1 (USB, Cleveland, OH) as described by the manufacturer.
Study of CCNDI mRNA stability. Exponentially growing cells
(Rec-l, XG5, and Gob, cell lines) were treated with 10 pg/mL of
actinomycin D (Sigma Chemical, St Louis, MO). CCNDl mRNA
level was then assessed by Northern blot analysis at various times
after addition of actinomycin D. The Northern blot was sequentially
hybridized to a CCNDl probe andto a MYC exon 3 probeas a
control.
Western blot analysis. For Western blot analysis, proteins from
the pathological samples were solubilized in lysis buffer (1 50 mmol/
L NaCL, 50 mmoVL Tris-HCL, pH 8, 0.5% sodium deoxycholate,
1% Triton X100). Proteins (30 pg) from each sample were then
separated by sodium dodecyl sulfate 10% polyacrylamide slab gel
electrophoresis and electrophoretically transferred onto nitrocellulose filters. For immunodetection, the filters were incubated with a
U750 dilution of a polyclonal rabbit anti-cyclin D antibody (UBI,
New York, NY) at room temperature. After washing, fixation of the
antibody was shown by using a blotting detection kit for rabbit
antibodies (Amersham, Uppsala, Sweden). The polyclonal antibody
used in this study was raised against a peptide contained in the Cterminal domain of the protein (residues 208 to 295).
RESULTS
In a previous study, we showed that inMCL and t(1Iq 13)associated leukemias, the steady-state level of CCNDl transcript is dramatically elevated relative to anyother lymphoid
tissues” andthat a 1.5-kbmRNAis
predominantly expressed.
One case of t( 11; 19)-associated leukemia (case no. 39)
expressed, in addition to the 1.5-kb transcript, two aberrant
transcripts of 2 and 3 kb, indicating that the CCNDl mRNA
may be altered in this tumor (Fig 2 ) . To characterize further
the CCNDl transcripts in this lymphoid malignancy, a cDNA
library was made from fresh tumoral cells. Screening of this
library with probe A allowed us to isolate 12 positive clones.
Eleven clones covering less than 1,500 bp may correspond
to the 1.5-kb transcript. The longest of them was entirely
sequenced; it is almost identical to the region encompassing
nucleotides 1 to 1346 on the PRADl cDNAsequence,14
except for two base changes: (1) a G is present at nucleotide
870 instead of an A in the coding sequence; (2) a c is present
at nucleotide l100 instead of an A in the 3’ UTR. None of
the base changes observed altered the amino acid sequence
of the protein. There is no recognizable polyadenylation sequence (AATAAA) anywhere within the sequence of the 1 i
clones analyzed, and none of them contains a poly(A) tail.
However, the corresponding transcripts are polyadenylated,
since poly(A+) selection increased the signal obtained on
Northern blot (Fig 2 ) . It is likely that, in this oligo-dT-
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
REARRANGEMENT OF CCNDl 3' UNTRANSLATED REGION
MTC
CEN. +
/
3691
5'
3'
W
I
€
H
I
P
I
I
xI
-
€
I
l10 kb
B
BP
TEL.
CCND1cDNA
U
U
A
B
p
C
n
O
E
P SPP
L I . 1 . L .
39- cDNA 3 kb
&
39- cDNA1.35
kb
Fig 1. Comparison of the restriction maps of the 3' end of CCNDl with those of the normal 4.5-kb CCNDl cDNA and of two cDNA clones
isolated from case no.39. Black boxes indicate the coding region; dotted line representsthe MER11 sequence; double-headedarrow corresponds
to theCCNDT last exon; slided-horizontal lines indicate the position of the probes used in thisstudy. CEN, centromere; TEL. telomere, X, Xbd;
E, EcoRI; H, Hindlll;P, P A ; B, BsmHI; Bg, Bgfll; S, Sad.
primed library, all the cDNA clones were initiated from the
destabilizing signals AUUUApresent in thenormal trannumerous poly(A) stretches present within the 3' end of the
script are eliminated. In case no. 39, PCR amplification of
CCNDI mRNA.
genomic DNAwith primers flanking the CCNDllMERll
We also isolated a 3,013-nucleotide long cDNA clone
junction (nucleotides 2090 to 2465) yielded a 375-bp fragrepresentative of the 3-kb aberrant transcript. The first 2,275
mentwhose sequence matchedperfectlythat of the 3-kb
nucleotides of this clone are identical to nucleotides 2 to
aberrant transcript (data not shown), demonstrating that the
2276 of the PRADI cDNA ~equence,'~
with the same base
rearrangement occurred atthe genomic leveland was not
changes at positions 870 and 1 1 0 0 , and are followed by a
the result of a cloning artifact. The fact that the same base
sequence (nucleotides 2276 to 3013) unrelated to the
changes was observed in the two groups of cDNA suggests
CCNDI/PRADI gene (Fig 3). Comparison of this sequence
thatthe1.5-kb
transcript represents an alternativelyprocessed form of the 3-kb mRNA and that they both originate
with those in data bases (EMBL data base) showed that it
corresponds to a new member of the MER1 1 sequences
from the same allele.
