* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Cloning a Gene for Over-expression and Purification
Genetic code wikipedia , lookup
DNA vaccination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Metagenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene expression profiling wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene nomenclature wikipedia , lookup
Gene therapy wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Genome evolution wikipedia , lookup
Gene desert wikipedia , lookup
Primary transcript wikipedia , lookup
Gene expression programming wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Epigenomics wikipedia , lookup
SNP genotyping wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Microsatellite wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Microevolution wikipedia , lookup
Genome editing wikipedia , lookup
Designer baby wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Cloning a gene Cloning a Gene for Over-expression and Purification Motivation: produce a bioremediation enzyme to metabolize herbicide residues in soil. Nitroreductase is able to metabolize herbicides such as 2,4dinitrophenol. However this enzyme denatures readily: is it too delicate for field work. NADH-oxidase (NADOX) is a homologous enzyme from Thermus thermophilus that has a very high melting temperature and at 25° C displays increased catalytic activity in the presence of denaturants and high salt concentrations. We want to over-express NADOX and test if for possible use as a bioremediation tool. Strategy: clone the gene into an overexpression plasmid. A.-F. Miller © 2013 Page 1 Simplest example Cloning vectors contain an origin of replication, a selectable marker, cloning sites. Splicing a gene of interest into a plasmid provides for its propagation by host cells and permits its ready repurification (retrieval). A.-F. Miller, 2013, pg 3 G&G Fig. 12.1 A clone is a (population of) genetically identical organisms. In order for the gene to be carried over multiple generations, it needs to be replicated at least as often as the cell in which it is carried. For convenience, we clone bacterial genes into plasmids. Plasmid, small extrachromosomal circle of DNA. (4.3 kB vs. 4.6 MB) Includes origin of replication. Often carries a set of genes needed for metabolism of occasional nutrient sources, or antibiotics. A.-F. Miller, 2013, pg Cloning operations do not depend on the content of the gene. Restriction enzymes vector, insert. sticky ends / blunt ends Phosphatase, ligase Directional cloning behind a promotor, transformation of ‘competent’ cells, selection. A.-F. Miller, 2013, pg 4 G&G Fig. 12.3, 5 Making lots of the insert: use PCR PCR amplification PCR: Polymerase chain reaction is used to make many copies of DNA lying between the primers used. Primers are necessary in order for DNA polymerase to copy template DNA. Template Polymerase 5’ to 3’ A.-F. Miller, 2013, pg Primer Supply template, primers (two) NTP, DNA polymerase that tolerates repeated heating (to separate DNA strands) and cooling (to permit primers to anneal onto template). A.-F. Miller, 2013, pg 5 6 PCR see also Fig 12.21 PCR, the video + + + + melt 95°C cool 70°C + linkers bind +NTP polymerase primers at x1000 + + + + + + + + + + + + + A.-F. Miller, 2013, pg 7 + + + + + + + + A.