Download Designing synthetic MLPA probes - MRC

MRC-Holland b.v.
Version 15
Last update 09-09-2015
Page 1 of 21
Designing synthetic MLPA probes
Table of Contents
1.
Introduction ............................................................................................................................................ 2
2.
MLPA PROBES Terminology ................................................................................................................ 3
3.
3.1.
3.2.
MLPA PROBES Method ......................................................................................................................... 4
MLPA method .......................................................................................................................................... 4
Methylation-Specific MLPA method ......................................................................................................... 5
4.1.
4.2.
4.3.
MLPA PROBES DNA sequence ............................................................................................................ 5
Getting the DNA sequence of choice ...................................................................................................... 5
Formatting the DNA Sequence ................................................................................................................ 7
Elongating a known human sequence in one or both directions ............................................................. 8
5.1.
5.2.
MLPA PROBES Basics probe design .................................................................................................. 9
General Probe Design Rules ................................................................................................................... 9
Probe design steps ................................................................................................................................ 10
6.1.
6.2.
6.3.
6.4.
6.5.
6.6.
MLPA PROBES Important design concerns ..................................................................................... 10
Minimum number of MLPA probes per reaction .................................................................................... 10
The effect of the Tm value ..................................................................................................................... 10
The effect of the first nucleotide............................................................................................................. 11
The effect of mismatches (including SNPs and mutations) on probe signal ......................................... 11
Selecting reference probes (only if it is NOT possible to use the P200 or P300 reference probemixes)12
Optional signal-reducing competitor oligo ............................................................................................. 13
4.
5.
6.
7.
MLPA PROBES Designing Methylation-Specific MLPA probes ..................................................... 13
8.
MLPA PROBES Probe design example ............................................................................................. 13
9.
ORDERING synthetic probes.............................................................................................................. 14
10.
10.1.
10.2.
10.3.
10.4.
10.5.
ORDERING MLPA reagents ................................................................................................................ 14
Situation 1: adding probes to P200/P300 reference probemix .............................................................. 14
Situation 2: adding probes to an existing SALSA MLPA probemix ....................................................... 16
Situation 3: making an all-synthetic probemix ....................................................................................... 16
EK MLPA reagent kits (for standard MLPA and MS-MLPA) ................................................................. 17
Quality Control Fragments ..................................................................................................................... 17
11.1.
11.2.
11.3.
11.4.
PREPARING the synthetic probemix ................................................................................................. 17
General guidelines ................................................................................................................................. 17
Making the synthetic basic probemix (step a-c) .................................................................................... 17
Making the final probemix (step d)......................................................................................................... 18
Making a competitor oligo mix ............................................................................................................... 19
11.
12.
Troubleshooting................................................................................................................................... 19
13.
References ............................................................................................................................................ 20
14.
Useful websites, tools and software .................................................................................................. 20
MRC-Holland b.v.
Version 15
Last update 09-09-2015
Page 2 of 21
Designing synthetic MLPA probes
1. Introduction
Designing synthetic probes is a common practice performed by many of our customers who want to have an MLPA
probemix targeted to genes not covered by any probemix available from MRC-Holland. To facilitate this, we have a
protocol available that describes the design of synthetic probes in detail. When designing probes for human genes,
we recommend adding your synthetic probes with our P200 or P300 Human DNA Reference probemixes. These
probemixes contain high-quality reference probes and MLPA control fragments, while leaving sufficient space for
the addition of synthetic probes. More information can be found in 10.1 Situation 1: adding probes to P200/P300
reference probemix.
Around 11 probes can be included in a synthetic probemix, see 5 MLPA PROBES Basics probe design. Each
MLPA reaction should be done with at least 5 MLPA probes; using fewer probes makes the reaction unreliable.
Synthetic probes differ from MRC-Holland probes in that our probes consist of one synthetic oligonucleotide and
one clone-derived one. This allows us to make longer probes and to include up to 50 different probes in one MLPA
reaction.
Advantages of own synthetic probes vs. MRC-Holland probes:
• Own design.
• Quickly available.
Disadvantages of own synthetic probes vs. MRC-Holland probes:
• Restrictions on maximum probe length and therefore fewer probes per MLPA reaction.
• Quality of probes depends on own design and oligo supplier.
• Without previous design experience, designing MLPA probes can be difficult. Although this protocol tries to
describe MLPA probe design rules as comprehensively and clearly as possible, it is impossible to convey
all our in-house probe design experience.
• At MRC-Holland, probes are elaborately tested for various characteristics, including peak height,
reproducibility across samples, sensitivity to differences in salt concentration and polymerase activity. This
requires special expertise.
There are three kinds of MLPA probes:
• DNA probes
: detection/quantification of genomic DNA sequences.
• Methylation probes
: detection/quantification of both copy number and methylation of genomic DNA.
• RNA probes
: detection/quantification of mRNA-derived cDNA. The design of synthetic RNA
probes is described in a different protocol, available on request: [email protected].
Feedback about this protocol? Please email [email protected].
This protocol offers detailed guidelines for synthetic probe design. Unfortunately, MRC-Holland cannot offer any
additional support on synthetic probe design. If you do not have any experience with MLPA, you are strongly
advised to first get familiar with the MLPA method by reading the MLPA technology section on our website.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 3 of 21
Designing synthetic MLPA probes
2. MLPA PROBES Terminology
Figure 1 - Terminology of probe components. One MLPA probe consists of two oligonucleotides: the Left Probe
Oligonucleotide (LPO) and the Right Probe Oligonucleotide (RPO). Both LPO and RPO may contain an optional
stuffer sequence in between the hybridising sequence and the primer binding site, although this is not
recommended for synthetic probes.
LPO: 5’ end: binding sequence of Forward PCR primer (GGGTTCCCTAAGGGTTGGA); 3’ end: Left Hybridising
Sequence (LHS).
RPO: 5’end: Right Hybridising Sequence (RHS); 3’ end: binding sequence of Reverse PCR Primer
(TCTAGATTGGATCTTGCTGGCAC). The primer binding sequences are used for the amplification of the probe
during the PCR reaction; labelled primers are supplied by MRC-Holland.
Term/abbreviation
BLAST
BLAT
Map Viewer
Coding Sequence CDS
Forward Probe
HUGO name
LHS & RHS - Left &
Right Hybridising
Sequence
Left Probe Oligo LPO
Ligation site
melting temperature
- Tm
Explanation
Basic Local Alignment Search Tool from NCBI, to compare DNA sequences with
sequences deposited in the Genbank database. Often used at MRC-Holland are the
Genome BLAST (sequence vs. “standard” human genome) and the NR (Non-Redundant)
BLAST: sequence vs. collection of selected DNA/mRNA sequences.
BLAST-like alignment tool. Developed by the University of California Santa Cruz. Excellent
tool to find sequence similarities, flanking sequences, SNPs, CpG islands, copy number
viariation in healthy individuals and many more features of a sequence.
NCBI website that offers a graphical overview of the human and other genomes:
http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9606
Sequence between start and stop codon. In Map Viewer, numbers mentioned under CDS
refer to numbering of the Genbank entry of NM sequence.
Most of our probes are located in coding regions of genes. We use the term Forward
Probe when the hybridising part of the probe is identical to the mRNA sequence. These
Forward Probes thus bind to the complement of the coding strand. Reverse Probes detect
the opposite strand.
Each gene has been assigned an official HUGO name by the committee of the Human
Genome Organization. For instance, the HUGO name of the p53 gene is TP53. More
information on http://www.genenames.org
Hybridising parts of LPO and RPO. Bind to adjacent target DNA sequences.
Probe oligonucleotide that is situated on the left when probe is shown from 5’ to 3’.
Consists of forward PCR primer sequence (5’ end) and hybridising sequence (3’ end).
3’ nucleotide of LPO and 5’ nucleotide of RPO, where ligation occurs.
Temperature at which 50% of a sequence’s copies are in stable double helix and 50% are
single stranded. Tm indicates the strength of the probe-target binding and is influenced by
the length and sequence (in particular the %GC) of the hybridising sequence, salt
concentration and the solvent used. RaW software is the tool used at MRC-Holland to
calculate the Tm, see http://www.mlpa.com - Support – Designing Synthetic probes.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 4 of 21
Designing synthetic MLPA probes
NM_ sequence
nt
MLPA probe
Primer
Right Probe Oligo RPO
SNP
Please note that many different algorithms exist to calculate the Tm, each resulting in a
different value.
