Download Tissue-Specific Expression and Promoter Analysis of the Tobacco

Plant Physiol. (1 996) 112: 51 3-524
Tissue-Specific Expression and Promoter Analysis of the
Tobacco ltpl Gene’
Stefano Canevascini, Doina Caderas, Therese Mandel, Andrew J. Fleming, lsabelle Dupuis,
and Cris Kuhlemeier*
lnstitute of Plant Physiology, University of Berne, Altenbergrain 21, CH-3013 Berne, Switzerland
The in vivo function of plant LTPs is controversial. The
LTPs so far cloned contain a leader sequence responsible
for insertion into the ER and subsequent secretion of the
protein (Bernhard et al., 1991; Madrid, 1991). In situ hybridizations have shown accumulation of Itp transcripts in
epidermal layers of tobacco (Fleming et al., 1992), tomato
(Fleming et al., 1993), and Arabidopsis (Thoma et al., 1994),
and anti-LTP antibodies recognized epitopes in cell walls
and intercellular spaces in Arabidopsis (Thoma et al.,
1993). Furthermore, in broccoli, LTP is the most abundant
protein in the extracellular wax (Pyee and Kolattukudy,
1994, 1995). Such a specific localization of LTP in the epidermal cell wall is incompatible with a role in general lipid
redistribution, and, in the light of a11 these observations,
LTPs have been proposed to play a role in the transport of
extracellular lipophilic material. This material could be
required for the assembly of cutin (Sterk et al., 1991) and
other amorphous barriers around the plant (Koltunow et
al., 1990; Sossountzov et al., 1991; Kalla et al., 1994; Thoma
et al., 1994).
Such extracellular LTPs might not simply play a passive
role in the formation of structural barriers but might also
have an active function in plant defense. Thus, in the
course of an investigation of possible defense proteins in
barley, Molina et al. (1993) isolated potent growth inhibitors of bacterial and fungal pathogens that acted synergistically with thionins. These substances were subsequently
identified as nonspecific LTPs. The transcription of the ltp4
gene, coding for one of these proteins, was shown to be
induced 9-fold 12 h after the inoculation of fungal pathogen isolates (Molina and García-Olmedo, 1993).
We are primarily interested in the Ntltpl gene as an early
marker for epidermis differentiation. In previous experiments we showed that the RNA is present in a11 aerial
tissues but that abundance declines with age of the tissue
(Fleming et al., 1992). It was concluded that expression was
limited to the outer cell layer in young leaves and in the
shoot apical meristem using in situ hybridization. However, this was not the case in early leaf primordia, and
expression was also observed in interna1 tissues. Here we
present the results of promoter-GUS fusions in combination with in situ hybridization, which corroborate and extend the previous results. Our data are most easily incorporated into a model in which LTPs play a role in the
preformed defenses of the plant against pathogen invasion.
The Nicofiana fabacum lfpl gene (Nflfpl) encodes a small basic
protein that belongs to a class of putative lipid transfer proteins.
These proteins transfer lipids between membranes i n vitro, but their
in vivo function remains hotly debated. This gene also serves as an
important early marker for epidermis differentiation. We report
here, the analysis of the spatial and developmental activity of the
Nfltpl promoter, and we define a sequence element required for
epidermis-specific expression. Transgenic plants were created containing 1346 bp of the Nflfpl promoter fused upstream of the
P-glucuronidase (CUS) gene. In the mature aerial tissues, CUS
activity was detected predominantly in the epidermis, whereas in
younger aerial tissues, such as the shoot apical meristem and floral
meristem, GUS expression was not restricted t o the tunica layer.
Unexpectedly, CUS activity was also detected in young roots, particularly in the root epidermis. Furthermore, the Nflfpl promoter
displayed a tissue and developmental specific pattern of activity
during germination. These results suggest that the Nflfpl gene is
highly expressed i n regions of the plant that are vulnerable t o
pathogen attack and are thus consistent with the proposed function
of lipid transfer proteins i n plant defense. Deletions of the promoter
from i t s 5’ end revealed that the 148 bp preceding the translational
start site are sufficient for epidermis-specific expression. Sequence
comparison identified an eight-nucleotide palindromic sequence
CTACCTAC i n the leader of Nfltpl, which i s conserved i n a number
of other lfp genes. By gel retardation analysis, the presence of
specific DNA-protein complexes in this region was demonstrated.
l h e characterization of these factors may lead t o the identification
of factors that control early events in epidermis differentiation.
Lipids are synthesized in the ER and in chloroplasts,
from where they must be transported to various membranes via membrane vesicles, by lateral diffusion within
the plane of the membrane through contact sites, or shuttled by carrier molecules. In animals and fungi, LTPs can
specifically bind different lipids and shuttle them between
membranes (for a review, see Wirtz, 1991). In contrast,
LTPs purified from plants have a broad phospholipid substrate specificity in vitro, similar to nonspecific LTPs of
mammals (Douady et al., 1982; Kader et al., 1984; Watanabe
and Yamada, 1986).
This work was supported by the Schweizerischer Nationalfonds and Stiftung zur Forderung der wissenschaftlichen Forschung an der Universitat Bern and the Human Capital Mobility
Project, funded through the Bundesamt für Bildung und Wissenschaft.
* Corresponding author; e-mail kuhlemeierQpfp.unibe.ch; fax
41-31-332-20-59.
Abbreviations: LTP, lipid transfer protein; nt, nucleotide.
513
Canevascini et al.
514
Some discrepancies between RNA and GUS data are also
apparent, which demonstrates the need for caution in interpreting results obtained with the GUS system. Finally,
promoter deletion analysis identifies a 148-bp region sufficient for epidermis-specific expression.
MATERIALS A N D METHODS
Nucleic Acid Manipulations
DNA manipulations were conducted using standard
procedures as described by Sambrook et al. (1989). Esckerichia coli K12 strain BB-4 served as the host for plasmid
amplifications.
Numbering of the Ntltpl gene was done so that the A of
the initiator ATG was + l . The 5’ end of the mRNA was
mapped to -106 (Fleming et al., 1992). The A nucleotide at
position -1 was changed into C to create an NcoI site over
the initiation codon using PCR. In all three constructs this
NcoI site was used for fusion to the GUS-nos reporter gene
derived from plasmid pMOGEN18 (Sijmons et al., 1990).
Constructs with the full-length promoter of 1346 bp upstream of the translation start site and 5’ deletions retaining
488 and 148 bp upstream, respectively, were cloned into
the polylinker of pMON505 (Rogers et al., 1987).
The recombinant vector was mobilized from E. coli BB-4
into Agrobacterium LBA4404 in a triparental mating with E.
coli HBlOl harboring pRK2013. Nicotiana tabacum cv Samsun were transformed as described by Horsch et al. (1985).
