Download Protein Synthesis – Level 1

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

NEDD9 wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Nucleosome wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

MicroRNA wikipedia , lookup

Molecular cloning wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Epigenomics wikipedia , lookup

DNA supercoil wikipedia , lookup

Microevolution wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Gene wikipedia , lookup

Genomics wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

History of RNA biology wikipedia , lookup

Polyadenylation wikipedia , lookup

DNA vaccination wikipedia , lookup

Non-coding DNA wikipedia , lookup

Mutation wikipedia , lookup

Non-coding RNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Helitron (biology) wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Expanded genetic code wikipedia , lookup

Transfer RNA wikipedia , lookup

Frameshift mutation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Genetic code wikipedia , lookup

Point mutation wikipedia , lookup

Primary transcript wikipedia , lookup

Messenger RNA wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
Protein Synthesis – Level 1
Use the following DNA sequence to answer the questions that follow:
TACGGTAAATCGTGGATC
1. What will be the mRNA that results from transcription?
2. How many codons does this mRNA have?
3. What anticodons will the tRNAs have for this mRNA? (Remember, there
is no tRNA anticodon for a stop codon)
4. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
TAGGTAAATCGTGGATC
5. What type of mutation is this?
6. How will the protein be affected (be specific).
Protein Synthesis – Level 2
Use the following DNA sequence to answer the questions that follow:
TACGCCGTAAATCGTGGTAACGCCATC
1. What will be the mRNA that results from transcription?
2. If the underlined portions represent introns, what will the mature mRNA
be/read?
3. How many codons does this mature mRNA have? How many tRNA
anticodons will there be?
4. What anticodons will the tRNAs have for this mRNA?
5. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
TACGCCGTAAATCGAGGTAACGCCATC
6. What type of mutation is this?
7. How will the protein be affected (be specific).
Protein Synthesis – Level 3
Use the following DNA sequence to answer the questions that follow:
3’-GCCTATACGCCGTAAATCGTGGTAACGCTATC -5’
1. What will be the mRNA that results from transcription?
2. If the underlined portions represent introns, what will the mature mRNA
be/read?
3. Prior to leaving the nucleus, what will be added to the mature mRNA?
What will the mRNA look like after this occurs? What is the purpose of
this processing?
4. Where (what triplet) will the mRNA bind to the ribosome?
5. What amino acids will make up the polypeptide?
If a mutation occurred and the DNA became:
3’-GCCTATACGGCCGTAAATCGAGGTAACGCTATC-5’
6. What type of mutation is this?
7. How will the protein be affected (be specific).