Reference sequences of mRNAs. Each common transcript variant has a separate NM_
accession number. A good overview of the various transcript variants of a gene can be
obtained on the Entrez Gene website: http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene.
For exon numbering, which cannot be found in NM_sequences anymore, look for
corresponding NG_sequence here: http://www.ncbi.nlm.nih.gov/refseq/rsg/browse/. N.b.
NG_sequences also include intronic sequences.
Nucleotide.
The combination of LPO and RPO.
DNA oligonucleotide which, when annealed to a complementary DNA sequence, can be
used as starting point for extension by a polymerase enzyme during PCR. Note that in
MLPA, a primer is not the same as a probe! An MLPA probe recognises a designated
DNA target, while primers are used only for amplification of probes during PCR. A
universal primer pair is used for all MLPA probes, including synthetic ones; labelled PCR
primers of the correct sequence are supplied by MRC-Holland as part of an MLPA
reagents kit.
Probe oligonucleotide situated on the right when probes is shown from 5’ to 3’. Consists of
hybridising sequence (5’ end) and the reverse complement of the reverse PCR primer (3’
end). The 5’ end of the RPO has to be phosphorylated or ligation of LPO and RPO will fail.
Single Nucleotide Polymorphism.
3. MLPA PROBES Method
3.1.
MLPA method
Figure 2 - MLPA method
1. Denaturation and hybridisation
Hybridisation sequence (left)
Hybridisation sequence (right)
2. Ligation
3. PCR with universal primers X and Y
4. Fragment analysis
1. DNA sample is heated so that it
denatures, probemix is added. Each
probe consists of two parts: the LPO and
RPO, which hybridise to the adjacent
targets on the sample DNA.
2. LPOs and RPOs that are hybridised to
adjacent targets are ligated to form one
complete probe.
3. During the PCR reaction, only complete
probes are amplified exponentially.
4. The amplification products are separated
by capillary electrophoresis.
5. Using intra- and inter normalisation of the
signals by MLPA analysis software
(Coffalyser.Net) it is possible to compare
a patient with various reference samples,
which yields information on copy number
changes.
Note that a cloned RPO (as shown here) always
contains a stuffer sequence (green). In synthetic
probes, the use of a stuffer is not recommended.
Click on “MLPA Procedure” section on the MLPA website for more details about the MLPA method: www.mlpa.com
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 5 of 21
Designing synthetic MLPA probes
3.2.
Methylation-Specific MLPA method
Methylation-specific MLPA (MS-MLPA) probes are similar to the normal DNA probes, but contain a Hha1 restriction
site in their hybridising sequence. The Hha1 enzyme cuts DNA at GCGC unless the first C of the CGCG restriction
site of the target DNA is methylated. By adding the HhaI enzyme together with the ligase-65 enzyme, probes that
are hybridised to unmethylated restriction sites are cut and cannot be amplified. Each MS-MLPA reaction is divided
in two parts after the probe hybridisation reaction: one for the copy numbers (ligation only) and one for the
methylation status (ligation + digestion).
Methylated Target
Unmethylated Target
M
M
1.1.
Denaturation
Denaturationand
andHybridization
hybridisation
M
2. Ligation / Digestion
2.with
Ligation
/ Digestion endonuclease
methylation-sensitive
with methylation-sensitive endonuclease
M
PCRwith
withuniversal
universalprimers
primersXXand
andYY
3.3.
PCR
Exponential
amplification,
undigested
exponential
amplification
of ligated,
undigestedprobes
probesonly
only
X
Y
FragmentAnalysis
Analysis&&Sample
SampleComparison
Comparison
4.4.
Fragment
Figure 3 - Left: overview of the MS-MLPA method. Right: results of samples. After hybridisation, the reaction
is split into an undigested reaction, for detection of copy numbers, and a digested reaction, for detection of
methylation status. In the digested reaction, the HhaI restriction enzyme will cut probes that are hybridised to
unmethylated restriction sites, so that they cannot be amplified. A) Undigested reference sample, B) Digested
reference sample, C) Undigested patient sample, D) Digested patient sample. Aberrant methylation is visible by
comparison of pictures B and D. Taken from Nygren et al. (2005) Nucl. Acid Res. 33:e128.
4. MLPA PROBES DNA sequence
4.1.
Getting the DNA sequence of choice
To design a probe, the sequence of the target DNA of interest is needed. One of the many ways to find, see 4.1
Getting the DNA sequence of choice, and format, see 4.2 Formatting the DNA Sequence, the sequence of a
human gene is described below. If the target sequence is known, 4.3 Elongating a known human sequence in one
or both directions describes how to obtain the flanking genomic sequences. For other organisms, other databases
and tools may be better suited.
1. Determine the name of the gene of interest. Many genes have several aliases; to avoid confusion it is
recommended to check http://www.genenames.org/ to see what the HUGO-approved gene name is.
2. Find the Accession number of the mRNA reference sequences. A useful site for this is NCBI Entrez gene:
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene.
Alternatively,
on
the
Mapview
website:
http://www.ncbi.nlm.nih.gov/mapview/, do a search for the name of the gene. From the results, look for the
RefSeq transcripts.
- A list of Reference Sequences associated with the gene is shown, these are often splicing variants. Find the
NM_sequences and select the standard that is used in the RefSeqGene project (it might be necessary to
MRC-Holland b.v.
Version 15
Last update 09-09-2015
Page 6 of 21
Designing synthetic MLPA probes
check all NM_sequences), or choose the longest transcript. Keep in mind that the standard in the
RefSeqGene project or the longest transcript does not necessarily include all exons. If this is the case, look
for missing exons in alternative transcripts. Note down the NM_ accession nr of choice for later use.
Exon numbering: NG_sequences can be consulted to find the exact exon numbers:
http://www.ncbi.nlm.nih.gov/refseq/rsg/browse/, Keep in mind however that intronic sequences are
also included in the NG-sequences.
- If you follow the Mapview website, an overview is given of the genomic position of the gene relative to other
genes. Click again, the following page shows the reference mRNA sequence.
Figure 4 - Steps required to obtain the DNA sequence. Map Viewer (a, b), Gene Report (c), NCBI Reference
Sequence (d).
3.
Determine exon-intron boundaries. To determine exon-intron boundaries, the mRNA sequence is
compared with the complete genome. One way of doing this is to do a Genome BLAST on the NCBI
website (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606). Paste the
sequence of interest or the Genbank (NM_) accession nr and do a search using the default settings. On
the next screen, change the Alignment View to Query Anchored with dots for identities, and limit your
results to “Homo Sapiens” in the Organism field.
4.
Retrieve Genomic Sequence. Go to the Santa Cruz Website: http://genome.ucsc.edu/cgi-bin/hgGateway,
and do a search on the gene name. Select the RefSeq with the corresponding Accession number.
Alternatively, submit the sequence of interest in BLAT (http://genome.ucsc.edu/cgi-bin/hgBlat). On the
next page, an overview is given of the part of the genome where the gene of interest is located.
Determine the direction of the gene, (>>>> Forward; <<<< Reverse). Click View, DNA at the top of the
screen. Select the “All lower case” tick box (see Figure 5).
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 7 of 21
Designing synthetic MLPA probes
Figure 5 - Steps required to obtain the DNA sequence from the Santa Cruz website.
a.
If the gene is reverse as indicated on the previous screen, tick the Reverse Complement box. Click the
button extended Case/Color options, copy the settings from Figure 6 and click submit. (If some of the
tracks are unavailable, go two pages back and turn them on visible. Click refresh to apply the settings.)
Figure 6 - '' Extended Case/Color'' option in Santa Cruz.
b.
4.2.
1.
Copy the sequence obtained to MS Word. Note that large sequences may cause Word to crash. You
can prevent this by turning the spell check off beforehand and/or by using several files.
Formatting the DNA Sequence
Formatting the Word document. Firstly, all line breaks/enters are removed using the Find and replace tool in
Word.
a. Click Ctrl-H in Word to open it. Next, type “^p” in the Find what: field. Click Replace All .
b. The next step is making SNPs more recognisable; to make SNPs stand out, we will highlight them.