Plant Material
To determine the GUS activity of the primary transformants, three clones were produced of each primary transformant and grown on Murashige-Skoog medium (Murashige and Skoog, 1962) supplemented with 10 g / L SUCin
a sterile environment with a 1ight:dark cycle of 16:8 h.
When the plantlets had five to seven leaves, GUS activity
was determined for the third leaf from the top of each plant
in a fluorometric assay. As a control, three clones of a
wild-type plant were used.
For experiments with seedlings, sterile transformant
seeds (F, generation) were germinated on MurashigeSkoog supplemented with 10 g / L SUCand grown in a
sterile environment with a 1ight:dark cycle of 16:8 h. At
times indicated in the figure legends, roots and shoots of
the seedlings were collected for RNA extraction and fluorometric assays; they were cut 3 to 4 mm from the hypocotyl and the hypocotyl-root border region was discarded.
Plant Physiol. Vol. 1 1 2, 1996
NJ), vortexed, and incubated for 1 h at 37°C. The reaction
was stopped with 1.75 mL of 0.2 M Na,CO, and fluorescence was measured in a fluorometer (model TKO 100, A,,
= 365 nm, A,,=460
nm; Hoefer Scientific Instruments, San
Francisco, CA). Protein concentration was determined using the Bio-Rad protein assay. For histochemical staining,
plant tissues were incubated in 5-bromo-4-chloro-3-indoylP-D-glucuronic acid solution for 2 h to overnight until the
blue staining had reached sufficient intensity. At the beginning of the reaction a slight vacuum was applied to
permit a better infiltration of the substrate solution. Details
of the staining, tissue embedding, and sectioning were
described by Mandel et al. (1995).
RNA Analysis
RNA extractions and northern blots were carried out
essentially as described by Fleming et al. (1992), with the
only difference being that the full-length 710-nt-long XbaIHindIII Ntltpl cDNA insert from the Bluescript vector
pTM91-18 and the 1.4-kb EcoRI eIF-4A cDNA insert from
the plasmid peIF-4A10 were used in a random primed
reaction to synthesize the radioactive probes. As a control
following hybridization with the Ntltpl probe, the membranes were stripped and hybridized with the eIF-4A
probe, which hybridized to all of the RNA samples with
similar intensity (results not shown). EIF-4A has been
shown to be constitutively expressed in tobacco plants
(Owttrim et al., 1994; Mandel et al., 1995). The intensity of
the signals was measured on a molecular imager (model
GS250, Bio-Rad).
In situ hybridization was performed as described by Cox
and Goldberg (1988) and Sterk et al. (1991). As probes,
sense and antisense transcripts of the ltpl cDNA (cutting
the pTM91-18, respectively, with HindIII and XbaI and
using the appropriate primers) were used.
Sequence Analysis
Sequence comparisons were performed with the GCG
software (Wisconsin Genetics Computer Group, sequence
analysis software package, version 6.2).
The sequences used in this work are stored in the GenEmbl library with the following accession codes: N. tabacum
cv Samsun ltpl, X62395; Hordeum vulgare cv Bomi ltpl and
472, X59253 and X69793, respectively; H. vulgare cv Himalaya papi and cv kval, M15207 and X78205, respectively;
and Sorgkum vulgare ltpl and 472, X71667 and X71668,
respectively .
Electrophoretic Mobility Shift Assay
Determination of CUS activity
GUS activity in crude plant extracts was determined
essentially as described by Jefferson (1987). Plant tissue
was harvested and immediately homogenized by grinding
in 0.5 mL of lysis buffer: 1 mM EDTA, 10 mM p-mercaptoethanol, 0.1% Triton X-100 (Sigma), 50 mM Na,HPO,/
NaH,PO,, pH 7.0. Twenty-five microliters of the homogenate was added to 0.25 mL of lysis buffer containing 1 mM
4-methylumbelliferyl-~-~-glucuronide
(Serva, Paramus,
Nuclear extracts were prepared from leaf and root tissue
of 8-week-old N. tabacum grown on hydroculture in a
growth room. The method used was essentially that of
Green et al. (1989). Probes were labeled by filling 3’ overhangs using the Klenow fragment of E. coli DNA polymerase I and [a-32P]dCTP. DNA-binding reactions contained
1.5 to 2 Fg of poly(dI.dC), 1X loading dye (8% glycerol, 1X
TBE [89 mM Tris, 89 mM boric acid, 2 mM EDTA], 0.02%
bromphenol blue, and 0.02% xylene cyanol FF), 0.5 to 1.5
51 5
Tobacco ltpl
fmol (500-50.000 cpm) of radioactively labeled DNA fragments, and 3 to 4 Fg of nuclear extract. After a11 of the
components were added, the reaction was adjusted to 10
FL with binding buffer (45 mM KCl, 1.1 mM EDTA, 0.5 mM
DTT, 25 mM Hepes, pH 7.5, 5% glycerol). Specific unlabeled competitor (188- or 120-bp fragment), as well as
unrelated DNA (35s DNA or Ntltpl-promotor sequence
-1099 to -920), was included in the binding reactions.
After a 20-min incubation at room temperature, samples
were separated on a 4% native polyacrylamide gel in 0.25X
TBE. If competitor DNA was used, 10 min of incubation
were allowed before the probe was added and the reaction
was incubated for a further 20 min. The gels were dried
and autoradiographed.
RESULTS
Molecular Cloning and Analysis of the N t k p I Promoter
In previous work a cDNA and a genomic clone encoding
a protein with homology to a maize LTP were isolated
(Fleming et al., 1992). The 5’ end of the mRNA was determined by nuclease S1 protection analysis. The genomic
clone had only a 310-bp sequence upstream of the ATG. To
obtain an additional upstream DNA region of the Ntltpl
gene, the genomic clones that had been isolated previously
(Fleming et al., 1992) were analyzed further. A 5-kb fragment was subcloned, sequenced, and found to contain a
1346-bp sequence upstream of the translation start codon
(Fig. 1).This 1346-nt sequence contains the putative TATA
box at position -135, -29 nt from the transcription start
(Fleming et al., 1992).
The Ntltpl-promoter sequence was compared with other
ltp-promoter sequences reported in the literature. An 18-nt
AT-rich perfect palindrome (S1 box in Fig. 1)was found at
position -603 and a second 8-nt perfect double palindrome
CTAGCTAG (Dl box in Fig. 1)was found at position -57
and, partially conserved (6 of 8 nt identity), at position -95
in the leader region of the Ntltpl promoter. The D1 box is
also present in the leader of H . vulgare ltpl and in its
putative homolog Hvpapi at position -44 and, partially
conserved, at position -24 from the ATG (Mundy and
Rogers, 1986; Skriver et al., 1992);in the promoter region of
H. vulgare ltp2 at position -84 from the ATG (Kalla et al.,
1994); in S. vulgare Itpl at position -184 and, partially
conserved, three times more at position -103, -75, and
-63 from the ATG; and in S. vulgare ltp2 at position -173
and, partially conserved, twice at positions -160 and -192
from the ATG (Pelèse-Siebenbourg et al., 1994) (Table I).