-F. Miller, 2013, pg 8 Also http://www.youtube.com/watch?v=x5yPkxCLads DNA Replication Restriction endonucleases ! ! ! ! ! ! Restriction enzymes are enzymes that cut DNA at specific sequences within double stranded DNA. Different enzymes cut DNA at different sequences. Target sequences are usually palindromic (read the same in both directions). These enzymes can be used to confirm the presence of sequences by virtue of their action of cutting DNA only when the sequence occurs. These enzymes often cut the two DNA strands in staggered locations, and so are also used to produce complementary overhangs “sticky ends”. Sticky ends allow different digestion products to be assembled together to produce recombinant DNA molecules from two pieces that have been produced by the same restriction enzymes. We will be using Nde I (CATATG) and Hind III (AAGCTT) TATGGCTTGGAAT3’ ACCGAACCTTA5’ Nde I 5‘CGTACCGATCA 3‘GCATGGCTAGTAT 5‘CGTACCGATCATATGTACCGGAT3’ 5‘CGTACCGATCATATGGCTTGGAAT3’ + 3‘GCATGGCTAGTATACTGGAATA5’ 3‘GCATGGCTAGTAT ACCGAACCTTA5’ TATGTACCGGAT3’ ACATGGAATA5’ A.-F. Miller, 2013, pg 9 http://www.wehi.edu.au/education/wehitv/ A.-F. Miller, 2013, pg Over-expression vectors pET plasmid provides a strong promotor and other ‘designer’ features in the service of expressing a gene of interest. 10 Our Choice: Vector: pET15TEV_NESG EcoRI (5740) AatII (5669)* gene of interest AmpR PstI (4992)* Provides N-terminal His tag, TEV cleavage site ribosome binding site, (but no lac repressor). A.-F. Miller © 2013 Page 11 We choose to use a DNA polymerase that has no other duties in the cell, and that we can up-regulate at will (induce) upon addition of IPTG to the medium. (Look up IPTG) rbs SphI (725)* BsaI (4808)* pBR322 origin Insert gene here NheI (32)* EcoRV (192) T7 term T7 reverse XhoI (328)* AccI (344) SacI (354)* BamHI (359)* EcoRI (368) NdeI (377)* TEV His NcoI (423)* XbaI (462)* T7 T7 forward BglII (528)* pET15TEV_NESG 5741 bp ApaI (1461)* BssHII (1661)* EcoRV (1700) BsmBI (1865) AccI (3624) BsmBI (3495) Init Sal I XhoI Nco I| Nde I EcoR I BamH I Sac I" HinD III | | TEV Protease | | | | | | | CCATGGGCCATCACCATCACCATCACgaaaacctgtattttcagagcCATATGGCGAATTCTGCGGATCCTGCGAGCTCTGTCGACGCAAAGCTTCTCGAG GGTACCCGGTAGTGGTAGTGGTAGTGcttttggacataaaagtctcgGTATACCGCTTAAGACGCCTAGGACGCTCGAGACAGCTGCGTTTCGAAGAGCTC ______6XHis tag____ A.-F. Miller © 2013 Page 12 ( signals carried within a cloned insert. It therefore lacks translation the ribosome PflM I(572) binding site and gin start codon present on the pET translation vectors. A C-terminalApaB His•Tag I(674) sequence is availori ATG able. Unique sites are shown on the circle map. Note that the sequence is numbered by the pBR322 f1 convention, so the T7 expression region is reversed on the circular map. The cloning/expression 3153 3914-4771 4903-5358 ® Sca I(4464) Pvu I(4354) Sty I(57) Bpu1102 I(80) Pst pET-21(+) I(4229)sequence landmarks Vector: pET21 237-253 236 158-203 140-157 26-72 640-1719 3153 3914-4771 4903-5358 pET-21(+) Dra III(5127) Sca I(4464) Pvu I(4354) AlwN I(3507) or Bsa I(4045) i (3Eam1105 I(3984)– 15 3) (5369bp) Mlu I(990) Bcl I(1004) BstE II(1171) Bmg I(1199) Apa I(1201) BssH II(1401) EcoR V(1440) Hpa I(1496) Psp5 II(2097) Bpu10 I(2197) or ) Psp5 II(2097) Bpu10 I(2197) BspE I(2617) gene ATG TAA T7 promoter primer #69348-3 T7 promoter primer #69348-3 T7 promoter lac operator lac operator BamH I EcoR I Sac I BamH I EcoR I Sac I Eag I III 1102 Not I Sal I Hind Bpu I Bpu1102 I Sty I Sal I Hind III Ava I* Xho Sty I I Eag I Not I Ava I* Xho I His•Tag His•Tag T7 terminator T7 terminator T7 terminator primer #69337-3 T7 terminator primer #69337-3 pET-21(+) cloning/expression region Novagen • ORDERING 800-526-7319 • A.