Click the button More >>; see Figure 7. Set the cursor on the blank Find what field, click Format, Font
choice, select font style Italic and click OK. This searches for everything in the document that is italic, which
are the SNPs. Now set the cursor on the blank Replace with: field. Click Format, Font choice and select
Highlight. The colour of the highlight can be changed using this button
. Click Replace All.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 8 of 21
Designing synthetic MLPA probes
Figure 7 - ''Replace'' function in Word.
c.
For Methylation probes, it is useful to also mark the restriction sites. When using Hha1, this is GCGC. Set
the cursor on the Find what: field and click No Formatting. Insert the sequence of the restriction site.
Change the colour of the highlight to a different colour, and click Replace All. The result should be similar
to that shown in Figure 8.
AGGGGTGGAGAGAAAAGAGGGGAGGGATGGGGGGAGGGGAAACAGGAGCGAGGTGTCTCCCTAGCTCGCTGCCTCTGGCAAGTGGAGT
TTTTAAAAAGCTCCAGCAGATCATGTCATGACGACTTCGCTGCTCCTGCATCCACGCTGGCCGGAGAGCCTTATGTACGTCTATGAGG
ACAGCGCGGCGGAGAGCGGCATCGGCGGCGGCGGCGGAGGAGGAGGCGGCGGCACGGGCGGAGCGGGGGGTGGCTGCAGCGGAGCGAG
CCCCGGCAAAGCCCCGAGCATGGATGGTCTGGGCAGCAGCTGCCCGGCCAGCCACTGCCGCGACCTGCTTCCGCACCCCGTGCTGGGC
CGCCCGCCGGCTCCCCTGGGCGCCCCTCAGGGCGCCGTCTATACGGACATCCCGGCCCCGGAGGCGGCGCGCCAGTGTGCCCCGCCGC
CCGCACCCCCCACCTCGTCCAGCGCCACCCTGGGCTACGGCTACCCCTTCGGGGGCAGCTACTACGGCTGCCGCCTGTCGCACAACGT
GAACCTGCAGCAGAAGCCTTGCGCCTACCACCCGGGCGATAAATACCCGGAGCCGTCGGGCGCCCTGCCCGGTGACGACCTGTCCTCT
AGGGCCAAGGAGTTCGCCTTCTACCCCAGCTTCGCCAGCTCCTACCAGGCGATGCCCGGCTACCTGGACGTGTCGGTGGTGCCCGGGA
TCAGCGGGCACCCGGAGCCGCGTCACGACGCCCTCATCCCCGTCGAAGGCTACCAGCACTGGGCTCTCTCCAATGGCTGGGACAGTCA
GGTGTACTGCTCCAAGGAGCAGTCGCAGTCCGCCCACCTCTGGAAGTCTCCCTTCCCAGgtaaggaagggacccgagcgccgccgccg
ccggggacccctccccgccctgcctgccccggggctccgcgccccaaccacccccgccgtctggccccggcgcgcccgctcggctggg
ctgcctatggagccggccgggcgagctgcactgaggaatgcgccggggaagaaatctgctccgacacgttctctgtagctgcccggcc
gagaatgaagcaatcacaggcgcccgaaagccgggccgccggctctgctctgtccggtagctcgcctccgcctccccttgcaggctcc
agcctcccgccgggctcttggcccctaaacctgcttccggcaagggatgggggcggggtgggcctatagtgccttggaatccaggaca
aaacccccaacccaccgaataactggggagggcggagaataagaacccccactttctttgacagaattcgcaggatcgttcaggcact
agacagtattttttaaataggggactaatttgctggggtctacagaaatgtgagatttatttttttcctttcctgacttattttaaaa
atctggccacgaatttcctgattgttgagggaacagaagatccaaaatctctggagagggagtggagaggaggctagaatccctcccc
agcattgtaaagttttccttgcctctttggtatattgagctcaaacctatagacatttccactgccaactcccccatatgtggtcgag
aaagagagttagttattggtgccccagacacagaaagaagggcgtggggatgagaaatgggagaggaagacctgttcaagacctgttc
Figure 8 - Formatted DNA sequence. Highlighted restriction sites and SNPs. Underlined and Uppercase: exon.
Lowercase: intron. Blue: CpG island. Highlighted in blue: Restriction site (for Methylation probes). Highlighted in
brown and italic: Single Nucleotide Polymorphism (avoid).
4.3.
Elongating a known human sequence in one or both directions
When only part of a human sequence is known (for instance the sequence detected by one of our probes), the
Santa Cruz website is a perfect tool to find the flanking genomic sequences.
Paste the sequence available in the BLAT Search genome site: http://genome.ucsc.edu/cgi-bin/hgBlat
Click submit.
Select the sequence with the best homology, usually the upper one. Remember whether the strand is
mentioned as “+“ or “-“. When mRNA sequences are inserted that contain exon boundaries, the SPAN will
be larger than the difference between Start and End; click browser.
In the next screen, click DNA at the top of the screen.
Fill in the required number of extra nucleotides upstream and downstream. Use multiples of 50 nt as each
line of the sequence obtained has 50 nt. When the strand was “-“, click Reverse complement. When
additional information is required such as the position of SNPs, click All lower case and extended
case/color option and proceed as depicted in Figure 6.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 9 of 21
Designing synthetic MLPA probes
5. MLPA PROBES Basics probe design
Please note that the word “probe” in this protocol refers to the combination of a given LPO AND RPO.
5.1.
General Probe Design Rules
Please also follow the additional guidelines in 6 MLPA PROBES Important design concerns. When designing
Methylation probes, please also follow the additional guidelines in 7 MLPA PROBES Designing MethylationSpecific MLPA probes.
•
LPO Hybridising Sequence (LHS) and RPO Hybridising Sequence (RHS) should be directly adjacent.
•
Preferably locate hybridising sequences in the coding parts of a gene, where more information on SNPs is
available.
•
There should be no overlap between the hybridising sequences of different probes.
•
Each probe should have a unique total probe length (LPO+RPO).
•
Total probe length mentioned in this protocol consists of: LHS + RHS + 42 nt for both PCR primer binding
sequences. Add the length of a stuffer if used (use only if necessary, see 6.2 The effect of the Tm value).
•
Divide the total probe length evenly over LPO and RPO to avoid an unnecessary long length of one oligo
(note: the longer the oligo, the lower the quality).
•
Minimum length of LHS or RHS
: 21 nucleotides
•
Minimum total length difference required between probes : 4 nt
•
Minimum and maximum total synthetic probe length
The best length for synthetic probes is between
: 100 and 140 nt.
The exact minimum and maximum probe length depend on what you will add your synthetic probes to.
Check the product description of the probemix you are going to add your probes to and make sure there
is at least 4 nt between your probe(s) and any existing probe or control fragment in the probemix.
The absolute maximum length for synthetic probes is 168 nt. Use stuffer sequences only if needed, see
6.2 The effect of the Tm value. In practice, such long probes will have a lower signal due to lower quality
of long synthetic oligonucleotides, and will often have shoulder peaks which complicate analysis. For
this reason we strongly recommend to avoid the use of probes with a total length of > 140 nt.
When using the P200 probemix, the minimum probe length is 88 nt to avoid overlap with the Q
fragments. This means that a total of 88-42 nt (primer binding sequences) = 46 nt is the minimum length
of BOTH hybridising sequences together. If the 46 nt is evenly divided between LHS and RHS, the
hybridising sequence of the LHS and RHS will be 23 nt each. To obtain a sufficiently high Tm, only
probes in GC rich sequences can be made with such short lengths.
•
Tm of each hybridising sequence (LHS, RHS separately) : ≥ 71°C (Absolute minimum is 68°C, see
•
•
Table 1)
•
∆G =secondary structure (LHS / RHS) preferably
: ≥ 0 (Preferred, drop this criterium if not feasible)
•
LPO primer binding sequence1
: GGGTTCCCTAAGGGTTGGA
•
RPO primer binding sequence1
: TCTAGATTGGATCTTGCTGGCAC
•
GC content
: ~ 50% (If possible)
•
LHS
: preferably a maximum of 2 G/C nt in the 5 nt at its 3’ end, directly adjacent to the ligation site
•
LHS/RHS : preferably a maximum of 3 G/C directly adjacent to the primer binding sequence
Table 1 – LHS/RHS length and Tm
length
23-25 (23 and 24 nt: use only in exceptional cases)
26-30
31-35
36-40
40-max. 55
1
Tm range
≥ 72.5 °C, preferably > 74.0 °C
≥ 71.0 °C, preferably > 72.5 °C
≥ 71.0 °C
≥ 70.0 °C
≥ 68.0 °C
The primer sequence contained in the LPO is identical to the sequence of the Forward PCR Primer and is used in
the second PCR cycle. The primer binding sequence incorporated in the RPO is complementary to the reverse
primer that is included in each MLPA kit. During the first amplification round in MLPA, the reverse primer binds to
this complementary sequence in the RPO and a complementary copy of the original probe is made.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 10 of 21
Designing synthetic MLPA probes
5.2.