To investigate the spatial regulation of the Ntltpl promoter, the 1346-bp promoter fragment was fused to the
GUS gene and transformed via Agrobacterium into N. tabacum cv Samsun. Fifteen independent transformants were
obtained and tested for GUS activity. The transformants
showed different intensities of GUS activity, the highest
being 150-fold more active than the lowest (Fig. 2). This
variability in GUS expression is probably due to the transcriptional activity of the region in which the construct was
inserted.
Tissue sections and intact seedlings of a11 the independent transformants at various stages of development were
stained from 2 h to overnight and the pattern of GUS
staining was recorded. Thirteen of 15 lines exhibited qualitatively similar patterns of expression of GUS activity. The
intensity of the GUS staining decreased with the age of the
tissue, confirming the presence of a developmental gradient in Ntltpl expression previously shown at the leve1 of
Ntltpl transcript accumulation by Fleming et al. (1992).
The Ntltpl Gene 1s Specifically Expressed in the
Mature Plant
Previous in situ hybridization data indicated that the
Ntltpl transcript was localized to the leaf epidermis (Fleming et al., 1992). Analysis of leaf tissue from plants transgenic for the 1346-GUS construct revealed that the pattern
of GUS expression was indeed predominantly restricted to
the epidermis, as shown in Figure 3, A and B. Moreover,
GUS signal was not uniformly distributed within the epidermis; there seemed to be a higher concentration in the
-1346
-1271
-1210
-1191
-1190
-1111
-1110
-1031
-1030
-951
-950
-811
-810
-191
-190
-111
-710
-631
-630
-551
-550
-411
-410
-391
-390
-311
-310
-231
-230
-151
-150
-71
-10
13
Figure 1. Ntltpl promoter sequence of the 5’
region upstream from the ATG start codon. The
nt’s are numbered starting from the A (+1) of the
ATG start codon. The putative TATA box at
position -1 35, the transcription start at position
-106, and the ATG start codon are underlined.
The 18-nt-long palindrome S1 at position -603
and the 8-nt-long palindrome D1 at positions
- 5 7 and, partially conserved, at position -95
are shown in bold type.
51 6
Plant Physiol. Vol. 11 2, 1996
Canevascini et al.
Table 1. Sequences related to the 01 box found at the ATG-upstream region o f Itp genes from different species and the hva 1 gene from
barley
Positionj
Species
Gene
Sequence
Reference
a
N. tabacum cv Samsun
Itpl
S. vulgare
ltpl
ltp2
H . vulgare cv Bomi
ltpl
H. vulgare cv Himalaya
ltp2
PaPi
hval
Consensus
a
CCAACACTAGCTCCTACT
CCCCTAGCTAG ATACTT
CTACTGCTCTAGCTACCTCC
TCTCCTCACCAGCTAGCACT
CATTCAAACCTACTAC
CACAACCTAGC
CGCTAGCTAGCTACT
TACCTAGCTC
TCTCCTCACCAGCTAG
CATCACTAGCTAGTACCT
CTACTGTTAGCTACAGATT
CCCCTAGCTACAAACTT
CATCACTAGCTAGTACGT
ACCCCCTAGCTAGTTTAA
C CTAGCTAG TACT
11
49
23
43
-1 5
23
-293
b
-95
-57
-1 75
-103
- 75
-63
-173
-160
-92
-44
- 24
- 84
-44
-395
Fleming et ai., 1992
Pèlese-Siebenburg et al., 1994
Pèlese-Siebenburg et al., 1994
Linnestad et ai., 1991
Kalla et ai., 1994
Mundy and Rogers, 1986
Straub et al., 1994
The distance (in bp) from the putative a: transcription start site; b: translation start site.
guard cells forming the stoma. This is apparent both in
Figure 3B and, at a higher magnification, in Figure 3C.
Cross-sections through transgenic stems also revealed a
predominantly epidermis-restricted pattern of GUS expression (Fig. 3D). However, within the sections there was also
a component of GUS expression that was not restricted to
the epidermis. For example, in Figure 3A some cells of the
cortex on the adaxial side of the mid-rib of the leaf express
the Ntltpl-GUS construct. A low GUS staining was also
observed in the spongy parenchyma of leaves (Fig. 3B).
Such nonepidermal expression of the Ntlfpl promoter
was most obvious in sections of tissue containing small
nondifferentiated cells. For example, Figure 4, A to C, show
longitudinal sections through the stem of an Ntltp’l-GUS
transgenic plant taken at different positions along the
apical-basal axis of the plant. In the most dista1 region (Fig.
4A) at the junction of the stem and a petiole, a high GUS
expression can be observed in the axis, with the blue signal
extending radially from the epidermis into the outermost
layers of the cortex and the axillary meristem. At more
proximal positions along the stem (Fig. 4, B and C), the
signal in the cortex progressively decreases and the epidermis-specific component of the expression pattern becomes
more apparent.
Nonepidermal expression of the 1346-GUS construct is
also observed in sections through vegetative (Fig. 4D) and
floral (Fig. 4E) meristems, in cortical cells of the young leaf
mid-rib (Fig. 4F), and, in germinating seedlings, in cortical
cells of the young root at the boundary with the hypocotyl
(Fig. 4G). In these examples (meristem, young leaf, and
young root) it was difficult to distinguish any strong preferential expression of the GUS construct in the epidermis,
indicating that the expression pattern observed was not
simply the result of diffusion following a high localized
activity of the ltpl promoter.
The Nfltpl Cene 1s Specifically
Regulated during Cermination
wt 9 81 84 50 78 7 64 2 40 1 75 53 59 3 82
Transformants nr.
Figure 2. Fluorometric activity of the 1346-GUS primary transformants. Primary transformants were grown on Murashige-Skoog medium containing lO g/L Suc on a 1ight:dark cycle of 16:8 h at 25°C.
When the plantlets had five to seven leaves, CUS activity was
determined for the third leaf from the top of the plant (n = 3). wt,
Wild type.
The observation of expression of the 1346-GUS construct
in young cells of the germinating root led us to examine
further the expression pattern in the germinating seedling,
since both our previous data (Fleming et al., 1992) and
those of other groups (Skriver et al., 1992; Kotilainen et al.,
1994; Pyee and Kolattukudy, 1995) suggested that LTP
gene expression is restricted to aerial portions of the plant.