-F. Miller © 2013 Page 13 TECHNICAL SUPPORT TECHNICAL SUPPORT Init Sal I XhoI Nco I| Nde I EcoR I BamH I Sac I" HinD III | | TEV Protease | | | | | | | CCATGGGCCATCACCATCACCATCACgaaaacctgtattttcagagcCATATGGCGAATTCTGCGGATCCTGCGAGCTCTGTCGACGCAAAGCTTCTCGAG mcs of pET15TEV Before proposing to use Nde I, Eco RI, Hind III or Xho I, confirm that these do not cut within the gene. Search for CATATG, GAATTC, AAGCTT, CTCGAG NADOX gene Gene sequence TTHA0425 NCBI Reference Sequence: NC_006461.1 >gi|55979969:402495-403112 Thermus thermophilus HB8 chromosome, ATGGAAGCGACCCTTCCCGTTTTGGACGCGAAGACGGCGGCCCTAAAGAGGCGTTCCATCCGGCGTTACC GGAAGGACCCCGTACCCGAGGGGCTTCTCCGGGAAATCCTCGAGGCCGCCCTCCGGGCGCCCTCGGCCTG GAACCTCCAGCCCTGGCGGATCGTGGTGGTGCGGGACCCCGCCACCAAACGGGCCCTGAGGGAGGCGGCC TTCGGCCAGGCCCACGTGGAGGAGGCCCCCGTGGTCCTGGTCCTCTACGCCGACCTCGAGGACGCTCTCG CCCACCTGGACGAGGTCATCCACCCCGGGGTCCAGGGGGAAAGGCGTGAGGCGCAGAAGCAGGCCATCCA ACGGGCCTTCGCCGCCATGGGGCAAGAGGCGCGAAAGGCCTGGGCCTCCGGGCAGAGCTACATCCTCTTG GGCTACCTCCTTCTCCTCCTGGAGGCTTATGGCCTCGGAAGCGTCCCCATGCTGGGGTTTGACCCCGAGA GGGTGAGGGCGATCCTGGGGCTTCCTTCCCACGCCGCCATCCCCGCCCTGGTGGCCTTGGGCTACCCGGC GGAGGAGGGCTACCCCTCCCACCGCCTGCCCCTGGAGCGGGTGGTCCTCTGGCGCTAA Cannot use Xho I 800-207-0144 A.-F. Miller © 2013 Page 14 pET-21(+) cloning/expression region Novagen • ORDERING 800-526-7319 • Eenie Meenie Minie Moe, which nuclease should we use ? PshA I(1835) i (3 1 BspE 53 I(2617) BspLU11 I(3091) Sap I(2975) Bst1107 I(2862) Tth111 I(2836) rbs BssH II(1401) EcoR V(1440) Hpa I(1496) PshA I(1835) pET-21(+) BspLU11 I(3091) Sap I(2975) AlwN I(3507) Bst1107 I(2862) Tth111 I(2836) T7 promoter 3-5358) (490 gin ori 0-1719) I (64 lac Provides lac operator repress expression of toxic gene, C-terminal His tag. Pst I(4229) BstE II(1171) Bmg I(1199) Apa I(1201) Bgl II(268) SgrA I(309) Sph I(465) EcoN I(525) PflM I(572) ApaB I(674) (5369bp) f1 Ava I(158) Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) Ap (39 1447 71 ) T7 promoter T7 transcription start Multiple cloning sites mH I - Xho I) Bsa(BIa(4045) His•Tag® coding sequence T7 terminator Eam1105 I(3984) – lacI coding sequence pBR322 origin bla coding sequence f1 origin Bcl I(1004) 0-1719) I (64 lac Second Choice: region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed Mlu I(990) using the T7 terminator primer (Cat. No. 69337-3). Ap (39 1447 71 ) pBR322 origin bla coding sequence f1 origin Blue coloured codons are corrections I made based on literature disagreements and the crystal structure. 800-207-0144 Vector: pET15TEV_NESG Design feature for the insert (our gene) Sites we will use Init Sal I XhoI Nco I| Nde I EcoR I BamH I Sac I" HinD III | | TEV Protease | | | | | | | CCATGGGCCATCACCATCACCATCACgaaaacctgtattttcagagcCATATGGCGAATTCTGCGGATCCTGCGAGCTCTGTCGACGCAAAGCTTCTCGAG GGTACCCGGTAGTGGTAGTGGTAGTGcttttggacataaaagtctcgGTATACCGCTTAAGACGCCTAGGACGCTCGAGACAGCTGCGTTTCGAAGAGCTC ______6XHis tag____ Add a linker between protease cleavage and our protein. ATGGGCCATCACCATCACCATCACgaaaacctgtattttcagagcCATATGGCGAATTCTGCGGATCCTGCGAGCTCTGTCGACGCAAAGCTTCTCG http://web.expasy.org/translate/ What codons to use for Gly and Ser ? GS 5'3' Frame 1 Met G H H H H H H E N L Y F Q S H Met A N S A D P A S S V D A K L L Therefore we will need the following flanking sequences on our primers ‘5-CATATG➝ ←TTCGAA-5’ Both of these endonucleases need some bases on either side in order to cut efficiently, so we will add a few more bases. Intelligent choice of codons Insert a mini-linker of flexible soluble amino acids. Gly-SerTherefore add codons for Gly and Ser to gene. 5’-TTTTTTCATATG➝ ←TTCGAATTTTTT-5’ A.