Probe design steps
•
•
•
•
•
•
Find the region of interest, preferably in an exon. Try to find a region with the following features:
o GC% = ~50%. Specifically around the 5’ and 3’ of the LHS.
o No or limited homology with other human sequences. In case two closely related sequences have
to be distinguished, make certain that the last nucleotide of the LPO has a mismatch with the
related sequence (6.4 The effect of mismatches (including SNPs and mutations) on probe signal).
o No SNPs. See also 6.4 The effect of mismatches (including SNPs and mutations) on probe signal
o No overlap with another probe, as it will compete for the same target sequence.
Adjust the length of the LHS and the RHS so that:
2
o Tm is preferably >70 °C (absolute minimum 68 °C). Use RaW program .
o The LHS 5’ does not start with an Adenine (if no stuffer is used).
o Length of the LHS and the RHS is at least 23 nucleotides each.
Use the UNAfold website (see Mfold website) to test the ∆G of the LPO and RPO:
o Copy the primer binding sequence, (stuffer) and LHS in the correct order on the website.
o Set the [Na+] = 0.35 M.
o Set the Folding temperature = 60° C.
o Click the Fold DNA button and make sure ∆G ≥ 0 (if possible). Always take the first ∆G value
(Structure 1).
o You can click the ‘jpg’-link if you want to see the folding structure of the oligo. This can give you a
better idea of the chances of the oligo binding to itself, especially in the case of a negative ∆G.
o Repeat steps for the RPO (keep in mind that LPO and RPO have a different primer sequence).
Testing the specificity of the probe:
o Run the LHS and RHS together in the Human Genome BLAST website, see 14. Useful websites,
tools and software. Tick somewhat similar sequences in Program Selection.
o Look for any undesirably homologies and try to avoid these. If there is a homologous sequence
which overlaps with both the LHS and RHS, make sure that the overlap with either LHS or the RHS
has a Tm of <50°C (use RaW to calculate the overlap present - LHS and RHS separately). If the
overlap with both LHS and RHS has a Tm which is higher than 50°C and has >12 overlapping
nucleotides, both oligonucleotides may bind sufficiently strongly to be ligated and generate a
signal, which should be avoided.
Do the same in NR BLAST: if the link is unclear about the origin of the sequence, copy the name given
under LOCUS and look it up in Map Viewer and/or do a BLAT on the Santa Cruz site.
If a probe sequence is polymorphic or can be found in a different gene as well: see 6.4 The effect of
mismatches (including SNPs and mutations) on probe signal. Design a new probe if there are avoidable
polymorphisms.
6. MLPA PROBES Important design concerns
6.1.
Minimum number of MLPA probes per reaction
Any MLPA reaction should be done using a total of at least 5 unique probes in a probemix, because the quantity of
probes affects how the MLPA PCR reaction comes to a halt. In probe sets with a sufficiently high number of
probes, the PCR reaction will stop due to primer depletion, as all probes use the same PCR primers. After ~30
cycles, most of the PCR primers will have been depleted and even extra PCR cycles will not influence relative peak
heights/areas. In contrast, when there is only a small number of probes, the PCR reaction will slow down due to
rapid reannealing of complementary strands. PCR primers will not be completely consumed, meaning the PCR
reaction does not come to a full stop. As a result, relative peak heights can change in even the last PCR cycles,
thereby making the results more variable. Therefore, make sure that any probemix used in a single MLPA reaction
contains at least 5 probes in total.
6.2.
The effect of the Tm value
There is no upper limit for the Tm and it is thus possible to use long hybridising sequences. The advantage of a
long hybridising sequence and a high Tm is a lower sensitivity of the probe signal to polymorphisms (SNPs) within
the hybridising sequences. However, the use of a non-hybridising stuffer sequence (derived from e.g. T7 or λ2
The RaW program that can be downloaded from our website, use the following settings: Go-Oli-Go method; 0.1 M
salt; 1 µM oligo concentration. Different programs will give different Tm values!
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 11 of 21
Designing synthetic MLPA probes
phage sequences) may occasionally be advantageous to obtain sufficient probe length, for instance when the
target sequence is very GC-rich. Only use a stuffer when necessary, as it is easier to just extend the hybridising
sequence.
Once bound, the chance of a probe leaving its target during the remaining part of the 16 hrs hybridisation reaction
should be very low. In case the binding of one of the probe oligonucleotides to the DNA template is not sufficiently
stable, an equilibrium will be reached between probe binding and probe “denaturation” which is extremely sensitive
to small changes in incubation temperature and probe and salt concentrations. In that case, small differences in
evaporation between different samples can also have a strong effect on the MLPA results. This is why we
recommend having a Tm of at least 71°C.
6.3.
The effect of the first nucleotide
The first nucleotide following the LPO primer binding sequence (GGGTTCCCTAAGGGTTGGAN) affects the height
of the probe signal. Usually, this will be the first nucleotide of the LPO hybridising sequence. (When a stuffer
sequence is used, it is the first nucleotide of the stuffer which matters.) Strongest weakest signal:
CC >C > G > T > A.
We recommend using the following division in the choice of first nucleotides:
• T for short probes (<120 nt)
• G for the intermediate (120-140 nt) probes
• C for long (>140 nt) probes.
The use of Adenosine as a first nucleotide should be avoided. Using CC as the first two nucleotides gives an even
higher signal (CC>CG>CT>CA). Note that the first nucleotide of choice does not necessarily have to hybridise to
the target DNA.
It is not essential to follow these recommendations, but it may help reduce sloping: the effect that longer probes
give lower signals. The above guidelines can also be used to redesign certain LPOs after the first MLPA
experiments in order to further optimise the peak pattern by increasing or decreasing the peak height of selected
probes. Please ensure a minimum size gap of 4 nt between probes remains after the addition of any nonhybridising nucleotides.
6.4.
The effect of mismatches (including SNPs and mutations) on probe signal
When designing a probe that includes an unavoidable SNP, or conversely, a probe that should specifically detect a
single nucleotide difference such as a point mutation, keep in mind the following:
The ligase-65 enzyme is most sensitive to mismatches on 3’ end (=LPO border) of the ligation site.
Probes that have a mismatch on the 5’ site of the ligation site (i.e. the 3’ end of the RPO) are usually still ligated to
some extent. When mismatches are further away from the ligation site, the effect becomes less predictable and
may vary from a substantially reduced probe signal to no effect at all. This depends mostly on the Tm of the
remaining continuous sequence. In the next two chapters, more information can be found first on how to design
when aiming to detect a mismatch and lastly on how to design to minimise the effect of a mismatch.
5’
3’
3’
5’
Figure 9 - The 5’ side of the ligation site (the LPO border) is most sensitive to mismatches.
a. Designing probes that should detect a mismatch
If you aim to design a probe that can distinguish two closely-related sequences (e.g. a gene from a pseudogene) or
one that specifically detects a point mutation or SNP, make sure the mismatch with the related sequence or the
point mutation/SNP is located on the last nucleotide on the 3’ end of the LPO (i.e. the 5’ side of the ligation site);
see Figure 9.
MRC-Holland b.v.
Version 15
Last update 09-09-2015
Page 12 of 21
Designing synthetic MLPA probes
Keep in mind that probes having a G/T or T/G mismatch with the sample DNA at the 3’ end of the LPO still
generate a signal of approximately 25%, see Table 2. This is due to the fact that Guanine and Thymine are able to
form some hydrogen bonds, allowing ligation activity. A very small probe signal (<5%) might be obtained when the
probe has a C/T mismatch with the sample DNA at the 3’ end of the LPO.