However, examples in which an LTP protein (Thoma et al.,
1993) or l t p transcripts (Molina and García-Olmedo, 1993;
Krause et al., 1994) are found in roots are known.
Tobacco /fp1
517
Figure 3. Histochemical GUS assay of the 1346GUS transformants shows that the GUS stain accumulates in the epidermis of mature tissues. A
and B, Hand cross-sections through a young leaf.
Bars = 560 and 170 /am, respectively. C, Phasecontrast micrograph of a stripped epidermis. The
epidermis cells are out of focus because they are
lying on a lower plane than the guard cells. Bar =
40 /am. D, Hand cross-section through a young
stem. Bar = 420 jam.
u
Analysis of transgenic seeds following imbibition indicated a localized activity of the Ntltpl promoter toward the micropylar pole of the seed, as shown in Figure
5A. This signal was predominantly visible in the integuments surrounding the micropyle, and, indeed, dissection of the embryo from the seed coat followed by analysis of GUS expression indicated that expression of the
Ntltpl promoter in the imbibing embryo was virtually
undetectable (data not shown). Subsequent to the emer-
gence of the radicle, the GUS signal became apparent
throughout the hypocotyl and cotyledons of the seedling, and it remained high in the integuments surrounding the micropyle (Fig. 5B). To verify the GUS expression
pattern seen in the germinating seedling, we performed
a series of in situ hybridizations using an antisense probe
for the Ntltpl transcript. Surprisingly, at a developmental stage equivalent to that shown in Figure 5B, in situ
hybridization revealed a predominantly epidermis-
m
sp
sp
Figure 4. Histochemical GUS assay of the
Ntltpl-GUS transformants showing that GUS
activity is very high and not epidermis-specific
in young, growing tissues. A to C, Hand longitudinal sections through a 1-week-old stem.
Bar = 830 /am. D, Longitudinal section of a
shoot apical meristem. m, Meristem; Ip, leaf
primordium. Bar = 40 /am. E, Longitudinal section of a floral meristem at the sepal stage, sp,
Sepal primordium. Bar = 85 /am. F, Hand crosssection of a young petiole. Bar = 330 /am. G,
Longitudinal section of the stem-root border region in a young seedling, h, Hypocotyl; v, vascular tissue; e, root epidermis; c, cortex cells.
Bar = 250 /am.
Canevascini et al.
518
Plant Physiol. Vol. 112, 1996
D
f
Figure 5. Histochemical CUS assay of the Nf/tpl-GUS transformants and in situ hybridization. The Nt/fpl promoter drives
a developmentally regulated expression of the CUS marker gene during germination and seedling growth. A, Dark-field
micrograph of a 1-d imbibed seed. The CDS stain is revealed as a pink signal. The arrow shows the site of radicle
penetration. Bar = 280 fj.m. B, Dark-field micrograph of a 3-d-old seedling with the cotyledons still in the seed envelope.
The thin arrow shows the endosperm at the site of the penetration. The thick arrow shows the hypocotyl adaxial site where
the maximal CUS activity is found. Bar = 280 jam. C and D, Longitudinal (C) and cross-sections (D) of 3-d-old seedlings.
The sections were hybridized with the Ntltpl cDNA antisense probe. Signal is seen as a dark precipitate in these bright-field
micrographs. The thick arrows show the hypocotyl adaxial site where the maximal Nf/(p1 mRNA concentration is found.
Bars = 420 and 110 j^m, respectively. E, A 4-d-old seedling showing CUS activity in the bent hypocotyl marked by a thick
arrow. Bar = 830 jim. F, Six-day-old seedlings showing GUS activity in roots at the hypocotyl-root border region. Bar = 1
mm. G, Nine-day-old seedling showing GUS activity in root epidermis and in the shoot apex and the petioles of the
cotyledons (thick arrow). The site of the root apex is marked by the thin arrow. Bar = 1 mm.
specific signal restricted to the cotyledons and hypocotyl, reaching the maximal intensity in the adaxial site
of the hypocotyl (arrow in Fig. 5, C and D).
As the cotyledons expanded and were drawn backward via the hypocotyl hook, GUS expression became
limited to the hypocotyl region and the apex between the
cotyledons (Fig. 5E). At a later stage of development, the
apical hook unfurled and GUS expression was restricted
to a portion of tissue at the shoot/root boundary (Fig.
5F). This area is equivalent to that shown in cross-section
in Figure 4G, indicating a nonepidermal localization of
the GUS signal.
The Ntltpl Promoter Is Active in the Root Epidermis
During subsequent elongation and formation of the first
true leaves, GUS expression in the aerial portion of the
plant was highest in the region of the shoot apex (Fig. 5G).
Previous data had indicated a gradient of Ntltpl expression
within the plant, with the highest level of Ntltpl transcripts
being measured in the apical part of the plant (Fleming et
al., 1992). However, at this stage of seedling development
the most striking expression of the 1346-GUS construct was
observed in the portion of the root that had generated root
hairs (Fig. 5G). Analysis of cross-sections (Fig. 6A) and
longitudinal sections (Fig. 6B) of roots at this stage of
development revealed the predominantly epidermal nature of this expression pattern. We have previously argued
that histochemical GUS data are prone to misinterpretation
and that it is essential to perform proper controls with
constitutively expressed genes (Mandel et al., 1995). Here
we show the expression of 35S-GUS and NeIF-4A10-GUS,
both of which are expected to be evenly expressed in all
cells of the root (Fig. 6, C and D). These promoters drive
GUS expression in all cells of the root, and the pattern
obtained is clearly different from that seen with the Ntltpl
promoter. Thus, we conclude that the Ntltpl gene directs
expression in the root epidermis, with occasional cells of
the outer cortex showing relatively high GUS signals.
Since our previous analysis of mature roots had failed to
detect significant levels of Ntltpl transcripts, we performed
a northern blot analysis of Ntltpl transcript levels in RNA
extracted from precisely staged root tissue following embryo germination. The results of this analysis, shown in
Figure 7, A and B, indicate that Ntltpl transcripts are
indeed present in young root tissue. The level of Ntltpl
transcript is higher than that measured in RNA extracted
from mature root tissue but is still relatively low compared
with that measured in aerial parts of the plant (40 times less
519
Tobacco /fp1
Figure 6. Cross-section (A) and longitudinal
section (B) of roots of 16-d-old seedlings showing CDS activity in root tissue, e, Root epidermis; c, cortex cells. Bars = 85 and 43 ^m,
respectively. C and D, Cross-sections of roots of
16-d-old seedlings of 4A-10-GUS (C) and 35SCUS (D) transgenic plants. Bars = 90 and 100
/urn, respectively.
than in expanding leaves, results not shown). The trend of
increasing Ntltpl transcript level in the root during early
development correlated with the measured GUS activity
in transgenic roots at equivalent stages (compare B and C,
Fig. 6).
