* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download From Genes to Proteins What do genes code for?
Cre-Lox recombination wikipedia , lookup
Bottromycin wikipedia , lookup
RNA silencing wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Protein moonlighting wikipedia , lookup
Biochemistry wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Western blot wikipedia , lookup
Non-coding DNA wikipedia , lookup
List of types of proteins wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Molecular evolution wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Protein adsorption wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Polyadenylation wikipedia , lookup
Point mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Proteolysis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Messenger RNA wikipedia , lookup
Protein Synthesis Notes 1/11/2017 From Genes to Proteins What do genes code for? PROTEINS Regulatory functions Other stuff? DNA proteins EVERY trait of the organism! Skiles, AP BIO 1 Protein Synthesis Notes 1/11/2017 The “Central Dogma” The flow of genetic information in a cell DNA RNA replication protein trait Retroviruses transcribe RNA into DNA through the use of an enzyme called reverse transcriptase: RNA → DNA → RNA → protein Some very primitive viruses use only RNA → proteins Prions are proteins directly replicating themselves by making conforma onal changes in other proteins, Protein → Protein (SCARY) BUT retroviruses, primitive viruses, and prions are technically not considered "alive” Do any organisms violate the central dogma? a Protein Synthesis: From gene to protein a a a trait a nucleus a a DNA transcription mRNA translation a a protein a a a cytoplasm Skiles, AP BIO 2 Protein Synthesis Notes 1/11/2017 RNA • Monomers = nucleotides • Ribose sugar • Nitrogen Bases • uracil instead of thymine • U bonds with A • C bonds with G • Single stranded • Location: • Nucleus or cytoplasm RNA Types of RNA • Ribosomal RNA (rRNA) • Major component of ribosomes • Transfer RNA (tRNA) • Folded upon itself • Carries the amino acids to the mRNA at ribosome • Messenger RNA (mRNA) • Sequence of nucleotides that determines the sequence of amino acids • Made in the nucleus from copying a DNA section: transcription • Small-nuclear RNA (snRNA or “snurps”) • Forms the “spliceosomes” which are used to cut out introns from pre-mRNA • Small-interfering RNA (siRNA) • targets specific mRNA and prohibits it from being expressed Skiles, AP BIO 3 Protein Synthesis Notes 1/11/2017 Transcription: DNA info copied to mRNA • Location: Nucleus • RNA polymerase: (gene) • AND a DNA section direction in 5’to 3’ • mRNA Leaves the nucleus through the nuclear pores to find a ribosome http://content.dnalc.org/content/c16/16905/16905_ transcription_advanced.jpg Coding strand = this side of DNA actually has the nucleotide sequence that ‘spells out’ the protein needed, a.k.a. the “sense strand” Template strand (noncoding) = the opposite side of the DNA, used to build the mRNA, a.k.a. the “anti-sense strand” WHY USE THE OPPOSITE SIDE??? Skiles, AP BIO 4 Protein Synthesis Notes 1/11/2017 How is Transcription Started? Transcription Factors • Cell signal to transcribe • Bind to promoter region • The “TATA Box” • Other TF’s bind • RNA polymerase can now bind • Turns gene on OR off Modifying the Transcript Splice animation Exons = • expressed / coding DNA Introns = non-coded section • in-between sequence Spliceosomes cut out introns with snRNAs intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence Skiles, AP BIO 5 Protein Synthesis Notes 1/11/2017 Alternative Splicing • Not all the exons may make it to the final product • Intron presence can determine which exons stay or go • Increases efficiency and flexibility in making proteins Final mRNA processing for Eukaryotes • Need to cytoplasm mRNA!) mRNA moving to (enzymes in cytoplasm will attack • add 5 GTP cap • add poly-A tail 3' A mRNA 5' Skiles, AP BIO G P P P 6 Protein Synthesis Notes 1/11/2017 Summing Up Transcription: Understanding the Genetic Code DNA code is almost universal amongst all organisms (evolutionary heritage) • Each CODON of mRNA is 3 nucleotides (EX: CCG, AUG) • Each 3 nucleotides “spells out” a specific amino acid • 64 different codon combinations possible • Only 20 amino acids exist in the human body • Some codons code for the same amino acids (degenerate or redundancy) mRNA sequence = amino acid sequence of protein • (ex: Protein: AUG-CCG is NOT the same as CCG-AUG!) Skiles, AP BIO 7 Protein Synthesis Notes 1/11/2017 CODON CHART • You don’t need to memorize the codons*, we have a chart for that Start codon AUG methionine Stop codons UGA, UAA, UAG *except for start and stop- know those ones.. mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Skiles, AP BIO MetArgValAsnAlaCysAla 8 Protein Synthesis Notes 1/11/2017 TRANSLATION: Reading the code from mRNA to build an amino acid sequence (protein) Translation Needs RIBOSOMES • Made of rRNA and proteins • Function: Facilitates bonding of correct tRNA anticodon to mRNA codon to build the protein Skiles, AP BIO E P A 9 Protein Synthesis Notes 1/11/2017 Translation: Transfer RNA • Contains anticodon • tRNA anticodons bind to mRNA codons • Some tRNA may bind with more than one codon (Supports redundancy) • “Wobble” hypothesis is that anticodon with U in third position can bind to A or G Translation purpose: mRNA to Protein • Location: cytoplasm 1. Initiation - start codon found (AUG) 2. Elongation – amino acids are joined 3. Termination – a STOP codon is reached Skiles, AP BIO 10 Protein Synthesis Notes 1/11/2017 RNA polymerase DNA Can you tell the story? amino acids exon pre-mRNA intron tRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit polypeptide 5' small ribosomal subunit 3' tRNA E P A ribosome Protein Synthesis in Prokaryotes • Transcription & translation are simultaneous in bacteria • no mRNA editing • ribosomes read mRNA as it is being transcribed Skiles, AP BIO 11 Protein Synthesis Notes 1/11/2017 Prokaryote vs. Eukaryote Protein Synthesis Differences • Prokaryotes • DNA in cytoplasm • circular chromosome • naked DNA • no introns • No splicing • Promoter & terminator sequence • Smaller ribosomes Skiles, AP BIO • Eukaryotes • DNA in nucleus • linear chromosomes • DNA wound on histone proteins • introns and exons • “TATA” box promoter • Transcription factors present 12