Table 2 – Mismatch with the sample DNA at the 3’ end of the LPO
3’ ligation site
sequence to be detected > related sequence
G>A
T>C
C>T
Mismatch between the nucleotide at the 3’ end of the
LPO and the sample DNA. (expected probe signal as
compared to no mismatch)
G > T (~ 25%)
T > G (~ 25%)
C > A (< 5%)
Examples:
Probe: LPO 5’…CATGTGTCCAAG-TGGAAGCCC… 3’ RPO
Gives no signal on sequence CATGTGTCCAAC-TGGAAGCCC
Gives no signal on sequence CATGTGTCCAAT-TGGAAGCCC
But gives a ~ 25% signal on sequence CATGTGTCCAAA-TGGAAGCCC
Solution is to design a probe that detects the complementary strand.
Probe: LPO 5’…CATGTGTCCAAT-TGGAAGCCC…3’ RPO
Gives no signal on sequence CATGTGTCCAAA-TGGAAGCCC
Gives no signal on sequence CATGTGTCCAAG-TGGAAGCCC
But gives a signal (~ 25%) on sequence CATGTGTCCAAC-TGGAAGCCC
Solution is to design a probe that detects the complementary strand.
Probe: LPO 5’…CATGTGTCCAAC-TGGAAGCCC…3’ RPO
Gives no signal on sequence CATGTGTCCAAA-TGGAAGCCC
Gives no signal on sequence CATGTGTCCAAG-TGGAAGCCC
Might give a low signal on sequence CATGTGTCCAAT-TGGAAGCCC
Probe: LPO 5’…CATGTGTCCAAA-TGGAAGCCC…3’ RPO
Gives no signal on sequence CATGTGTCCAAT-TGGAAGCCC
Gives no signal on sequence CATGTGTCCAAG-TGGAAGCCC
Gives no signal on sequence CATGTGTCCAAC-TGGAAGCCC
b. Designing probes while trying to minimise the effect of a mismatch
Sequence variations within two nucleotides of the ligation site can result in a reduced probe signal due to the less
effective ligation of the two probe oligonucleotides. Secondly, mismatches in the middle of the hybridising sequence
may have an (strong) effect on the final probe signal by negatively affecting the stability of the probe binding, due to
the reduction of the remaining Tm. This is why it is advised to avoid any SNPs in the target sequence if possible.
If you cannot avoid the presence of certain SNPs in the probe sequence, make sure you minimise their effect by
situating SNP at least 8 nt from the ligation site. Make sure that both the LHS and RHS sequence still have a
o
remaining continuous sequence (without SNPs) with a Tm of at least 70 C to ensure that the probe oligonucleotide
can still bind stably to its target, even when the SNP is present in the DNA target sequence.
6.5.
Selecting reference probes (only if it is NOT possible to use the P200 or P300 reference probemixes)
MLPA is a relative technique, meaning that any probe peaks obtained only make sense when seen in relation to
other probes and to other samples. To detect any relative changes in the peaks generated by your target-specific
probes, reference MLPA probes are needed. Reference probes should detect genes that are unrelated to the
condition of interest and that are preferably located at a different chromosome.
When you are working with human genomic DNA, adding your synthetic probes to the SALSA MLPA probemix
P200 or P300 will provide you with sufficient reference probes. For all other organisms or RNA detection, you
will have to design your own reference probes. The design of reference probes follows the same rules as targetspecific probes. Please select genomic regions in which copy number changes are rare and which are usually
unaffected in the condition of interest.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 13 of 21
Designing synthetic MLPA probes
6.6.
Optional signal-reducing competitor oligo
By the inclusion of a competitor oligo or COMP in the probemix, a probe signal can be reduced. This COMP is
identical to the LPO and to a small part (4 nucleotides: TGGA) of the Forward primer binding sequence. The
COMP will compete with the LPO for the limiting number of binding sites on the cDNA (in RT-MLPA) or genomic
DNA (in MLPA). It can be ligated to the RPO, but the resulting COMP-RPO ligation product cannot be amplified
exponentially as the probe formed in this way does not contain both primer binding sequences. The use of a 1:1
ratio of LPO and its corresponding competitor normally reduces the probe signal two-fold. COMP oligos for DNA
MLPA mixes can be added together with the LPO and RPO oligos in the 200ul basic synthetic probemix, see
step c in 11.2 Making the synthetic basic probemix (step a-c).
7. MLPA PROBES Designing Methylation-Specific MLPA probes
Please read the above sections 5 MLPA PROBES Basics probe design and 6 MLPA PROBES Important design
concerns carefully, as these rules also apply to Methylation-specific probes.
Cytosine residues followed by Guanines (5’ CpG 3’) are targets for methylation enzymes in humans. Any
sequence carrying a methylation-sensitive restriction endonuclease site can be used for MLPA methylation
detection probes. CpG islands in the promoter region of genes are usually of interest for methylation testing. We
use the Hha1 restriction enzyme, which digests probe-DNA hybrids containing the Hha1 restriction site with the
first C on the target DNA unmethylated. HhaI can be replaced by other enzymes, although not all methylationsensitive restriction enzymes will be compatible with the buffer and temperature used in the MLPA ligation
reaction. In our initial testing, HhaI performed better than HpaII and several other enzymes.
Restriction endonucleases are less efficient in digesting sites that are located near the end of the doublestranded region of the probe-target hybrid. Therefore, the HhaI site should not be located at the 5’ end of the
LHS or at the 3’ end of the RHS; make sure that at least 5 nt on either site of the GCGC sequence hybridise to
the target sequence.
• A GCGC restriction site should be located inside the hybridising sequence, with a minimum of 5 nt
distance to the 5’ of the LHS or the 3’ end of the RHS.
• Because of the high GC% of CpG islands, it can be hard to meet all requirements specified under 5.1
General Probe Design Rules. The following requirements can be relaxed a bit:
∆G can be slightly negative.
GC% should preferably be ~50% around the 5’ and 3’ of the LHS, but may be higher in other parts.
• Most CpG sequences outside the CpG islands are methylated in human DNA. CpG sequences within
CpG islands are often protected from methylation. Sequences located near the boundaries of a CpG
island may in some cases be methylated in a subset of the cells, resulting in low signals for MS-MLPA
probes directed to these sequences.
• For probes in CpG islands, a higher (2-3 fold) concentration of the probe oligonucleotides is sometimes
required, as the high secondary structure of the target sequence of a probe will reduce the
oligonucleotides’ hybridisation speed.
Other criteria for MS probes are similar to those for DNA probes (see 5 MLPA PROBES Basics probe design).
8. MLPA PROBES Probe design example
Synthetic (MS-)MLPA DNA probe
•
Chr. 21q22.11
•
Synthetic DNA specific MLPA probe for methylation quantification in the human EVA1C gene.
•
Genbank Sequence: NM_058187.4
•
Total length of amplification product: 55 + 55 = 110 nt.
•
LPO:
o
Tm= 77.2 ºC.
o
forward primer sequence (bold) + LHS:
GGGTTCCCTAAGGGTTGGACGGTTCAGAAAGATGCTGTGGCCCACTTTAAAACA
A
Length: 19 (PCR primer; bold) + 1 (stuffer) + 25 (hybridising; underlined) = 55 nt.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 14 of 21
Designing synthetic MLPA probes
•
RPO:
o
o
Tm= 79.5 ºC
RHS (5’ phosphorylated!!) + reverse primer sequence (bold):
AGCCCAATTATTAGCGCTCGGCGGCTGTTTGTTCTAGATTGGATCTTGCTGGCAC
Length: 31 (hybridising; underlined) + 1 (stuffer) + 23 (PCR primer; bold) = 55 nt.
HhaI site (GCGC) is highlighted in grey.
The combined LHS+RHS is:
GGTTCAGAAAGATGCTGTGGCCCACTTTAAAACAAAGCCCAATTATTAGCGCTCGGCGGCTGTTTG
The probe will bind to the reverse-complement of this sequence!
9. ORDERING synthetic probes
We strongly recommend ordering probes from IDT: www.idtdna.com. We know some laboratories experienced
problems using synthetic MLPA probes bought elsewhere, due to bad quality or incomplete phosphorylation. A
low quality of the oligonucleotides results in lower signals and shoulder peaks. In particular an extra peak that is
one nt shorter than the real probe peak can appear. Quality requirements for MLPA probe oligonucleotides are
higher than for conventional PCR primers, so select your supplier carefully.
Before ordering, take note of the following:
All RPOs should be 5’-phosporylated!