Delineation of Sequence Elements Required for
Epidermis-Specific Expression
Two 5' deletions were constructed starting from the
1346-GUS construct. These contained 488 and 148 bp of
sequence upstream of the translational start site, respectively. Since the 5' untranslated leader is 106-nt long (Fleming et al., 1992), the shorter deletion retains only 42 bp of
untranscribed DNA, 13 bp of which are upstream of the
TATA-box. The deletions were fused to the GUS-nos 3'
reporter gene and introduced into tobacco. Ten and 14
independent transgenic plants were obtained for the 488GUS and the 148-GUS constructs, respectively. Fa seedlings
were separated into roots and shoots, and GUS enzymatic
activity was determined fluorometrically (Fig. 8). The activity in shoots was lower than in roots in all three transgenic families. The -488 deletion did not show great
changes in activity, compared with the -1346 deletion. In
contrast, GUS activity decreased consistently with the
— 148 deletion, showing a particularly low expression in
shoots.
To determine whether deletion of upstream DNA compromised the spatial distribution of GUS expression, the
enzyme was detected histochemically in plastic sections.
The low activity and variability in shoots of the —148
deletions precluded a reliable determination of tissue specificity. In roots, however, expression was sufficiently high
to obtain consistent results. A clear epidermis-specific expression was observed with both deletions (—488 and
— 148), which was indistinguishable from that shown in
Figure 6, A and B, for the 1346-GUS construct. Therefore,
we conclude that minimal elements required for epidermis-
specific expression reside in the 148 bp preceding the translational start site.
Proteins Binding to the Minimal Sequence
Based on the results of the in situ localization studies,
we focused our interest on the smallest promoter deletion construct, the 148-bp fragment, and attempted to
characterize DNA-protein interactions by using electrophoretic mobility shift assays. Tobacco nuclear protein
extracts were prepared from leaf and root tissue of
8-week-old plants and were incubated with a 32P-labeled
— 148 DNA fragment. When using leaf extracts, one retarded band was observed, indicating the formation of a
DNA-protein complex (Fig. 9A). The addition of a 500fold molar excess of unlabeled 148-bp fragment as a
specific competitor had no effect on binding of the labeled probe. Only at a 1000-fold excess was binding
reduced. A fragment containing the cauliflower mosaic
virus TATA box, and added at the same molar concentration, did not interfere with binding.
We reasoned that the very high amount of competitor
required might reflect the presence of abundant general
transcription factors binding to the TATA box. Therefore, a
slightly shorter fragment was created in which the TATA
box was no longer present (deletion —120 to —2; Fig. 9B).
Three DNA-protein complexes were detected when this
fragment was used as a radiolabeled probe (Fig. 9B, lane 2).
These interactions were competed away by increasing
amounts of the nonlabeled 148-bp fragment (lanes 3-5). It
is interesting that a new band appeared with a higher
migration rate when competition with the 148-bp fragment
was carried out but not with the cold probe as a competitor.
No competition was observed when an unrelated DNA
fragment was included in the binding reaction. This indicates that the factors forming the three retarded complexes
are specific for the Ntltpl —120 to -2 promoter sequence.
Canevascini et al.
520
I
\
Plant Physiol. Vol. 112, 1996
pression during plant development; consensus patterns of
expression presumably indicate consensus functions. The
use of promoter-GUS fusions introduced into transgenic
plants provides a powerful system for the relatively facile
examination of gene tissue expression pattern in various
organs at various stages of development under various
I
900 nt -
10
11
60
t(days)
60
g
o-
I
6
1
2-
S
n-
_
240
B
220
13
"
80 -
'a
60 -
•
i 11n
40 00
9
10
11
60
20 -
t(days)
o
I
160 -
120 -
o
T
CO
80 -
O
I
40 -
R S R S R S R S
A1346 A488 A148
wt
aex
T
7
8
n
9
10
11
R S
A1346
60
t (days)
Figure 7. Ntltpl mRNA concentration and GUS activity in roots are
developmental^ regulated. Seeds of the transformant number 40
were germinated on Murashige-Skoog medium under a light:dark
cycle of 16:8 h. Roots were collected from the 7-, 8-, 9-, 10-, and
11-d-old seedlings grown on Murashige-Skoog medium and from
60-d-old plants grown on soil (transformant no. 64) and, in parallel,
RNA extracted and GUS activity measured in a fluorometric assay.
Ten micrograms of total RNA was loaded in each lane for the
northern blot. A, Northern blot hybridized with the Ntltp] antisense
probe. B, Nf/rpl mRNA quantification. The bands of the northern blot
shown in A were quantified on a phosphorimager. C, Fluorometric
GUS activity. The GUS activity of the 60-d-old plants (transformant
number 64) cannot be directly compared with those reported for the
7- to 11-d-old plants (transformant no. 40) because a different transformant line was used.
R S
A488
R S
A148
R S
wt
B
-Transcription
-1346
GUS
nos 3'
GUS
nos 3'
GUS
nos 31
ATG
-488
ATG
ATG
No specific interactions were detected with extracts derived from roots (results not shown).
DISCUSSION
One approach to understanding the function of the various plant LTPs cloned is to analyze their pattern of ex-
Figure 8. A, Fluorometrically measured GUS activity of Nt/fp1-GUS
constructs in 15-d-old transgenic tobacco seedlings. Inset shows
GUS activity measured in individual transgenic lines from which the
mean data (shown on top of the bars in the large graph) were derived.
R, Root; S, shoot; wt, wild type; MU, methylumbelliferone. B, Schematic diagram of the constructs used to create the -1 346, -488, and
-148 Itp deletion-GUS transgenic plants.
Tobacco /tp1
521
B
competitor:
competitor:
148 bp fragment
35STATA
500x lOOOx
SOOxlOOOx
148 bp fragment
120 bp fragment
-1099 to-920
-Iruucription
-148
20x
lOOx 300x
300x
lOOx SOOx
pTranlcription
ATO
-120
ATG
Figure 9. A, In vitro binding of nuclear leaf proteins to the 148-bp fragment of the Nf/fpl promoter. Radiolabeled fragments
(0.64 fmol) were incubated with 2 jug of poly(dl.dC) in the absence (lane 1) or presence (lanes 2-6) of 4 fj.g of tobacco
nuclear leaf extract from 8-week-old tobacco plants. The molar excess of unlabeled competitor DNA in the binding reactions
are indicated. The 35S DNA is the minimal promoter of the cauliflower mosaic virus. Arrow, Large size complex; F, free
probe. The scheme below the retardation assay shows the 148-bp fragment used in this experiment. B, In vitro binding of
nuclear leaf proteins to the Nf/tpl promoter sequence from -120 to -2 bp. Radiolabeled fragments (0.63 fmol, -120 to -2)
were incubated with 1.5 jug of poly(dl.dC) in the absence (lane 1) or presence (lanes 2-8) of 3 ;u.g of tobacco nuclear leaf
extract. Arrows indicate the three new bands. F, Free probe. The scheme below the retardation assay shows the 120-bp
fragment used in this experiment.
environmental conditions. Moreover, the cloning and analysis of such promoter sequences allows the dissection of
regulatory elements within the promoter.