On Southern blots containing BamHl and HindIII-cleaved
family. In fact, this region has greater than 90% similarity
with two members (HUMP45C17, HUMSIGG3) of this famDNA from case no. 39, probes D and E detected two differily of medium reiteration frequency repetitive ~ e q u e n c e s . ~ ~ ~ent
* ~rearranged bands in addition to the same germline band
(Fig 4). The first explanation of this resultisthat
reIt should be notedthat in all the analyzed cDNA clones,
arrangement of the 3' end of CCNDI corresponds to an
the CCNDl coding frame is retained and that the mRNAinsertion of the MER1 1 sequence at this site. However, as
case no. 39 is associated with a variant t(11;19)(q13;q13)
translocation, we cannot ruleoutthepossibilitythat
the
39
MER1 I sequence originates from chromosome 19 and that
the rearranged band detected by probe E corresponds to the
A T
4 34 40
der( 19) chromosome. In Fig 4, case no. 39, the intensity of
the rearranged bands differs considerably as compared with
the residual germline band. This pattern was not observed
when using probes A, B, and E (data not shown). This indicates that on the der( 11) chromosome, the 3' CCNDl UTR
corresponding to probe D was amplifiedduring the translocation process.
This observation and a previously published study" showing that the 3' end of CCNDl was rearranged in one case
of lymphoma suggested that, in some tumors, its deregulation might occur at the posttranscriptional level. To test this
hypothesis, we haveanalyzed a large series ofMCLand
t( 1 Iql3)-associated leukemias using probes specific to the
Fig 2. Northern blot analysis of CCNDl expression in MCL or leudifferent parts of the CCNDl transcript (Fig 1). Three of the
kemias with rearrangement of the CCNDT 3' UTR. (Left1 10 p g of
40 tumors (cases no. 4, 34, and 40; case no. 39 not included)
total RNAfromeach sample was processed for Northern blot analysis
showed rearrangement of the 3' end of CCNDI. Southern
as described in the Methodsand the filter was hybridized to a CCNDT
blot analysis using probes B or C detected a rearranged
probe (probe Al. (Right) 5 p g of poly(A'1 RNA (A) and 5 p g of total
RNA from case no. 39 were blottedand hybridized to probe A.
fragment in BamHI- and Sad-cleaved DNA (Fig 5). None
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
3692
RIMOKH ET A t
GCGCAGTAGCAGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCAGAAGAGCGCGAGGGAGCGCGGGGCAGCAGAAGCGAGAGCCGAGCGCGGACC 98
CAGCCAGGACCCACAGCCCTCCCCAGCTGCCCAGGAAGAGCCCCAGCCATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTAC 19 7
17
MetGluHisGlnLeuLeuCysCysGluValGluThrIleArgArgAlaTyr
CCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAG
PrOASpA~aASnLeuLeuAsnAspArgValLeuArgAlaMetLeuLysAlaGluGluThrCysAlaProSerValSerTyrPheLysCysValGlnLys
296
50
GAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAAC 39 5
G~uValLeuProSerMetArgLysIleValAlaThrTrpMetLeuGluValCysGluGluGlnLysCysGluG1uGluValPheProLeuAlaMetAsn 83
TACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACC 494
116
TyrLwAspArgPheLeuSerLeuGluProValLysLysSerArgLeuGlnLeuLeuGlyAlaThrCysMetPheValAlaSerLysHetLysGluThr
ATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACMGCTCAAG
I1eProLeuThrAlaGluLysLeuCysIleTyrThrAspAsnSerIleArgProGluGluLeuLeuGlnHetGluLeuLeuLwValASnLysLeuLyS
593
149
TGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCG 692
TrpAsnLeuAlaAlaMetThrProHisAspPheIleGluHisPheLeuSerLysMetProGluAlaGluGluAsnLysGlnIleIleArgLysHiSA~a 182
CAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTG
79 1
G1nThrPheValAlaLeuCysAlaThrAspValLysPheIleSerAsnProProSerMetValAlaAlaGlySerValValAlaAlaValGlnGlyLeu 215
AACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGACCC~GACTGCCTCCGGGCCTGCCAG89 0
ASnLwArgSerProAsnAsnPheLeuSerTyrTyrArgLeuThrArgPheLeuSerArgValIleLysCysAspProAspCysLeuArgAlaCySGln 248
GAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTG 989
28 1
GluGlnIleGluAlaLeuLeuGluSerSerLeuArgGlnAlaGlnG1nAsnHetAspProLysAlaAlaGluGluGluGluGluGluGluGluGluVal
GACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGAGGGCGCCAGGCAGGCGGGCGCCACCGCCACCCGCAGCGAGGGCGGAGCCGGCCC 1088
295
AspLeuAlaCysThrProThrAspValArgAspValAspIle
1187
CAGGTGCTCC~CTGACAGTCCCTCCTCTCCGGAGCATTTTGATACCAGAAGGGAAAGCTTCATTCTCCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTT
CCCCCTTCCATCTCTGACTTAAGCAAAAGAAAAAGATTACCCAAAAACTGTCTTTAAAAGAGAGAGAGAGAAAAAAAAAATAGTATTTGCATMCCCTG 1286
AGCGGTGGGGGAGGAGGGTTGTGCTACAGATGATAGAGGATTTTATACCCCAATAATCAACTCGTTTTTATATTAATGTACTTGTTTCTCTGTTGTAAG 1385
AATAGGCATTMCACAMGGAGGCGTCTCGGGAGAGGATTAGGTTCCATCCTTTACGTGTTTAAAAAAAAGCATAAAAACATTTTAAAAACATAGAAAA 1484
1583
ATTCAGCAMCCATTTTTAAAGTAGAAGAGGGTTTTAGGTAGAAAAACATATTCTTGTGCTTTTCCTGATAAAGCACAGCTGTAGT~~TTCTAGGCA
TCTCTGTACTTTGCTTGCTCATATGCATGTAGTCACTTTATAAGTCATTGTATGTTATTATATTCCGTAGGTAGATGTGTAACCTCTTCACCTTATTCA 1682
TGGCTGMGTCACCTCTTGGTTACAGTAGCGTAGCGTGGCCGTGTGCATGTCCTTTGCGCCTGTGACCACCACCCCAACAMCCATCCAGTGACMACC 1781
1880
ATCCAGTGGAGGTTTGTCGGGCACCAGCCAGCGTAGCAGGGTCGGGAAAGGCCACCTGTCCCACTCCTACGATACGCTACTATAAAGAGAAGACGAMT
AGTGACATMTATATTCTATTTTTATACTCTTCCTATTTTTGTAGTGACCTGTTTATGAGATGCTGGTTTTCTACCCAACGGCCCTGCAGCCAGCTCAC 1979
GTCCAGGTTCMCCCACAGCTACTTGGTTTGTGTTCTTCTTCATATTCTAAAACCATTCCATTTCCAAGCACTTTCAGTCCAATAGGTGTAGGAAATAG 2078
CGCTGTTTTTGTTGTGTGTGCAGGGAGGGCAGTTTTCTAATGGAATGGTTTGGGAATATCCATGTACTTGTTTGCAAGCAGGACTTTGAGGCMGTGTG 2177
GGCCACTGTGGTGGCAGTGGAGGTGGGGTGTTTGGGAGGCTGCGTGCCAGTCAAGAAGAAAAAGGTTTGCATTCTCACATTGCCAGGATGATAAGTTCA2276
ACTGAGCCTTAAACWIGCAAGTTTTTTATTAAGGGTTTCAAGAGGGGAGGGGGTGTGAGAACATGGAGTAGAGCTCATGCTTCAAAGG~AAAAAACAG 2375
AACAAAGA TCACTTGCTTCTGAGGGAACAGGAGAAAAGGCAACACAGAACTACTGATAAGGGTCCATGTTCAGCGGTGCACGT4 TTATCTTGATAAACA 2474
TTCACCAGGGTGGAGTTTTTCCCCACCGTAGTAAGCCTGAGGGTACTGCAGGAGATCAGGGCG 2573
TCTTGAACAAAAAA TAGGGAAACGTCTGACCACAAA
TATCTCAGTCCTTATCTCAACCACGTAAGACAGACATTCCCAGAGCAGCTGTTTATAGACCTCTCCCCAGGAATGCATTCCTTTCCCAGGGTATTAATA 2672
TTAA TATTGCTTGCTAAC;GAAAAGAATTTAGCGATATCCTCCCTACTTGCATGTCCTTTTATAW;CTCTCTGCAAGAAGAAAAATATGGCTTTTTTTGCC 2771
TGACCCTGCAGGCAGTCAGACCTTATGGTTGTCTTCCCTTGTTCCCTAAAATCGCTGTTATTCTGTTTTTTCTCAAGGTGCACTGA
TTTCATATTGTTC 2870
AAACACACGTTTTACAATCAATTTGTACAGTTAACACAATTATCACGGTGGTCCTGAGGTGACATACATCCTCAGCTTACGAAGATAAWIGGATTAAGA 2969
3013
GATGAGAGTAAGACAGGCGTAAGAAATTATAAAAGTATTAATTT
Fig 3.Sequence of the 3-kb CCNDl aberrant transcript
observed in case no.
