Download 10858_2015_9967_MOESM1_ESM

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Replisome wikipedia , lookup

MicroRNA wikipedia , lookup

LSm wikipedia , lookup

Molecular evolution wikipedia , lookup

X-inactivation wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Agarose gel electrophoresis wikipedia , lookup

Genetic code wikipedia , lookup

Community fingerprinting wikipedia , lookup

SR protein wikipedia , lookup

Transcription factor wikipedia , lookup

QPNC-PAGE wikipedia , lookup

Promoter (genetics) wikipedia , lookup

Non-coding DNA wikipedia , lookup

RNA interference wikipedia , lookup

Bottromycin wikipedia , lookup

Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup

Messenger RNA wikipedia , lookup

Gel electrophoresis wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Polyadenylation wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

RNA wikipedia , lookup

Transcriptional regulation wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

Gene expression wikipedia , lookup

RNA silencing wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

Epitranscriptome wikipedia , lookup

Non-coding RNA wikipedia , lookup

RNA-Seq wikipedia , lookup

Transcript
Supplementary Material to:
Rapid NMR screening of RNA secondary structure and binding
Christina Helmlingǂ, Sara Keyhaniǂ, Florian Sochor, Boris Fürtig, Martin Hengesbach, Harald
Schwalbe1,*
Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic
Resonance (BMRZ), Johann Wolfgang Goethe-Universität, Frankfurt/M., 60438, Germany
1
ǂJoint
first authors
* To whom correspondence should be addressed. Tel: +496979829130 Fax: +496979829130 Email:
[email protected]
S1: DMSO effect on 3’ end transcript homogeneity
The effect of DMSO on 3’ end transcript homogeneity was investigated on additional RNA sequences
in order to assess the generality of the approach. For transcriptions, standard primers were used to
focus on homogeneity effects caused by DMSO and not 2’-O-methylation of the primers. For this
study, we chose A/U rich sequences, which caused severe amounts of non-DNA-templated
nucleotide addition (>+4). First, we illustrate the effect of DMSO on 3’ end homogeneity on a series of
rather short constructs (30 nt – 39 nt) to unambiguously resolve also residual n+1 transcripts (Figure
S1). Transcriptions performed in the absence of DMSO clearly show heterogeneous product
formation with the main products being significantly larger than the desired RNA. Incorporation of a G
(35 nt. transcript) and C (39 nt. transcript) considerably reduces the transcription of additional
nucleotides. Transcript 30 also shows decreased heterogeneity, which could be caused by additional
C residues involved in the DNA/RNA duplex occurring prior to residue U22. Figure S1b shows a
significant decrease in 3’ end heterogeneity by the addition of 20% of DMSO. In the presence of
DMSO, only n+1 transcripts (< ~40%) can be detected. The formation of n+1 transcripts can
presumably be further reduced by using 2’-OMe primers as shown in Figure 2. Direct comparison of
constructs 31-35 transcribed in the absence and presence of DMSO shows that only construct 35 is
transcribed with the correct length in the absence of DMSO. Constructs 33 and 34 show a minor
fraction of n+1 product formation with the major transcripts being >+4. Construct 31 transcribes n+1
and n-1 in the absence of DMSO. Figure S1d shows a DMSO optimization of the 37 nt transcript.
According to this optimizations, the largest yield and homogeneity are acquired when using 20% of
DMSO in the transcription mixture.
Supplementary Fig. S1 20% denaturing polyacrylamide gels investigating the effect of the cosolvent
DMSO on the 3’ end homogeneity of RNA transcripts containing a 13 nt A/U stretch (highlighted in red)
near the 3’ end. a denaturing polyacrylamide gel of 10 RNA constructs differing in one nt length
transcribed under standard conditions and b in the presence of 20% of DMSO. c direct comparison of
five selected RNA constructs shown in a and b, where lanes marked with D correspond to
transcriptions performed in 20% of DMSO. The loading mixture contained 50% formamide, 10% of the
transcription mixture for a and 1% of the transcription mixture for b (0.2% DMSO), respectively. Gels
were stained with GelRedTM. d DMSO optimization for the 37 nt. transcript. The gel was visualized by
UV shadowing.
S2: Application of the method to different RNA
In order to further substantiate the improvement in 3’ end homogeneity, we show its effect for two
additional larger RNA constructs, which were also transcribed from A/T rich DNA templates, in Figure
S2.
Sequence:
AAUGAAUAUAAAAGAAACUUAUACAGGGUAGCAUAAUGGGCUACUGACCCCGCCUUCAAACCUAUUUGG
AGACUAUAAGUGAAAAACCACUCUUUAAUUAUUAAAGUUUCUUUUUAUGUCCAAAAGACAAGAAGAAA
Supplementary Fig. S2 12% denaturing polyacrylamide gels for different RNA constructs transcribed
in the absence (a) and presence (b) of 20% of DMSO. The transcripts correspond to intermediates of
the sequence specified above with 104-112nt transcripts highlighted in red and 134-138nt transcripts
highlighted in green. The loading mixture contained 50% formamide and 50% of the transcription
mixture. Gels were visualized by UV shadowing.
S3: Effect of washing volume on residual Mg2+/spermidine binding
Figure S3 illustrates the improvement in NMR spectral quality for dGsw80 by increasing the washing
volume. Loop-loop reporter signals can be detected when washing with 60 mL of NMR buffer (U66)
and the resulting spectrum shows a significant amount of minor signals, which suggests RNA
heterogeneity. An increase in the washing volume to 120 mL homogenizes the mixture and the
resulting NMR spectrum is comparable to HPLC purified RNA.
Supplementary Fig. S3 1H NMR spectra of dGsw80 obtained after washing with 60 mL and 120 mL of
NMR buffer and comparison to a 1H NMR spectrum obtained from HPLC-purified dGsw80.