The Ntltpl Expression Pattern Contains Both
Epidermal and Nonepidermal Components
In the 1346-GUS transformants GUS activity in relatively
mature leaves and stems was predominantly epidermisspecific. This is in accord with our previous analysis of
Ntltpl transcript distribution (Fleming et al., 1992) and
with the various reports on lip gene expression performed
in other species (Sossountzov et al., 1991; Clark and
Bohnert, 1993; Fleming et al., 1993; Thoma et al., 1993,
1994), in which at least some degree of epidermis specificity was described. However, even in mature leaves and
stems at least some faint GUS staining was generally visible in nonepidermal tissue. This nonepidermal expression
was most apparent in tissue containing small, relatively
nondifferentiated cells, e.g. apical meristems, axillary meristems, and hypocotyl tissue. In contrast, in situ hybridization analysis of these tissues revealed a predominantly
epidermal restriction of transcript distribution (Fig. 5, C
and D). However, it should be remembered that the two
methods of analysis, in situ hybridization and GUS histochemistry, reveal different aspects of gene expression. In
situ hybridization analysis provides an image of RNA distribution at an instant in time, whereas GUS histochemistry
reveals the accumulation of the GUS protein in cells over a
period of time. Analysis of GUS enzyme activity may thus
reveal areas of promoter activity that are poorly resolved
by in situ hybridization.
Although lip 1 transcripts may accumulate in epidermal
cells, our data indicate that the ltp\ gene is expressed to
some extent in some nonepidermal tissues.
One surprising observation in this study was the high GUS
activity in the roots during seedling germination. Our previous analysis of Ntltpl mRNA accumulation failed to detect
any transcripts in mature root tissue, in accord with the data
on other Itp genes. However, an analysis of Ntltpl transcript
levels in RNA extracted from the precise developmental stage
indicated by the GUS assay did reveal a low, but detectable,
level of Ntltpl mRNA. This expression is predominantly, but
not exclusively, restricted to the epidermis and root
hairs. In addition to providing an example of the power
of the GUS reporter gene system in revealing specific
gene expression patterns, the activity of the Ntltpl promoter in the root epidermis has a bearing on the potential function of the encoded LTP. The northern blot data
(Fleming et al., 1992; this work) show that the Ntltpl
mRNA accumulates at high levels in the young tissues in
the aerial part of the plant and at a much less extent in
the roots. This is also true for 10- to 20-d-old seedlings,
in which the Ntltpl transcript accumulates 40 times more
in the apex than in the roots (results not shown). In 10to 20-d-old seedlings of Ntltpl-GUS transgenic lines,
GUS activity was higher in roots than in aerial tissues
522
Canevascini et al.
(Figs. 5G and 8). A different GUS mRNA or GUS-protein
stability in these tissues could explain this discrepancy.
In two cases we observed a clear discrepancy between
the GUS data and the results obtained from in situ
hybridization. Both in the shoot apical meristem (Fleming et al., 1992) and in young seedlings (Fig. 5, A-D) in
situ hybridization shows clearly that expression is preferentially in the epidermis, whereas GUS studies do not.
Explanations could include different sensitivity of the
two assays, diffusion of the 5-bromo-4-chloro-3-indoylp-D-glucuronic acid reaction product, or lack of regulatory elements in the promoter-GUS construct. Whichever
explanation is accepted we believe that detailed histochemical data obtained with reporter genes are more
trustworthy when they are accompanied by analysis at
the RNA level. In the case of roots in which low RNA
levels precluded in situ hybridization, we performed
GUS assays with two constitutive control promoters (Fig.
6, C and D). Both the 35s and the NeIF-4A10 promoter
clearly showed fairly uniform expression in a11 cell types
of the root. The contrast of these expression patterns
with that obtained for the Ntltpl promoter (Fig. 6, A and
B) instills confidence that Ntltpl expression is indeed
limited to the root epidermis.
The Potential Role of LTP in Plant Defense
LTPs have been proposed to play a role in cutin deposition. In agreement with this hypothesis, GUS activity in the
Ntltpl-GUS transgenic plants was always detected in cells
coated by a cutin layer. For example, the GUS staining was
found in the epidermis of the aerial part of the plant,
showing the highest apparent intensity in the guard cells
(Fig. 3, A-C). The higher GUS activity in guard cells correlates with the higher concentration of LTPs in cell walls
of guard cells observed in Arabidopsis by Thoma et al.
(1993). A low GUS staining was observed in the spongy
parenchyma of leaves, where the presence of a thin cuticle
on the surface of the cells facing the stomatal space has
been observed (Esau, 1969).
It appears to be generally accepted that roots do not
synthesize cutin (Buvat, 1989; Thoma et al., 1993), so the
expression of Ntltpl in root tissue would indicate that the
encoded protein cannot function exclusively in cutin synthesis. However, it must be mentioned that for severa1
plants cutin deposition in roots has been reported (Scott et
al., 1958; Esau, 1969).
An alternative hypothesis, that LTPs function in the intracellular trafficking of lipids (Sossountzov et al., 1991), is
supported by our observation that the Ntltpl gene is expressed to some level in various nonepidermal tissues.
However, an exclusive function in such intracellular transport is difficult to reconcile with the observed epidermisspecific component of ltp gene expression reported both in
this and other studies. In particular, the presence of signal
peptide sequences and the extracellular immunolocalization of LTPs suggest that a major function of LTPs lies
outside the plasma membrane, in particular in the epidermis. (Bernhard et al., 1991; Thoma et al., 1993).
Plant Physiol. Vol. 112, 1996
One correlation that can be drawn from this study is that
a high Ntltpl promoter activity occurs in parts of the plant
that are vulnerable to physical disruption and, thus, to
potential invasion by pathogens. For example, tissue at the
micropylar pole of the embryo, hypocotyl tissue at the
shoot/root boundary, root hairs, stem/leaf axils, and leaf
and stem epidermis are a11 areas of the plant that are liable
to physical damage either as a result of plant growth or
environmentally induced physical stress. Given that there
is evidence that LTPs can function to inhibit pathogen
growth (Terras et al., 1992; Molina and García-Olmedo,
1993; Molina et al., 1993) and that the specific expression of
other genes with a potential role in plant defense has been
shown to occur in similar parts of the plant, e.g. glucanase
in the micropylar integuments (Vogeli-Lange et al., 1994);
chalcone synthase at the rootlshoot boundary (Schmid et
al., 1990), it is tempting to speculate that a significant
function of LTP lies in being a component of a preformed
defense at areas of likely pathogen invasion.