39.The 295-amino acid coding is shown.
The 1 MER1
nucleotide
sequence is in italics. *Position
of the base changes (nucleotides 870 and 1100)compared with thenormal CCNDl c D N A sequence." The
sequence reported here
has been deposited in the E M B L data base (accession no. 223022).
of the rearranged bands cohybridized tothe immunoglobulin
JH probe (data not shown). Probes D and E did not detect
anyrearrangedfragment in these cases, althoughtheydetected the same germline bands, as did probes B and C in
BamHI- andSad-cleavedDNA.This
led us to postulate
that, in these cases, the genomic region correspondingto
probesD and E was deleted, and that the break occurred
between the stop codon and the 5' end of probe D.
Interestingly, all of these tumors (case no. 39 included)
also demonstrated bcl-l rearrangement with a break in the
MTC (Fig 6), each rearrangement being identified on two
or more restriction digests. We are indeed unable to specify
if the two breaks occurred on one or on both alleles.
Northern blot analysis showed that the steady-state level
ofthe CCNDl transcripts is dramaticallyelevated in the
samples showing complex rearrangements, and that the 1S kb transcript was predominantly represented, the normal 4.5kb mRNA being undetectable (Fig 2 ) . When material was
available,Westernblot
analysis usingapolyclonalrabbit
anti-cyclin D antibody confirmed, at
the protein level, that
CCNDI is really expressed in thesepathological samples
of 35-kD
(Fig 7). In fact, a protein with an expected size
was detected in cases no. 39 and 40 and in normal human
fibroblasts used as positive control. The CCNDI protein was
also present in three other cases of MCL (cases no. 9, 19,
and 22), but was undetectable in normal lymphoid tissues.
To determine if thehighexpression
of CCNDI in
lymphoidmalignancieswithbreakin
the 3' UTRwasa
consequence of an increase in stability of its transcript, we
assessed CCNDI mRNA half-lifein Rec-landGob. cell
lines, which exclusively express short transcripts, and in the
XG5 cell line, where both the 1.5-kb and the 4.5-kb transcripts are detected,
using the transcriptional inhibitor actinomycin D. It is to be noted that the CCNDI 3' UTR is not
rearranged in the XG5 cell line (datanot shown). In normal
tissue, the estimated CCNDI mRNA half-life is 0.5 hours.'"
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
3693
REARRANGEMENT OF CCND1 3' UNTRANSLATED REGION
c
B
c
39
H
c
39
H
B
39
c 39
-23
- 9.4
W
C
4 39 3440
- 23
- 9.4
e
- 6.7
- 6.7
I.
probe D
- 9.4
probe E
Fig 4. Southern blot analysis of CCNDI3' end rearrangement in
case no. 39. DNA from case no. 39 and from normal peripheral blood
leukocytes (C) was digested with the indicated enzyme (B, BamHI;
H, Hindlll), and processed for Southern blotanalysis as described in
the Methods.The filters were hybridized
t o probe D andE. The scale
is in kilobases.
I n XGS. the half-lives of the I .S-and 4.5-kb transcripts are
approxitnately 3 hours each: in Rcc-l and Gob.. the short
transcripts appeared t o he even more stable. with a halflifegreater than S hours(Fig X). Indeed. n o comparison
can he macle with normal B-lymphoid tissues.which do
n o t express CCNIII. This showed that increase in mRNA
stability could constitute one of the Inechanisms by which
CCNIII is deregulated i n MCL and t( I Iql3)-associated
leukemias.
