Download Protein Synthesis – Level 1

Protein Synthesis – Level 1
Use the following DNA sequence to answer the questions that follow:
TACGGTAAATCGTGGATC
1. What will be the mRNA that results from transcription?
2. How many codons does this mRNA have?
3. What anticodons will the tRNAs have for this mRNA? (Remember, there
is no tRNA anticodon for a stop codon)
4. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
TAGGTAAATCGTGGATC
5. What type of mutation is this?
6. How will the protein be affected (be specific).
Protein Synthesis – Level 2
Use the following DNA sequence to answer the questions that follow:
TACGCCGTAAATCGTGGTAACGCCATC
1. What will be the mRNA that results from transcription?
2. If the underlined portions represent introns, what will the mature mRNA
be/read?
3. How many codons does this mature mRNA have? How many tRNA
anticodons will there be?
4. What anticodons will the tRNAs have for this mRNA?
5. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
TACGCCGTAAATCGAGGTAACGCCATC
6. What type of mutation is this?
7. How will the protein be affected (be specific).
Protein Synthesis – Level 3
Use the following DNA sequence to answer the questions that follow:
3’-GCCTATACGCCGTAAATCGTGGTAACGCTATC -5’
1. What will be the mRNA that results from transcription?
2. If the underlined portions represent introns, what will the mature mRNA
be/read?
3. Prior to leaving the nucleus, what will be added to the mature mRNA?
What will the mRNA look like after this occurs? What is the purpose of
this processing?
4. Where (what triplet) will the mRNA bind to the ribosome?
5. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
3’-GCCTATACGGCCGTAAATCGAGGTAACGCTATC-5’
6. What type of mutation is this?
7. How will the protein be affected (be specific).