Promoter Elements Required for
Epidermis-Specific Expression
Northern blot data indicated that the Ntltpl gene is relatively highly expressed in young aerial tissues and is
barely detectable in roots. In contrast, the 1346-GUS construct confers a higher expression in roots than in shoots.
The simplest explanation for this discrepancy is that quantitative enhancer elements conferring expression in shoots
are located upstream of -1346.
Promoter deletion analysis of the Ntltpl promoter indicates that 148 bp of the 5’ flanking region are sufficient to
regulate a mainly epidermis-specific gene expression, but
elements in the upstream sequences are necessary to
achieve maximal expression of the GUS gene in transgenic
F, seedlings. Indeed, gel retardation assays demonstrated
that there was specific binding of leaf nuclear factors to the
region between -438 and -203 (data not shown).
The protein-binding activities of most interest are the
ones on the 148-bp fragment, since the minimal requirements for correct spatial distribution are met by this DNA
sequence. One retarded band could be detected by incubation of this fragment with leaf nuclear protein extract. The
DNA-protein complex migrated very slowly and hardly
entered into the gel, indicating a large complex. A 1000fold excess of unlabeled probe reduced binding, whereas a
fragment containing the 35s TATA box did not. Our hypothesis is that the high excess of specific competitor required reflects the presence of abundant general transcription factors associated with the Ntltpl TATA box, as is the
case in other organisms (Conaway and Conaway, 1993;
Buratowski, 1994). In a recently published work, the interaction of initiator and downstream elements with subunits
of the transcription factor IID complex (TATA box-binding
protein-associated factors) was discussed and the data suggest the involvement of these interactions in promoter
selectivity and transcriptional regulation (Verrijzer et al.,
1995). In plants, evidence exists that points to sequences
close to the TATA box as elements important for light
regulation and tissue specificity (Morelli et al., 1985; Ku-
Tobacco ltpl
hlemeier e t al., 1989). Similarly, t h e region a r o u n d the
Ntltpl TATA box could play a role i n epidermis-specific
expression. On the other hand, a D N A sequence without
t h e TATA box, extending f r o m -120 t o -2 bp, specifically
interacted w i t h nuclear proteins (Fig. 8B), suggesting that
regulatory elements m a y reside downstream of the TATA
box, possibly i n t h e transcribed D N A . Posttranscriptional
control h a s been reported for t h e Medicago sativa Mspvp2
gene, which i s related t o nonspecific LTPs (Kuhlemeier,
1992; Deutch a n d Winicov, 1995). A good candidate for a
regulatory element involved in posttranscriptional control
could b e the conserved double palindrome CTAGCTAG.
Further experiments will be directed a t establishing t h e
mechanism of ltp gene regulation, determining whether t h e
s a m e o r different elements confer epidermis specificity in
roots and shoots, a n d finally, precisely delimiting these
regulatory sequences together w i t h identification of the
protein factors that bind t o them.
ACKNOWLEDCMENTS
We thank Michael Stalder for help with the isolation of the
Ntltpl promoter, Roel op den Camp for stimulating discussions,
and Dr. Christoph Sautter and Professor Dr. M. Riederer for expertise in interpretation of the results. We are grateful to the
gardening team of the Berne Botanical Garden for professional
maintenance of the plants.
Received February 27, 1996; accepted June 27, 1996.
Copyright Clearance Center: 0032-0889/96/ 112/0513/ 12.
LITERATURE ClTED
Bernhard WR, Thoma S, Botella J, Somerville CR (1991) Isolation
of a cDNA clone for spinach lipid transfer protein and evidence
that the protein is synthesized by the secretory pathway. Plant
Physiol 95: 164-170
Buratowski S (1994) The basics of basal transcription by RNA
polymerase 11. Cell 77: 1-3
Buvat R (1989) Protective tissues. In Ontogeny, Cell Differentiation, and Structure of Vascular Plants. Springer-Verlag, Berlin,
pp 242-286
Clark AM, Bohnert HJ (1993) Epidermis-specific transcripts. Nucleotide sequence of a full-length cDNA of EPI12, encoding a
putative lipid transfer protein. Plant Physiol 103: 677-678
Conaway RC, Conaway JW (1993) General initiation factors for
RNA polymerase 11. Annu Rev Biochem 62: 161-190
Cox KH, Goldberg RB (1988)Analysis of plant gene expression. In
CH Shaw, ed, Plant Molecular Biology: A Practical Approach.
IRL, Oxford, pp 1-34
Deutch CE, Winicov I (1995) Post-transcriptional regulation of a
salt-inducible alfalfa gene encoding a putative chimeric prolinerich cell wall protein. Plant Moi Biol 27: 411418
Douady D, Grosbois M, Guerbette F, Kader J-C (1982) Purification of a basic phospholipid transfer protein from maize seedlings. Biochim Biophys Acta 710: 143-153
Esau K (1969)Die Epidermis. In Pflanzenanatomie. Gustav Fischer
Verlag, Stuttgart, Germany, pp 109-133
Fleming AJ, Mandel T, Hofmann S, Sterk P, de Vries SC,
Kuhlemeier C (1992) Expression pattern of a tobacco lipid transfer protein gene within the shoot apex. Plant J 2: 855-862
Fleming AJ, Mandel T, Roth I, Kuhlemeier C (1993) The patterns
of gene expression in the tomato shoot apical meristem. Plant
Cell 5: 297-309
523
Green PJ, Kay SA, Lam E, Chua NH (1989) In vitro DNA footprinting. IPI;SB Galvin, RA Schilperoort, DPS Verma, eds, Plant
Molecular Biology Manual. Kluwer Academic, Dordrecht, The
Netherlands, chapter 811, pp 1-22
Horsch RB, Fry JE, Hoffman NL, Eichholtz D, Rogers SG, Fraley
RT (1985) A simple and general method for transferring genes
into plants. Science 227: 1229-1231
Jefferson RA (1987) Assay for chimeric genes in plants: the GUS
fusion system. Plant Mo1 Biol Rep 5: 387405
Kader J-C, Julienne M, Vergnolle C (1984) Purification and characterisation of a spinach-leaf protein capable of transferring
phospholipids from liposomes to mitochondria or chloroplasts.