B
c 4c 4
L
S
c 34
0
c 34
S
-
0
-23
W U
4, -9.4
s
C 40 C 40 -23
*
- '.
-94
.4.3
-4.3
probe C
..
DISCUSSION
The rcsults presented here constitute additional eletnents
in favor of the role o f CCNIII i n lymphoid neoplasia antl
provide so~neclues with regard to its activation mcchanisms.
Cloning and sequence analysis o f CCNDI cDNAs in ;I
case of R-CLL showed that the coding franw \vas retained
and that the different s i x s of CCNIII mRNA resulted from
I n this Ieuketnia. the
different 3' untranslatedstructures.
CCNIII gene was expressed primarily a s ;I I.5-kb transcript.
but two aberrant transcripts o f 2. antl 3 kb were also detected.
The absence o f ;I recognizable polyxlcnylation site and of
;I poly(A) tail in the sequence o f I 1 cDNA clones covering
less than I .SO0 hp did not allow 11sto specify the nature of
I t may correspond. ;IS i t has been
theshortesttranscript.
previously rcpor~cd.'~.'''t o ;I truncntcd form of the normal
4.5-kh mRNA through the use of different polyaclcn!.latiol~
sign;ds. Sequence analysisshowed that the 3-kb aberrant
transcript results from the juxtaposition of a repetitive sequence of the MER1 I family to the CCNDI coding scqucncc. This might first represent a n example of insertional
mutagenesis lending to gcncderegulation. ;IS it has been
- 23
L
z.3
z
Fig 6. MTC rearrangement in MCL or leukemias with a break in
the 3' end of CCNDI.DNA extracted from the pathological samples
and from normal peripheral blood leukocytes (C) was digested with
BarnHl endonuclease and processed for Southern blot analysis as
described in theMethods. The filter was hybridized to a MTC probe.
The scale is in kilobases.
-2
probe B
probe B
Fig 5. Southern blot analysis of rearrangement of the CCNDl 3'
end in MCL and tlllql3)-associated leukemias. DNA, extracted from
the pathological samples and from normal peripheral blood leukocytes (C), was digested with the indicated enzymes (S,Sad; B,
BamHI) and processed for Southern blotanalysis as described in the
Methods. The filters were hybridizedt o probes C and B. The scale is
in kilobases.
- 35 kDa
Fig 7. Western blot analysis of the CCNDI protein in MCL and
t(llql3)-associated leukemias. Proteins were extracted from pathological samples, normal tonsil IT), reactive lymph node (L), Ramos
cell line (R), and normal human fibroblasts (F). lmmunodetectionof
the CCNDl protein was performedas described in the Methods.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
RIMOKH ET AL
3694
0
1
2
3
4
5
Hours
-3m
ccND1: G
"2kb
-15kb
MYC: G
CCND1: R
MYC: R
~ 1 5 k b
0"
-4.5 kb
ccND1: x
-3kb
MYC X
Fig 8. Study of CCNDl mRNAstabilii in t(llql3l-bearing
cell line:
Rec. (RI, Gob. (G), and XG5 (X) cell lines.Total RNA was extracted at
the indicated times after addition of actinomycin D and processed
for Northern blot analysis as described in the Methods. The filters
were sequentially hybridized to a CCNDl probe (probe A) and to a
MYC exon 3 probe. The size of CCNDl transcripts is in kilobases.
described whenproviral or human repetitive sequence are
integrated in the vicinity of certain genes3' However, we
have to consider the possibility that this aberrant transcript
is the consequence of the t(l I ; 19)(q13;q13), which characterized this leukemia, and that the MER1 I sequence originates from the chromosome 19.
The continuation of this workledustoshowthatrearrangement of the 3' end of CCNDl was not a rare event
in MCL and in t( 1 Iql3)-bearing leukemias. Using a set of
probes specific tothe different parts of CCNDI. such rearrangements were observed in DNA from four of the 40
patients tested. Consistent with previously published
works,'5.'" Southern blot and sequence analyses indicated
that, as a result of these rearrangements, the greatest part of
the CCNDl 3' UTR and. in particular. the AU-rich region
containing the mRNA-destabilizing signals AUUUA. is
eliminated. It is thus possible that the CCNDI 3' UTR corresponds to a new breakpoint cluster (mTC3).