LPO: starts with GGGTTCCCTAAGGGTTGGA (forward primer binding sequence).
RPO: ends with TCTAGATTGGATCTTGCTGGCAC (reverse primer binding sequence).
Note that oligos should never be fluorescently labelled; only the PCR primers (ordered from MRC-Holland)
need to be labelled (if desired).
Oligos shorter than 60 nt: 25 nMol.
Oligos longer than 60 nt: ‘’Ultramers” ultramer at 4 nMol scale.
An example of a synthetic probe as it should be ordered can be found in paragraph 8 MLPA PROBES Probe
design example. In our experience, synthetic oligonucleotides, including phosphorylated oligos, are stable for
o
many years when dissolved in TE and stored at -20 C.
10. ORDERING MLPA reagents
To perform an MLPA reaction, you need MLPA reagents. Reagents are sold by MRC-Holland in so-called
SALSA MLPA EK kits, which contain all necessary enzymes, buffers and labelled PCR primers. MLPA
Reagents kits are described in detail in 10.4 EK MLPA reagent kits
Furthermore, it is recommended to add your probes to an existing SALSA MLPA (reference) probemix, if
possible. There are three basic options of how to use your own synthetic probes in an MLPA reaction:
1. Combine synthetic human DNA probes with the SALSA MLPA P200 or P300 Human reference probemix in
combination with an EK MLPA reagents kit. This is the most commonly used option. See 10.1 Situation
1: adding probes to P200/P300 reference probemix.
2. Add a few probes (1-2) to any existing MLPA probemix and use the MLPA reagents of an EK MLPA
reagents kit. See 10.2 Situation 2: adding probes to an existing SALSA MLPA probemix.
3. For other applications, such as RNA detection or other organisms, make a completely synthetic probemix
and use this in combination with EK (RT-)MLPA reagents kit. See 10.3 Situation 3: making an allsynthetic probemix. It is possible to order quality control fragments separately if desired.
More information about these options can be found below. All prices and ordering information can be found on
www.mlpa.com under Ordering > Price list.
10.1.
Situation 1: adding probes to P200/P300 reference probemix
The SALSA MLPA P200 and P300 MLPA Human Reference probemixes both contain carefully selected reference
probes for human DNA and are specifically designed to be used in combination with self-made synthetic human
DNA probes. In addition, they contain various control fragments that are also present in other SALSA MLPA
probemixes, which help detect problems that could affect the MLPA reaction (insufficient DNA quantity,
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 15 of 21
Designing synthetic MLPA probes
denaturation problems). Together, the reference probes and control fragments facilitate data analysis, maximise
the number of synthetic probes you can include and give you extra assurance that the MLPA reaction went well.
More details about the P200 and P300 can be found in Table 3 and Table 4. The main difference is that the P200
leaves the range from 80-170 nt open for the inclusion of synthetic probes, while P300 has reference probes
distributed over the whole size range of the probemix. The latter allows for a better correction of signal sloping in
the MLPA amplification products3. The use of P300 is recommended when a smaller number of synthetic probes is
used. The use of P200 is recommended when a large number of synthetic probes is used, preferably targeting
sequences on different chromosomes. More information on www.mlpa.com; search for P200 or P300.
Advantages & Disadvantages of using P200 or P300 reference probemix:
Probes are not suitable for non-human DNA.
+
No need to design reference probes. The SALSA MLPA reference probes in the P200 and P300 have
been carefully selected from our probe database of well over 15,000 probes on the basis of their
stable and reliable performance.
+
SALSA MLPA reference probes are located over the whole size range (P300) or predominantly in the
longer probe range (P200), thus maximising the number of (shorter) self-made target probes to be
used in the limited size range suitable for synthetic probes, without having to use up this precious
design space for reference probes.
+
The presence of quantity control fragments (Q-fragments) warns for insufficient DNA or ligation problems.
4
+
Denaturation fragments (D-fragments) warn for poor denaturation, for instance due to contaminants .
+
P200 and P300 allow for easy MLPA troubleshooting: using this probemix enables you to determine
whether possible problems are due to the synthetic probes (i.e. design, quality) or something in the
MLPA reaction or sample quality.
+
Identity of reference probes available on request.
Table 3 – SALSA MLPA P200 Human DNA Reference-1 probemix
Length
(nt)
SALSA MLPA probe
Chromosomal position
MV36*
other
reference
(in Mb)
64-70Q-fragments: DNA quantity; only visible with less than 100 ng sample
76-82
DNA
173
Reference probe 03578-L02939
7q31
117.09
178
Reference probe 03139-L02607
14q22
54.40
184
D-fragment 08865-L08987
14q32
103.25
190
Reference probe 09561-L10015
20p13
3.84
196
Reference probe 05371-L04762
13q12
19.70
202
Reference probe 02213-L01217
20p12
10.57
208
Chromosome X probe 05005-L04391
Xq26
132.50
214
Reference probe 08172-L08052
10p13
13.18
220
Reference probe 09841-L10251
12q24
129.42
226
Reference probe 09100-L09159
4q25
110.91
233
Reference probe 05737-L05176
18q11
13.87
240
Chromosome Y probe 01071-L00464
Yq11
14.10
244
Reference probe 08051-L07832
5p15
13.82
250
Reference probe 08590-L08591
17p11
17.07
* Distance to P-telomere.
3
Signal sloping is the effect that longer probes generate a lower peak height in the electropherogram than shorter
probes. The degree of sloping differs between sequencer types. Because signal sloping may differ between
samples, a bias can occur when reference probes are located only in the longer probe range as is the case in the
P200. This is why the P300 reference probemix might be preferred.
4
To learn more about Q and D control fragments, please consult the MLPA protocol, which can be found on our
website www.mlpa.com > MLPA procedure > MLPA Protocols > One-Tube MLPA Protocol for DNA Detection and
Quantification.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 16 of 21
Designing synthetic MLPA probes
Table 4 – SALSA MLPA P300 Human DNA Reference-2 probemix
Length
(nt)
SALSA MLPA probe
other
Chromosomal position
MV36*
reference
(in Mb)
64-7076-82
88
Q-fragments: DNA quantity; only visible with less than 100 ng sample
DNA
D-fragment S0598-L28340
10.8 Mb
19p13
Ligation-dependent control
92
113.3 Mb
02q13
fragment S0005-L00509
108
Reference probe S0973-L27812
4p13
42.3 Mb
130 #
Digestion control probe S0750-L27811
2q12
102.6 Mb
148
Reference probe 17669-L27446
5q33
156.6 Mb
172
Reference probe 19185-L27754
3q23
140.4 Mb
178 #
Digestion control probe 20190-L27120
21q22
34.1 Mb
184
D-fragment 10904-L27810
9q34
134.2 Mb
191
Reference probe 18767-L28188
10q22
71.9 Mb
196
Reference probe 11157-L11841
5q31
137.6 Mb
208
Chromosome X probe 19928-L27808
Xq23
111.9 Mb
214
Reference probe 19623-L27807
10p11
34.6 Mb
220
Reference probe 14967-L27452
6q22
129.7 Mb
226
Reference probe 20173-L27439
2p22
32.2 Mb
232
Reference probe 19768-L27755
12q12
41.1 Mb
239
Chromosome Y probe 19927-L27806
Yq11
14.0 Mb
246
Reference probe 19985-L27453
4p16
5.7 Mb
252
D-fragment 20039-L27756
16q24
86.2 Mb
258
Reference probe 18593-L27454
2q33
199.9 Mb
265
Reference probe 13392-L14849
6q12
65.4 Mb
274
Reference probe 17450-L21206
16p13
9.8 Mb
* Distance to P-telomere.
# Only when used for methylation quantification (MS-MLPA), this denaturation warning probe can be
used as digestion control probe (warning for insufficient HhaI digestion). Upon digestion of the probesample hybrids with HhaI, this probe should not give a signal.
Probes with length 88-148 are included in P300 reference probemix only; P200 leaves this range open for inclusion
of additional synthetic probes.
Data obtained with the P200 and P300 and included synthetic probes can be analysed using the Coffalyser.Net
MLPA data analysis software. Coffalyser can be downloaded freely from our website: www.mlpa.com (click on
Coffalyser.Net). In the Coffalyser Sheet Library you can find the P200 and P300 sheets, to which you can add your
synthetic probes.
10.2.