-F. Miller © 2013 Page 15 http://muta-tion.blogspot.com/2011/07/genetic.html A.-F. Miller © 2013 Page 16 For Gly, use GGC Hershberg R, Petrov DA (2009) General Rules for Optimal Codon Choice. PLoS Genet 5(7): e1000556. doi:10.1371/journal.pgen.1000556 For Ser, AGC , also Welch et al (2009) Welch M, Govindarajan S, Ness JE, Villalobos A, Gurney A, et al. (2009) Design Parameters to Control Synthetic Gene Expression in Escherichia coli. PLoS ONE 4(9): e7002. doi:10.1371/journal.pone.0007002 Note that just choosing the most common codon does not guarantee higher expression. Arg Leu Ser Ile A.-F. Miller © 2013 Page 17 A.-F. Miller © 2013 Page 18 Modified early sequence of our gene. 5’-TTTTTTCATATGGGCAGC➝ extension, restriction site, codons for linker The authentic gene (early bases, corrections in blue, start in green) ATGGAAGCGACCCTTCCCGTTTTGGACGCGAAGACGGCGGCCCTAAAGAGGCG Meld together to get: (only first 30 bases to be replicated are shown) 5’-TTTTTTCATATGGGCAGCGAAGCGACCC TTCCCGTTTT GGACGCGAAG➝ How far into the gene does the primer need to extend ? Long enough that it binds selectively (short sequences can recur elsewhere in the genome simply at random), short enough that the search for complementary sequence does not happen too slowly (fast binding and release from wrong sites) A.-F. Miller © 2013 Page 19 . Hence the following “Rules of thumb” for primer design 5’ end of the gene Restriction site permits splicing into vector. (we have the Nde I site) ATG encodes start of translation. ( √) follows a ribosome binding site and a transcription initiation site. (plasmid provides these). Extend the primer by 2-10 bases upstream of restriction site (√). Overlap with the desired gene for enough bases to give Tm ≈ 60 °C (72° preferred by some). We will deal with these next. GC content between 40-60 %. Length of 18-30 bases for specificity. NOT last three bases = G or C, not last base = T. Tm = 2°C * (A + T) + 4°C * (C + G) http://www.basic.northwestern.edu/biotools/oligocalc.html SeeMiller http://www.embl.de/pepcore/pepcore_services/cloning/pcr_strategy/primer_design/ A.-F. © 2013 Page 20 Use tools on web sites to determine the GC content and melting temperatures (Tm) of duplexes predicted from different lengths of oligos. Considering first round only when only black bases pair. Might RNA structure mask the start site ? 5’ end of the gene 5’-TTTTTTCATATGGGCAGCGAAGCGACCC TTCCCGTTTT GGACGCGAAG➝ 5’-TTTTTTCATATGGGCAGCGAAGCGACCC TTCCCGTTTT G➝ Range of Tm values account for range of Na+ concentrations that may be present (stabilizing duplex). √ Predicted stability of -6.2 kcal/mol (would like to have < 10). Considering later rounds when daughter molecules from early rounds are serving as templates. http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi 5’-TTTTTTCATATGGGCAGCGAAGCGACCC TTCCCGTTTT GGACGCGAAG➝ 49 % GC, Tm = 68 - 78 °C 39 bases 50 % GC, Tm = 67 - 74 °C 32 nucleotides 50 % GC, Tm = 69 - 79 °C 40 nucleotides A.