The findingthatthe
half-life of CCNDI mRNA is increased in three cell lines carrying a t( I Iq13) translocation
stresses the importance of posttranscriptional derangement
in activation of CCNDI.The fact that in the XGS cell line
the half-lives of the 4.5-kb and 1 .S-kb CCNDI mRNAs are
identical allows us to rule out the hypothesis that the AUrichregion contained in the 3' UTR.anddeleted in some
tumors, is responsible for the greater stability of the truncated
messages. However. it must be pointed out that the half-life
of the CCNDl short mRNA is significantly longer in tumors
with 3' UTR rearrangement and.
thus.
that
these
rearrangements may alter KNA stability. There exist other situations where certain genes implicated in the control of cell
proliferation are deregulated throughstabilization of their
transcripts. So. the inappropriate expression ofthe M Y C
proto-oncogene in Burkitt's lymphomacanresultfrom
an
increase of the half-life of its transcript.""' However. in this
case, the sequences implicated in the control of the mRNA
stability are not only localized in the 3' UTR.but also in
the S' region encompassing thefirstexonof
MYC. It has
also been reported that the mRNA stability of different cytokines and cyclins G , is increased in some hematopoietic and
solid tumors."'.2J without gross genetic abnormalities ofthe
transcripts. From these data. it appears that the AU-rich sequences present in the 3' UTR of certain genes are not always
implicated in mRNA stability andthat other mechanisms
should exist. Their nature remains to be determined. Comparison of the sequences of therearranged 3' UTRwith
those of the short 1 .S-kb transcripts observed in most of the
MCLs and of the normal 4.5-kb mRNA should provide data
information withregardtotheregionsputativelyinvolved
in mRNA stability.
AUUUAmotifs in the 3' UTRof RNAscan also help
to modulate the efficient translation of these transcripts. In
particular. cytokine-derived UA-rich sequence canbe responsible for a translational blockade in ~itro.~'.~'
Consistent
with this hypothesis is the finding thatin two cases of tumors
(cases no. 39 and 40) with deletion of the CCNDI mRNA
AU-rich regions, the CCNDI protein is expressed at a high
level. Finally, the fact that in most of the MCL andt( 1 lq13)associated leukemias analyzed. CCNDI isprimarily expressed as a I .5-kb transcript".'" prompts us to pinpoint the
importance of the translational control of CCNDl expression
in the pathogenesis of these tumors. It remained to be determined why a short transcript is also produced in some tumors
without detectable rearrangement of the CCNDI 3' UTR.
All cases presented here demonstrated rearrangement of
both the MTC region and theCCNDI 3' UTR. This observation indicates that, in some cases. activation of CCNDI may
be the consequence of two independent genetic events.
namely, the juxtaposition of the CCNDI promoting region
to IgH enhancer in the t( I 1 ; 14) translocation and the loss of
3' end regulatory sequences.
Nucleotide changes leading to amino acid substitutions in
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
REARRANGEMENT OF CCNDl 3‘ UNTRANSLATEDREGION
the sequence of the CCNDl protein have been described in
one cell line.” The present report and the finding that in
two primary human tumors the CCNDl coding sequence is
normalz1suggest that amino acid changes are not required for
CCNDl to develop oncogenic properties in primary human
tumors.
The results of this study also provide the first evidence that
deregulation of CCNDI in MCLs and t(llql3)-associated
leukemias leads to the accumulation of abnormally high levels of a normal 35-kD CCNDl protein, which wedid not find
expressed in normal lymphoid tissues and in three follicular
lymphomas (Fig 7). The normal size of the CCNDI protein
in two cases of tumor (cases no. 39 and 40) with a break in
the 3’ UTR confirms that the rearrangement did not alter the
CCNDl coding frame.
ACKNOWLEDGMENT
We gratefully acknowledge Jean-Marie Blanchard and Jacques
Samarut for helpful discussion, Peter Griggs for reading the manuscript, and B6nidicte Santaluccia for excellent technical assistance.