Situation 2: adding probes to an existing SALSA MLPA probemix
Advantages & Disadvantages of using an existing SALSA MLPA probemix:
+
No need to order another probemix.
+
No need to design reference probes.
+
Easy to do.
Little space to add probes.
Recommended when only 1 or 2 probes have to be added.
10.3.
Situation 3: making an all-synthetic probemix
In case you are designing probes for organisms other than humans, the only option is to make an all synthetic
probemix consisting solely of your own synthetic probes. You can use this probemix in combination with an MLPA
EK reagents kit. More information on how to pipette this synthetic probemix can be found in 11 PREPARING the
synthetic probemix.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 17 of 21
Designing synthetic MLPA probes
Advantages & Disadvantages of making an all-synthetic probemix:
Necessary to design own reference probes, which can be challenging and takes up design space. It is
advised to use minimally 8 (for tumour characterisation minimally 10) reference probes.
Difficult to assess whether possible problems are due to synthetic probe design or oligo quality or other
factors.
No quality control fragments (can be ordered separately).
+
Suitable for all organisms
•
Note that at least 5 probes should be included in the MLPA reaction.
•
Recommended only for experienced MLPA probe designers.
10.4.
EK MLPA reagent kits (for standard MLPA and MS-MLPA)
EK kits contain all necessary MLPA reagents except for a probemix; so no reference probes or quality control
fragments are present. The MLPA reagents are5:
1.
2.
3.
4.
5.
6.
MLPA buffer
Ligase-65 enzyme
Ligase-65 buffer A
Ligase-65 buffer B
SALSA Polymerase
SALSA PCR primers, incl. dNTPs – various fluorescent dyes available, incl FAM, Cy5.0
EK kits are available in the following pack sizes: EK1 (100 reactions) and EK5 (500 reactions). EK kits can be used
both for a standard MLPA reaction as well as Methylation-Specific MLPA (HhaI enzyme not included).
10.5.
Quality Control Fragments
It is possible to order control fragment to be used with your own synthetic MLPA probes. Two control fragment
solutions are available:
•
CF1: contains Quantity Control (Q-)fragments which screen for insufficient DNA quantity + the 92 nt control
fragment to compare these signals to.
•
CF4: contains Q-fragments + the 88 & 96 nt Denaturation Control (D-)fragments and the 92 nt control
fragment to compare these signals to.
Both CF1 and CF4 are supplied as 25 x concentrated solutions (175 µl/vial; sufficient for 3000 MLPA reactions).
Note that only the Quantity Control fragments will work on ANY organism as they do not need to hybridise to the
target DNA. The 92 nt fragment and 88 and 96 nt Denaturation Control fragments work on human DNA only!
11. PREPARING the synthetic probemix
11.1.
•
•
•
11.2.
General guidelines
Do not use much more than the recommended amounts of probes as this may cause non-specific
amplification products and lower probe signals. The amount given below is sufficient to cover >95% of the
target sequences with probes within 10 hrs of hybridisation. Having such near-complete coverage means
that relative probe signals will depend on the relative amount of the probe target sequence in the sample
and NOT on the exact amount of probes used. A probe signal cannot be increased by addition of larger
amounts of that particular probe.
Oligos should be dissolved and diluted in TE: 10mM Tris-HCl, pH=8.0; 1 mM EDTA
Oligo solutions should be stored at -20 ºC. They should never be heated.
Making the synthetic basic probemix (step a-c)
Making a synthetic probemix from incoming oligos requires the following four steps (see also Figure 10 and
examples below) :
a. Make a 100 µM (normal oligos) or 10 µM (ultramers) oligo stock solution for each oligo by adding TE.
5
Note that in October 2011, MRC-Holland has switched to a one-tube MLPA protocol. Before this date, the so
called two-tube MLPA protocol was in use. EK kits sold prior to October 2011 also contained SALSA PCR Buffer
and Enzyme Dilution Buffer. These two reagents are no longer needed in the one-tube protocol.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 18 of 21
Designing synthetic MLPA probes
b.
c.
d.
Make a 1 µM final solution for each oligo by diluting the oligo stock solution further.
Combine 0.8 µl of the 1 µM final solution of each oligo (LPO and RPO of all probes), adding TE to
obtain a total volume of 200 µl. This is the synthetic basic probemix.
Add this synthetic basic probemix to (1) the P200/P300 reference probemix, or (2) to an existing MLPA
probemix, or (3) dilute it further to use it independently, as specified below.
Figure 10 - How to process incoming oligos to a final probemix that can be used for the MLPA reaction.
Example 1 (step a-c): you receive 40 nMol of oligo:
a. Dissolving 40 nMol of oligo in 400 µl TE will result in a 100 µM stock solution.
b. From this 100 µM stock solution, make a 100 fold dilution (1 µM) of each oligo in TE, for example
making 1 ml by diluting 10 µl stock solution in 990 µl TE.
c. Mix 0.8 µl of each 1 µM oligo solution (LPO + RPO) in a total volume of 200 µl.
Example 2 (step a-c): if you receive 4 nMol 6 (e.g. IDT ultramers), it is recommended to prepare stock solutions of
10 µM instead of 100 µM.
a. Dissolving 4 nMol oligo in 400 µl TE will result in a 10 µM stock solution.
b. From this 10 µM stock solutions, make a 10 fold dilution (1 µM) of each oligo in TE, for example making
0.1 ml by diluting 10 µl stock solution in 90 µl TE.
c. Mix 0.8 µl of each 1 µM oligo solution (LPO + RPO) in a total volume of 200 µl.
11.3.
Making the final probemix (step d)
Step d, making the final probemix that is to be used in the MLPA reaction, depends on what the synthetic oligos are
added to:
Situation 1 - Adding oligos to an MRC-Holland MLPA probemix:
Use 1.5 µl MRC-Holland probemix + 0.5 µl of your own synthetic basic probemix (end product of step c) in the
MLPA reaction. Total volume of the hybridisation reaction is increased from 8 to 8.5 µl, but this is no problem.
Situation 2 - Adding oligos to the P200 or P300 MLPA reference probemix:
For each planned MLPA reaction, combine 0.5 µl of your synthetic basic probemix (end product of step c) with 1 µl
of P200 or P300 reference probemix. From this solution, use 1.5 µl for each MLPA reaction.
Situation 3 - Using an all-synthetic probemix
Increase the volume of the synthetic basic probemix (end product of step c) to 600 µl (optionally including 24 µl of
the 25x concentrated control fragment mixes CF1 or CF4) by adding TE. From this solution, use 1.5 µl for each
MLPA reaction.
6
When receiving 15 nMol or less, it is advised to make a 10 µM stock solution (step a) instead of a 100 µM stock
solution, as dissolving oligos in less than 150 ul TE is not practical. When an oligo is longer than 60 nt, these are
typically ordered as ultramers (see 9 ORDERING synthetic probes) in which case the quantity received is usually
<15nM.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 19 of 21
Designing synthetic MLPA probes
Example 3 - making a final synthetic probe mix (step a-d) for one probe (situation 2):
•
LPO concentration: received 40.5 nmol, dissolve in 405 µl TE to get a 100 µM stock solution.
•
RPO concentration: received 27.2 nmol, dissolve in 272 µl TE to get a 100 µM stock solution.
•
From both the LPO and RPO stock solution, make 1 µM final solution. For 1 ml, take 10 µl of the stock
solutions and add to 990 µl TE. Do this for both oligos.
•
To obtain a synthetic basic probemix with a total volume of 200 µl, mix
o
0.8 µl of the LPO 1 µM final solution
o
0.8 µl of the RPO 1 µM final solution
o
198.4 µl TE
•
Step d: use 0.5 µl of this 200 µl synthetic basic probemix together with 1 µl P200 or P300 MLPA reference
mix and use this combined probemix for the MLPA reaction.
11.4.
a.
b.
c.
d.
Making a competitor oligo mix
Dissolve each COMP in TE at a concentration of 100 µM.
Mix 4 µl of each 100 µM COMP.
Dilute with TE to a final volume of 1000µl.
Prepare hybridisation master mix containing, for each reaction: 1.5 µl MLPA buffer (yellow cap) + 1.5 µl
probemix (black cap). Add 1.5µl MLPA Buffer + 1.5 µl probemix + 0.5 µl of Competitor mix.
o
Proceed with the MLPA protocol: 1 minute heating at 95oC, 16 hrs incubation at 60 C etc.