-F. Miller © 2013 Page 21 Only 21 b in rounds 1,2, 57 % GC, Tm = 56 - 63 °C But only 14 b long in round 1, 2, 64% GC, Tm 43-47 °C 22 bases long in round 1, 2, 59% GC, Tm 59-67 °C. 3’ end of the gene Restriction site permits splicing into vector. TAA stop codon (TAG and TGA are more prone to read-through). Extend the primer by 2-10 bases upstream of restriction site. Overlap with the desired gene for enough bases to give Tm ≈ 60 °C (72° preferred by some). GC content between 40-60 %. Length of 18-30 bases for specificity. NOT last three bases = G or C, not last base = T. Check that the two primers do not pair with one another. Mutate to a better stop codon. Add Hind III site and CAC CGC CTG CCC CTG GAG CGG GTG GTC CTC TGG CGC TAA AAGCTT AAAAAA 3’ extension. CAC CGC CTG CCC CTG GAG CGG GTG GTC CTC TGG CGC TAG 5’ 3’ The primer is the complement strand 3’ AC GGG GAC CTC GCC CAC CAG GAG ACC GCG ATT TTCGAA TTTTTT The primer (written right way ‘round, with site of Hind III cut) 5’ 5’ TTTTTT AAGCTT TTA GCG CCA GAG GAC CAC CCG CTC CAG GGG CA 3’ A.-F. Miller © 2013 Page 23 A.-F. Miller © 2013 Page 22 Reverse primer, Rules of thumb 3’ end of the gene Reverse primer, Rules of thumb 5’ Vector Init Sal I XhoI Nco I| Nde I EcoR I BamH I Sac I" HinD III | | TEV Protease | | | | | | | CCATGGGCCATCACCATCACCATCACgaaaacctgtattttcagagcCATATGGGCAGCGCGAATTCTGCGGATCCTGCGAGCTCTGTCGACGCAAAGCTTCTCGAG Restriction site permits splicing into vector. (√) TAA stop codon (TAG and TGA are more prone to read-through). (√) Extend the primer by 2-10 bases upstream of restriction site. (√) Overlap with the desired gene for enough bases to give Tm ≈ 60 °C (72° preferred by some). GC content between 40-60 %. Length of 18-30 bases for specificity. NOT last three bases = G or C, not last base = T. Check that the two primers do not pair with one another. The primer (bases that pair in the first round are in bold, all pair in rounds >2) 5’ TTTTTT AAGCTT TTA GCG CCA GAG GAC CAC CCG CTC CAG G 3’ 50 % GC Tm 67-77 °C 36 bases long (23 bases in rounds 1,2, 70 % GC and Tm 64-72 °C) 45 % GC Tm 62-71 °C 31 bases long (18 bases in rounds 1,2, 67 % GC and Tm 55-61 °C) Use green primer and a few extra cycles A.-F. Miller © 2013 Page 24 ( gin ori f1 3153 3914-4771 4903-5358 Sca I(4464) Pvu I(4354) NEXT: pET21 I(572) ATG start codon present on the pET translation vectors.PflM A C-terminal His•Tag® sequence is availApaB isI(674) able. Unique sites are shown on the circle map. Note that the sequence numbered by the pBR322 convention, so the T7 expression region is reversed on the circular map. The cloning/expression region of the coding strand transcribed by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper phage will produce virions containing single-stranded DNA that corresponds to the coding strand. Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat. No. 69337-3). Sty I(57) Bpu1102 I(80) pET-21(+) sequence landmarks Forward Forward primer T7 transcription start Multiple cloning sites (BamH I - Xho I) His•Tag® coding sequence Bsa I(4045) T7 terminator Eam1105 I(3984)la–cI coding sequence pBR322 origin bla coding sequence f1 origin 237-253 236 158-203 140-157 26-72 640-1719 3153 3914-4771 4903-5358 Dra III(5127) f1 Sca I(4464) 49 % GC, Tm = 68 - 78 °C 39 bases Only 21 b in rounds 1,2, 57 % GC, Tm = 56 - 63 °C Pvu I(4354) Pst I(4229) provide Eco RI, rbs and atg. (NdeI underlined) Bsa I(4045) AlwN I(3507) 5’ TTTTTT AAGCTT TTA GCG CCA GAG GAC CAC C➝ 3’ 45 % GC Tm 62-71 °C 31 bases long (18 bases in rounds 1,2, 67 % GC and Tm 55-61 °C) Temperatures match well. 3-5358) (490 gin ori (5369bp) – BssH II(1401) EcoR V(1440) Hpa I(1496) PshA I(1835) Reverse primer: as for pET15TEV Psp5 