REFERENCES
I . Solomon E, Borrow J, Goddard AD: Chromosome aberrations
and cancer. Science 254:1153, 1991
2. Rimokh R, Berger F, Corniller P, Wahbi K, Rouault J-P,
Ffrench M, Bryon P-A, Gadoux M, Gentilhomme 0, Germain D,
Magaud J-P: Break in the BCL-I locus is closely associated with
intermediate lymphocytic lymphoma subtype. Genes Chrom Cancer
2:223, 1990
3. Medeiros LJ, van Krieken JHJM, Jaffe ES, Raffeld M: Association of BCL- 1 rearrangements with lymphocytic lymphoma of intermediate differentiation. Blood 76:2086, 1990
4. Williams ME, Westermann CD, Swerdlow SH: Genotypic
characterization of centrocytic lymphoma: Frequent rearrangement
of the chromosome 11 BCL-l locus lymphomas. Blood 76:1387,
1990
5. Williams ME, Meeker TC, Swerdlow SH: Rearrangement of
the chromosome 11 BCL-1 locus in centrocytic lymphoma: Analysis
with multiple breakpoint probes. Blood 78:493, 1991
6. Leroux D, Le Marc’hadour F, Gressin R, Jacob MC, Keddari
E, Monteil M, Caillot P, Jalbert P, Sotto JJ: Non-Hodgkin’s lymphomas with t(l I; 14)(q13;q32): A subset of mantle zonehntermediate
lymphocytic lymphoma? Br J Haematol 77:346, 1991
7. Raffeld M, Jaffe ES: Bcl-l, t(ll;l4), and mantle cell-derived
lymphomas. Blood 78:259, 1991
8. Banks PM, Chan J, Cleary ML, Delsol G, De Wolf-Peeters C,
Gatter K, Grogan TM, Harris NL, Isaacson PG, Jaffe ES, Mason D,
Pileri S, Ralfkiaer E, Stein H, Warnke RA: Mantle cell lymphoma.
Am J Surg Pathol 16:637, 1992
9. Tsujimoto Y, Jaffe E, Cossman J, Gorham J, Nowell PC, Croce
CM: Clustering of breakpoints on chromosome 11 in humanBcell neoplasms with the t(l1; 14) chromosome translocation. Nature
315:340, 1985
10. Inaba T, Matsushime H, Valentine M, Roussel MF, Sherr
CJ, Look AT: Genomic organisation, chromosomal localization, and
independent expression of human cyclin D genes. Genomics 13565,
1991
11. Rimokh R, Berger F, Delsol G, Charrin C , BerthLas MF,
Ffrench M, Garoscio M, Felman P, Coiffier C, Bryon PA, Rochet
M, Gentilhomme 0, Germain D, Magaud JP: Rearrangement and
overexpression of the BCL-I/PRAD-I gene in intermediate lympho-
3695
cytic lymphomas and in t(llql3)-bearing leukemias. Blood 81:3063,
1993
12. Meeker TC, Sellers W, Harvey R, Withers D, Carye K, Xiao
H, Block A-M, Dadey B, Han T: Cloning of the t(I I; 14)(q13;q32)
translocation breakpoints from two human leukemia cell lines. Leukemia 5:733, 1991
13. Williams ME, Swerdlow SH, Rosenberg CL, Arnold A: Characterization of chromosome 11 translocation breakpoints at the
BCLl and PRADl loci in centrocytic lymphoma. Cancer Res
52:5541s, 1992 (suppl)
14. Mokotura T, Bloom T, Kim HG, Juppner H, Ruderman JV,
Kronenberg I”, Arnold A: Anovel cyclin encoded by a BCLl
linked candidate oncogene. Nature 350:512, 1991
15. Withers DA, Harvey RC, Faust JB, Melnyk 0, Carey K,
Meeker TC: Characterization of a candidate BCLl gene. Mol Cell
Biol 11:4846, 1991
16. Xiong Y, Conolly T, Futcher B, Beach D: Human D-type
cyclin. Cell 65:691, 1991
17. Sherr CJ: Mammalian G1 cyclins. Cell 73:1059, 1993
18. Rosenberg CL, Wong E, Petty EM, Bale AE, Tsujimoto Y,
Hams NL, Arnold A: PRAD1, a candidate BCLl oncogene: Mapping and expression in centrocytic lymphoma. Proc Natl Acad Sci
USA 88:9638, 1991
19. Set0 M, Yamamoto K, Iida S,Aka0 Y, Utsumi R, Kubonishi
I, Miyoshi I, Ohtsuki T, Yawata Y, Namba M, Motokura T, Arnold
A, Takahashi T, Ueda R Gene rearrangement and overexpression
of PRADl in lymphoid malignancy with t(l1; 14)(q13;q32) translocation. Oncogene 7:1401, 1992
20. Raynaud SD, Bekri S, Leroux D, Grosgeorge J, Klein B,
Bastard C, Gaudray P, Simon MP: Expanded range of llq13