Eur J Biochem 139: 411-416
Kalla R, Shimamoto K, Potter R, Nielsen PS, Linnestad C, Olsen
O-A (1994) The promoter of the barley aleurone-specific gene
encoding a putative 7 kDa lipid transfer protein confers aleurone
cell-specific expression in transgenic rice. Plant J 6: 849-860
Koltunow AM, Truettner J, Cox KH, Wallroth M, Goldberg RB
(1990) Different temporal and spatial gene expression patterns
occur during anther development. Plant Cell 2 1201-1224
Kotilainen M, Helariutta Y, Elomaa P, Paulin L, Teeri TH (1994)
A corolla- and carpel-abundant, non-specific lipid transfer protein gene is expressed in the epidermis and parenchyma of
Gerbera hybrida var. Regina (Compositae). Plant Mo1 Biol 26:
971-978
Krause A, Sigrist CJA, Dehning I, Sommer H, Broughton WJ
(1994) Accumulation of transcripts encoding a lipid transferlike protein during deformation of nodulation-competent
Vigna unguiculatn root hairs. Mo1 Plant-Microbe Interact 7:
411-418
Kuhlemeier C (1992) Transcriptional and post-transcriptional regulation of gene expression in plants. Plant Mo1 Biol 19: 1-14
Kuhlemeier C, Strittmatter G , Ward K, Chua N-H (1989) The pea
rbcS-3A promoter mediates light responsiveness but not organ
specificity. Plant Cell 1:471478
Linnestad C, Lonneborg A, Kalla R, Olsen O-A (1991) The promoter of a lipid transfer protein gene expressed in barley aleurone cells contains similar Myb and Myc recognition sites as the
maize Bz-McC allele. Plant Physiol 97: 841-843
Madrid SM (1991)The barley lipid transfer protein is targeted into
the lumen of the endoplasmic reticulum. Plant Physiol Biochem
29: 695-703
Mandel T, Fleming AJ, Krahenbiil R, Kuhlemeier C (1995) Definition of constitutive gene expression in plants: the transiation
initiation factor 4A gene as a model. Plant Mo1 Biol29: 995-1004
Molina A, García-Olmedo F (1993) Developmental and pathogen
induced expression of the barley genes encoding lipid transfer
proteins. Plant J 4: 983-991
Molina A, Segura A, García-Olmedo F (1993) Lipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and funga1 plant pathogens. FEBS Lett 316:
119-122
Morelli G, Nagy F, Fraley RT, Rogers SG, Chua N-H (1985) A
short conserved sequence is involved in the light-inducibility of
a gene encoding ribulose 1,5-biphosphate carboxylase small subunit of pea. Nature 315: 200-204
Mundy J, Rogers J (1986) Selective expression of a probable amylasel protease inhibitor in barley aleurone cells: comparison to
the barley amylase/ subtilisin inhibitor. Planta 169: 51-63
Murashige T, Skoog F (1962) A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiol Plant 15:
473497
Owttrim GW, Mandel T, Trachsel H, Thomas AAM, Kuhlemeier
C (1994) Characterization of the tobacco eIF-4A gene family.
Plant Mo1 Biol 26: 1747-1757
Pelèse-Siebenbourg F, Caelles C, Kader J-C, Delseny M, Puigdomènech P (1994) A pair of genes coding for lipid-transfer proteins in Sorghum vulgare. Gene 148: 305-308
Pyee J, Kolattukudy PE (1994) Identification of a lipid transfer
protein as the major protein in the surface wax of broccoli
(Brassica aleracea) leaves. Arch Biochem Biophys 311: 460468
524
Canevascini et al.
Pyee J, Kolattukudy PE (1995) The gene for the major cuticular
wax-associated protein and three homologous genes from broccoli
(Brussicu olerucea) and their expression pattems. Plant J 7: 49-59
Rogers SG, Klee MJ, Horsch RB, Fraley RT (1987) Improved
vectors for plant transformation: expression cassette vectors and
new selectable markers. Methods Enzymol 153: 253-277
Sambrook L, Fritsch EF, Maniatis T (1989) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY
Schmid J, Doerner PW, Clouse SD, Dixon RA, Lamb CJ (1990)
Developmental and environmental regulation of a bean chalcone synthase promoter in transgenic tobacco. Plant Cell 2:
619-631
Scott FM, Hammer KC, Baker E, Bowler E (1958) Electron microscope studies of the epidermis of Alliunr cepu. Am J Bot 45: 449-461
Sijmons PC, Dekker BMM, Schremmeijer B, Venvoerd TC, van
den Elzen PJM, Hoekema A (1990) Production of correctly
processed human serum albumin in transgenic plants. Biotechnology 8: 217-221
Skriver K, Leah R, Müller-Uri F, Olsen F-L, Mundy J (1992)
Structure and expression of the barley lipid transfer protein gene
Ltpl. Plant Mo1 Biol 18: 585-589
Sossountzov L, Ruiz-Avila L, Vignols F, Jolliot A, Arondel V,
Tchang F, Grosbois M, Guerbette F, Migniac E, Delseny M,
Puigdomenech P, Kader J-C (1991) Spatial and temporal expression of a maize lipid transfer protein gene. Plant Cell 3:
907-921
Sterk P, Booij H, Schellekens GA, Van Kammen A, De Vries SC
Plant Physiol. Vol. 112, 1996
(1991) Cell-specific expression of the carrot EP2 lipid transfer
protein. Plant Cell 3: 907-921
Straub PF, Shen Q, Ho DTH (1994) Structure and promoter analysis of an ABA and stress regulated barley gene, HVA1. Plant
Mo1 Biol 26 617-630
Terras FRG, Goderis IJ, Van Leuven F, Vanderleyden J, Cammue
BPA, Broekaert WF (1992) In vitro antifungal activity of a radish
(Raphanus sativus L.) seed protein homologous to nonspecific
lipid transfer proteins. Plant Physiol 1 0 0 1055-1058
Thoma S, Hecht U, Kippers A, Botella J, De Vries S, Somerville
C (1994)Tissue-specific expression of a gene encoding a cell wall
localized lipid transfer protein from Arubidopsis. Plant Physiol
105: 3 5 4 5
Thoma S, Kaneko Y, Somerville C (1993) A non-specific lipid
transfer protein from Arubidopsis is a cell wall protein. Plant J 3:
427436
Verrijzer CP, Chen J-L, Yokomori K, Tjian R (1995) Binding of
TAFs to core elements directs promoter selectivity by RNA
polymerase 11. Cell 81: 1115-1125
Vogeli-Lange R, Fründt C, Hart CM, Beffa R, Nagy F, Meins F Jr
(1994) Evidence for a role of P-l,3-glucanase in dicot seed germination. Plant J 5: 273-278
Watanabe S,Yamada M (1986) Purification and characterisation of
a non-specific lipid transfer protein from germinated castor bean
endosperms which transfers phospholipids and galactolipids.
Biochim Biophys Acta 876 116-123
Wirtz KWA (1991) Phospholipid transfer proteins. Annu Rev Biochem 6 0 73-99