* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Who Killed Esmeralda Gooch
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Molecular evolution wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Gel electrophoresis wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA vaccination wikipedia , lookup
SNP genotyping wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Restriction enzyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Who Killed Esmeralda Gooch? Use of DNA Fingerprinting in Forensic Science Purpose: The purpose is to use a simplified form of DNA fingerprinting that is used to identify people. Procedure: A. The Crime Late one night, the famous rock star, Esmeralda Gooch, returned to her luxurious apartment from an appearance at a concert. As she entered her locked apartment, she noticed that everything in her apartment was a mess; the drawers had been emptied out onto the floor, the cushions in the couch were ripped open and the safe behind the picture on the wall had been opened. She then noticed that the lights were on in her bedroom. She stormed into the bedroom and surprised a burglar in the process of removing her magnificent (and expensive) jewelry from its hiding place beneath the mattress. In frenzy, she jumped on the burglar and tried to stab the person with her nail file. While she was able to inflict a small wound, she was no match for the assailant’s machete; in the subsequent struggle, she was killed. The murderer escaped with her jewelry. B. The Investigation When the housekeeper, Clarabelle, entered her apartment the next day, she saw the body and immediately called the police. When they noted that there had been no signs of a forced entry, the investigation was narrowed down to people who knew Esmeralda and who had a key to enable them to enter her apartment. The suspects were: 1. Clarabelle, the housekeeper, who had just had a bitter argument with the singer over a denied raise in her salary. 2. Lucifer, her former boyfriend, whom she had just jilted for another man. 3. Pinky, the leader of her weight lifting class, who was her new boyfriend. It was rumored that Pinky was jealous of Esmeralda’s fame. When it was established that all three of the suspects had a key to Esmeralda’s apartment, all had a motive for killing her, and all had no iron-clad alibi for the evening that she was killed, the police realized that they had a problem. They consequently decided to hire a world-famous forensic science team, you and the rest of your Conestoga High School partners, to use DNA fingerprinting to prove which of the suspects was guilty. C. Use of Restriction Enzymes You are going to see how forensic scientists make DNA fingerprints from DNA found in sperm cells, blood, or other human cells. They make use of a type of enzyme called restriction endonucleases, or restriction enzymes. When these enzymes recognize a certain area of DNA molecule (a specific order of bases), they cut the DNA at the point. However, when they cut the DNA they do so unevenly making it a jagged cut. For example: One large fragment GGAATTCGAAGGATCC CCTTAAGCTTCCTAG G One enzyme cuts here gets cut into Another enzyme cuts here three smaller fragments: GG CCTTAA AATTCGAAG GCTTCCTAG GATCC G Each restriction enzyme only cuts at one particular sequence of bases. For example the endonuclease EcoRI, the first enzyme in the illustration above, cuts only at the G AATTC in a DNA molecule, breaking it into separate fragments. C TTAAG To see how these fragments are made and used: 1. Obtain sheets showing the same portion of DNA from each of the suspects, and from the sample of blood taken from Esmeralda’s nail file. 2. Divide your group into two teams. One team is to analyze the DNA using the restriction enzyme called BamHI; the other is to use the restriction enzyme EcoRI. To do this: a. You will look for the sequence of bases that each recognizes, and mark, right on the sheet, where it will cut. b. Then count the bases that will be in one strand of that fragment (on the top strand of the fragment), and put that number above the fragment. Recognition sequences: EcoRI - G AATTC C TTAA G Bam HI - G GATCC CCTAG G 3. After the restriction enzymes have cut the DNA, the fragments in each sample are then separated by size, by a technique called gel electrophoresis. In this technique, each sample is put into a well (a hole going part way into the material) in a block of agarose gel. An electric current is passed through the agarose, which then pulls the smaller fragments through the gel faster than the larger ones. The fragments will end up as bands sorted by size. Well where original DNA sample was placed Band w/most nucleotides (longest fragment) Band w/least nucleotides (shortest fragment) To see how the electrophoresis creates the fingerprint of your suspects’ DNA fragments, estimate the location of the bands in the agarose gel after electrophoresis. Draw the bands on the gel labeled for the enzyme that you used. (The lane on the left was used as a reference, it has DNA with fragments 5, 10, 15, 20, 25, and 30 bases long. You can use that to estimate the location of the fragments in your DNA). Put the electrophoresis results of both teams on the same sheet. Each team is to check the location of the bands of the other team’s fragments for accuracy. 4. To do the most accurate analysis possible (as you would like to be able to prove who killed Esmeralda, both to reinforce your reputation as a forensic scientist, and to earn a big bonus from Esmeralda’s children), you would like to repeat the procedure using both enzymes together. a. Using a red pen (or some color other than what you used before), mark the cutting sites of both enzymes on each person’s DNA. (Divide up the work amongst your group). b. Above each fragment, write the number of bases in that fragment (again, use the top strand). c. Mark the bands that you would get from electrophoresis on the agarose gel on the bottom of the gel electrophoresis page. Bands produced using Eco RI: Reference DNA Nail File DNA Bands produced using Bam HI: Clarabella’s Lucifer’s Pinky’s DNA DNA DNA Reference DNA Nail File Clarabella’s Lucifer’s DNA DNA DNA Pinky’s DNA 30bp 25bp 20bp 15bp 10bp 5bp Bands produced using both EcoRI and Bam HI: Reference DNA Nail File Clarabella’s Lucifer’s Pinky’s DNA DNA DNA DNA Questions: 1. a. What do your BamHI results show? ____________________________________ b. What do your EcoRI results show? ___________________________________ 2. Who was the murderer of Esmeralda Gooch? _______________________________ The Evidence From the Nail File: CATGGATCCCTAGAATTCGACCTGGATCCGACCGAATTCTGGATCCGCCACTAGAATTCAAACGGATCCATTACGTATGAATTCAGGATCCTTA GTACCTAGGGATCTTAAGCTGGACCTAGGCTGGCTTAAGACCTAGGCGGTGATCTTAAGTTTGCCTAGGTAATGCATACTTAAGTCCTAGGAAT From Clarabelle’s DNA: CATGGATCCCTAGGACGAATTCAGGATCCGAATTCTACGGGGATCCTAGAATTCGGTGAATTCGGATCCAGAAGCCTGAATTCAGGATCCTTAA GTACCTAGGGATCCTGCTTAAGTCCTAGGCTTAAGATGCCCCTAGGATCTTAAGCCACTTAAGCCTAGGTCT TCGGACTTAAGTCCTAGGAATT From Lucifer’s DNA: CATGGATCCACTGAATTCATGGATCCTGGATCCGAATTCGGATCCGGATCCCAGAATTCCCCGTTAGGATCCCTACCGG AATTCGGGATCCTTA GTACCTAGGTGACTTAAGTACCTAGGACCTAGGCTTAAGCCTAGGCCTAGGGTCTTAAGGGGCAATCCTAGGGATGGCCTTAAGCCCTAGGAAT From Pinky’s DNA: CATGGATCCCTAGAATTCGACCTGGATCCGACCGAATTCTGGATCCGCCACTAGAATTCAAACGGATCCATTACGTATGAATTCAGGATCCTTA GTACCTAGGGATCTTAAGCTGGACCTAGGCTGGCTTAAGACCTAGGCGGTGATCTTAAGTTTGCCTAGGTAATGCATACTTAAGTCCTAGGAAT