breakpoints with differing patterns of cyclin D1 expression in Bcell malignancies. Genes Chrom Cancer 8:80, 1993
21. Rosenberg CL, Motokura T, Kronenberg HM, Arnold A:
Coding sequence of the overexpressed transcript of the putative
oncogene PRADlkyclinDI in two primary human tumors. Oncogene 8519, 1993
22. Weisenburger DD,WarrenG,
Sanger WG, Armitage C O ,
Purtilo DT: Intermediate lymphocytic lymphoma: immunophenotypic and cytogenetic findings. Blood 69:1617, 1987
23. Jaffe ES, Bookman MA, Longo DL: Lymphocytic lymphoma
of intermediate differentiation-mantle zone lymphoma: A distinct
subtype of B-cell lymphoma. Hum Path01 18:877, 1987
24. Bookman MA, Lardelli P, Jaffe ES, Duffey PL, Longo DL:
Lymphocytic lymphoma of intermediate differentiation: Morphologic, immunophenotypic, and prognostic factors. J Natl Cancer Inst
82:742, 1990
25. Perry DA, Bast MA, Armitage JO, Weinsenburger DD: Diffuse intermediate lymphocytic lymphoma: A clinicopathologic study
and comparison with small lymphocytic lymphoma and diffuse small
cleaved cell lymphoma. Cancer 66:1995, 1990
26. Brochier J, Magaud JP, Cordier G: Heterogeneity of human
B lymphocytes as revealed by monoclonal antibodies. Ann Immunol
133D:283, 1984
27. Rimokh R, Magaud JP, Coiffier B, Samarut J, Germain D,
Mason DY: Translocation involving a specific breakpoint (5q35) on
chromosome 5 is characteristic of anaplastic large cell lymphomas.
Br J Hematol 71:36, 1989
28. Kaplan DJ, Jurka J, Solus JF, Duncan CH: Medium reiteration
frequency repetitive sequences in the human genome. Nucleic Acids
Res 19:4731, 1991
29. Jurka J, Walichiewicz J, Milosavljevic: Prototypic sequences
for human repetitive DNA. J Mol Evol 35:286, 1992
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
3696
30.Keyomarsi K, PardeeAB:Redundantoverexpressionand
gene amplification in breast cancer cells. Proc Natl Acad Sci USA
90: 1 I 12, 1993
3 I . Lammie GA, Smith R, Silver J, BrookesS, Dickson C, Peters
G: Proviral insertions near cyclin D1 in mouse lymphomas: A parallel for BCLl translocations in human B-cell neoplasms. Oncogene
7:2381, 1992
32. Rabbits PH, Forster A, Stinson MA, Rabbits TH: Truncation
of exon I from the c-myc gene results in prolonged c-myc mRNA
stability. EMBO i 4:3727, 1985
33. Eick D, Piechaczyk M, Henglein B, Blanchard JM, Traub B,
Kofler E, Weist S, Lenoir GM, BornkammGW:Aberrant
c-myc
RNAs of Burkitt's lymphoma cells have longer half-lifes. EMBO J
4:3717,1985
RIMOKH ET AL
34. Ross HJ, Sato N.Ueyama Y, Koeffler P: Cyto!cine messenger
RNA stability is enhanced in tumor cells. Blood 77: 1787. 199 I
35. Shaw G, Kamen R: A conserved AU sequence from the 3'
untranslated region of GM-CSF mRNA mediates selective mRNA
degradation. Cell 46:659, 1986
36. Akashi M, Shaw G, Gross M, Saito M, Koeffler HP: Role of
AUUU sequences in stabilization of granulocyte-macrophage colony-stimulating factor RNAin stimulated cells. Blood 78:2005,1991
37. Kruys V, Marinx 0, Shaw G. Deschamps J, Huez G: Translational blockadeimposed by cytokinederived UA-rich sequences.
Science245:852,1989
38. Han J, Brown T, Beutler B: Endotoxin-responsive sequences
control cachectidtumor necrosis factor biosynthesis at translational
level. J Exp Med 171 :465, 1990
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1994 83: 3689-3696
Rearrangement of CCND1 (BCL1/PRAD1) 3' untranslated region in
mantle- cell lymphomas and t(11q13)-associated leukemias
R Rimokh, F Berger, C Bastard, B Klein, M French, E Archimbaud, JP Rouault, B Santa Lucia, L
Duret and M Vuillaume
Updated information and services can be found at:
http://www.bloodjournal.org/content/83/12/3689.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.