II(2097) Bpu10 I(2197) Sap I(2975) Bst1107 I(2862) Tth111 I(2836) BspE I(2617) gene ATG BstE II(1171) Bmg I(1199) Apa I(1201) Psp5 II(2097) Bpu10 I(2197) BspLU11 I(3091) AlwN I(3507) or i (3 Sap I(2975) 15 3) BspE I(2617) Bst1107 I(2862) Tth111 I(2836) BspLU11 I(3091) rbs Mlu I(990) Bcl I(1004) PshA I(1835) pET-21(+) or Eam1105 I(3984) i 3 GAATTCGAAGGAGATATACAT ATG GAA GCG ACC CTT CCC GTT (TTG 15 GAC G... 3) Check to be sure that your two primers will not bind strongly to one-another. http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ BssH II EcoR V Hpa I(1496) 0-1719) I (64 lac 5’-TTTTTTCATATGGGCAGCGAAGCGACCC TTCCCGTTTT G➝ Reverse Bgl II(268) SgrA I(309) Sph I(465) EcoN I(525) (1401) PflM I(572) ApaB I(674) (1440) pET-21(+) (5369bp) BstE II(1171) Bmg I(1199) Apa I(1201) Ap (39 1447 71 ) Primers for use with pET15TEV_NESG Pst I(4229) T7 promoter Mlu I(990) Bcl I(1004) Ava I(158) Xho I(158) Eag I(166) Not I(166) Hind III(173) Sal I(179) Sac I(190) EcoR I(192) BamH I(198) 0-1719) I (64 lac Ap (39 1447 71 ) pBR322 origin bla coding sequence f1 origin TAA T7 promoter primer #69348-3 Consequences for expression: At N-terminus, after TEV cleavage, we will add H M G S to the ‘front’ of the protein. At the C-terminus there will be no changes relative to the native protein. A.-F. Miller © 2013 Page 25 T7 promoter T7 promoter primer #69348-3 T7 promoter lac operator BamH I EcoR I Sac I (rules of thumb) Restriction site permits splicing into vector. (we have the Eco RI site) ATG encodes start of translation. ( √) Follows a ribosome binding site and a transcription initiation site. (√). Extend the primer by 2-10 bases upstream of restriction site. Overlap with the desired gene for enough bases to give Tm ≈ 60 °C (72° preferred by some). GC content between 40-60 %. Length of 18-30 bases for specificity. NOT last three bases = G or C, not last base = T. provide Eco RI, rbs and atg. (NdeI underlined) 5’-TTTTGAATTCGAAGGAGATATACAT ATG GAA GCG ACC CTT CCC GTT T... 42 bases 40% GC 66-76 °C Tm in later rounds; 17 bases 59% GC 50-55 °C Tm in rounds 1,2 41 bases 39% GC 65-75 °C Tm in later rounds; 16 bases 56% GC 46-51 °C Tm in rounds 1,2 45 bases 42% GC 67-78 °C Tm in later rounds; 20 bases 60% GC 56-63 °C Tm in rounds 1,2 Use blue primer A.-F. Miller © 2013 Page 27 BamH I EcoR I Sac I Sal I Hind III Bpu1102 I Sty I Eag I Bpu1102 I Not I Sal I Hind III Ava I* Xho I Sty I Eag I Not I Ava I* Xho I His•Tag T7 terminator His•Tag T7 terminator primer #69337-3 T7 terminator pET-21(+) cloning/expression region T7 terminator primer #69337-3 Novagen • ORDERING 800-526-7319 • A.-F. Miller © 2013 Page 26 TECHNICAL SUPPORT 800-207-0144 pET-21(+) cloning/expression region Novagen • ORDERING 800-526-7319 • Forward primer: lac operator TECHNICAL SUPPORT 800-207-0144 Primers for use with pET21 Forward 5’ TTTTGAATTCGAAGGAGATATACAT ATG GAA GCG ACC CTT CCC GT➝ 45 bases 42% GC 67-78 °C Tm in later rounds; 20 bases 60% GC 56-63 °C Tm in rounds 1,2 Reverse 5’ TTTTTT AAGCTT TTA GCG CCA GAG GAC CAC C ➝3’ 31 bases 45 % GC Tm 62-71 °C (18 bases in rounds 1,2, 67 % GC and Tm 55-61 °C) Temperatures match alright. Check to be sure that your two primers will not bind strongly to one-another. http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ Consequences for expression: At N-terminus, The native protein will be intact (no changes). At the C-terminus there will be no changes relative to the native protein. A.-F. Miller © 2013 Page 28