12. Troubleshooting
All probes give low signals:
To test whether your oligo supplier indeed supplies good quality oligos, you can order this probe:
SerpinB2 gene: Chr. 18; length of amplification product: 81+42=123 nt.
LPO: GGGTTCCCTAAGGGTTGGACCATGACTCCAGAGAACTTTACCAGCTGTGGGTTCATGCA
RPO: 5’-P-GCAGATCCAGAAGGGTAGTTATCCTGATGCGATTTTGCAGGTCTAGATTGGATCTTGCTGGCAC
An optional competitor that can be used to reduce the signal of this probe (see 6.6 Optional signal-reducing
competitor oligo) has the sequence: TGGACCATGACTCCAGAGAACTTTACCAGCTGTGGGTTCATGCA
Low signal of one or a few probes:
In case one probe signal is very low, addition of up to three times more of that specific probe may sometimes solve
the problem, especially for probes in CG-rich sequences. A new design of the LPO may also help: remember that
having a Cytosine as the first nucleotide after the PCR forward primer sequence will generate the highest signal.
See 6 MLPA PROBES Important design concerns.
High signal of one or a few probes:
There are two options to reduce peak height. First is to change the first nucleotide after the primer of the LPO to a
T, see 6.3 The effect of the first nucleotide. Another option is to order a competing LPO, see 6.6 Optional signalreducing competitor oligo for more information.
For other troubleshooting related to the MLPA reaction, see the troubleshooting section on our website. Q and D
fragments for example are important aids in troubleshooting MLPA.
Version 15
Last update 09-09-2015
MRC-Holland b.v.
Page 20 of 21
Designing synthetic MLPA probes
13. References
The following publications describe the use of synthetic MLPA probes:
•
•
•
•
•
•
•
•
Kiehntopf et al. (2012) A homemade MLPA assay detects known CTNS mutations and identifies a novel
deletion in a previously unresolved cystinosis family. Gene 495:89-92.
Serizawa et al. (2010) Custom-designed MLPA using multiple short synthetic probes: application to methylation
analysis of five promoter CpG islands in tumor and urine specimens from patients with bladder cancer. J Mol
Diagn 12:402-8
Wildförster, V. and Dekomien, G. (2008) Detecting copy number variations in autosomal recessive limb-girdle
muscular dystrophies using a multiplex ligation-dependent probe amplification (MLPA) assay. Mol Cell Probes.
23:55-9.
Roelfsema et al. (2005) Genetic heterogeneity in Rubinstein-Taybi Syndrome: mutations in both the CBP and
EP300 genes cause disease. Am J Hum Genet. 76:572-80.
Vink GR et al. (2005) Mutation screening of EXT1 and EXT2 by direct sequence analysis and MLPA in patients
with multiple osteochondromas: splice site mutations and exonic deletions account for more than half of the
mutations. Eur J Hum Genet. 13:470-4.
Langerak P et al. (2005) Rapid and quantitative detection of homologous and non-homologous recombination
events using three oligonucleotide MLPA. Nucleic Acids Res. 33:e188.
Stern RF et al. (2004) Multiplex ligation-dependent probe amplification using a completely synthetic probe set.
Biotechniques. 37:399-405.
White et al. (2004) Two-color multiplex ligation-dependent probe amplification: detecting genomic
rearrangements in hereditary multiple exostoses. Hum Mutat. 24:86-92.
14. Useful websites, tools and software
If an URL is no longer working, please notify us at [email protected].
Coffalyser.Net
Mfold DNA Folding
Program
Ensemble
Entrez Gene
Human Genome BLAST
Human Genome
Organization
Genbank
Genomic Variants
Database
Map Viewer (Human)
NR-BLAST
OMIM
PubMed
RaW
USCS BLAT
Free software for analysis of MLPA results, available via www.mlpa.com Coffalyser.Net
http://mfold.rna.albany.edu/?q=mfold
Parameters should be set on [Na+] = 0.35 M, T = 60° C.
http://www.ensembl.org/index.html Ensembl is a joint project between EMBL - EBI
and the Sanger Institute. It is helpful for information on certain genes
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene, useful for finding NMsequences (for exon numbers, see NG-sequences:
http://www.ncbi.nlm.nih.gov/refseq/rsg/browse/).
http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606
http://www.genenames.org
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide
Useful for looking up reference (NM_) sequences.
http://dgv.tcag.ca/dgv/app/home
Database of copy number variants in the human genome
http://www.ncbi.nlm.nih.gov/mapview/
NCBI: NR-blast/blast.ncbi.nlm.nih.gov
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed
http://www.mlpa.com - Support – Designing Synthetic probes
MRC-Holland Software for Tm determination
http://genome.ucsc.edu/cgi-bin/hgBlat?command=start
Please note that designing MLPA for commercial use is not allowed when this infringes on MLPA patents US
6955901, CA2400240, EP 1130 113 A1, US 2007009288
MRC-Holland b.v.
Version 15
Last update 09-09-2015
Page 21 of 21
Designing synthetic MLPA probes
Implemented Changes compared to previous synthetic probe design protocol versions
Version 15 (Sep 2015)
Information about mRNA MLPA removed (Protocol inc. RNA probes is available on request).
Information about NG-sequences added.
Minor textual changes and layout changes.
§ 2 Term/abbrevations adjusted
§ 5.2 ≥12 nucleotides overlap with both LHS and RHS of a homologous sequence changed into >12.
§ 10.1 Table 3 adjusted and Table 4 added.
Version 14 (Dec 2014)
Minor textual changes and layout changes.
§12.5 Making a COMP mix for RNA mixes added.
§5.1 Added reference to §6 MLPA PROBES Important design concerns
Version 13 (Dec 2014)
Changed the term ‘kit into ‘probemix’, where applicable.
Removed information about PM200 probemix and EK20 reagent kit.
Minor textual changes and layout changes.
§1 Removed information about alternative probe design methods; reference to §11.1 added.
§2 Link to RaW program updated; information about Coffalyser.Net software added; mistake corrected in
information about Primer.
§3.2 Information about high signals which should be taken into consideration added.
§4 Information about transcript to choose changed; figure 4,5&6 updated.
§5.2 Changed minimum length LHS and RHS to 23 instead of 21 nt; settings Genome BLAST specified.
§6.4 Increased the minimum number of nt needed in between SNP; ligation site and 5’ and 3’ ends added in
figure 9.
§9 Probe design examples updated.
§11.1 Minor changes in table 3.
§11.2 Situation 2: Adding probes to P200/P300 reference probemix placed after §11.1 Situation 1: adding
probes to an existing SALSA MLPA probemix. Advantage added to the last-mentioned situation.
§11.3 Completed with information about number of reference probes to add.
§11.6 CF2 changed into CF4.
§12.4 Volume of RT mix added.
§14 Reference list updated.
§15 Link Genomic Variants Database updated and information about Coffalyser.Net added.
Version 12 (Jan 2012)
Order of chapters changed: probe design example is now §9.
§6.3 The effect of the first nucleotide: lengths added for short, intermediate and long probes.
§8.1: Recommended Tm value of RT-primers increased to 55-65 ºC (identical to versions before v11)
§11 Ordering MLPA reagents has been rewritten: a clearer distinction has been made between probemixes
and reagent kits; the contents of the EK MLPA Reagents kits have been adapted to the one-tube MLPA
protocol.
§12 Making the synthetic probe mix has been described in more detail and an illustration has been included
§13: probe design example altered
Version 11 (Sept 2011)
Various changes in wording, pictures and document structure, including:
§1: Mentioned the PM200 as a reference kit for mouse DNA; added information about minimal number of
probes for MLPA reaction.
§2: Changed HUGO website.
§4.1: Added referral: 4.3 ‘Elongating a known human sequence in one or both directions’; Replaced figures
4a, b & c and figure 6.
§5.2: Changed MFold DNA Folding Program website and max Tm in ‘Testing the specificity of the probe.
§8.1: Changed the Tm of RT-primers
§9: Changed information about scale of oligos to order; added information about oligo quality.
§10: Added 10.4 ‘Minimal requirements’.
§11: Added note that oligo solutions should not be heated.
§13: Added example of making a synthetic probemix.
§15: Changed HUGO, USCS BLAT and MFold DNA Folding Program websites; added information about
AlleleID software.