Download Two-Exon Skipping Due to a Point Mutation in p67

From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
Two-Exon Skipping Due to a Point Mutation in p67-phox-Deficient Chronic
Granulomatous Disease
By M. Aoshima, H. Nunoi, M. Shimazu,
S. Shimizu, 0. Tatsuzawa, R.T. Kenney, and S.Kanegasaki
The cytosolic 67-kD protein in phagocytes (p67-phoxl andB
lymphocytes is one of essential components ofthe superoxide-generating systemin these cells, and its defect causes an
autosomal recessive type ofchronic granulomatous disease
(CGD). We performed mutationanalysis of p67-phox mRNA
from a CGD patient who lacks the protein and foundan inframe deletion from nucleotide 694 t o 879, which corresponds t o t h e entire sequence of exons 8 and 9. This sequence encodes one of two Src homology 3 domains and a
part of proline-rich domain in p67-phox and lack of these
domains seem t o have influenced stability of this protein.
To know causative reason for thedeletion, we analyzed genomic DNA for p67-phox using two sets of primersthat covered exons 8 and 9 with adjacent introns. The DNA fragments from the patient were shown t o be same in length
as those fromcontrol. However, the single-strand conforma-
tion-polymorphism analysis of the fragments showed that
a patient’s specimen that included the splice junction of
exon 9 exhibited different m o b i l i from thecontrol. By sequencing of the fragment, a homozygous G t o A replace+l
of intron9 was foundt o be a sole mutament at position
tion, which reduced thematching score of the splicing
sequence to theconsensus calculated according t o t h eformula proposed by Shapiro and Senapathy (Nucleic Acids
Res 15:7155,1987). The reduced matching score at the splice
doner site (5’ splice site] of intron 9 and the original low
matching score at theacceptor site (3’splice site) of intron
7 may explain the skipping of exon 8 and 9, and another
predicted mechanism is discussed on the basis of Shapiro
and Senapathy’s hypothesis.
0 1996 by The American Society of Hematology.
(Gly-78 to Glu) was responsible for the protein deficiency
HRONIC GRANULOMATOUS disease (CGD) is a
in one CGD patient. Skipping of exon 3 due to T to C
rare inherited disorder whereby phagocytes cannot
replacement in the splice donor site in intron 3 was also
generate superoxide anion and its derivatives to other active
found recently.’8In this study, we report a new type of
oxygen species that may be used for killing infectious agents.
p67-phon-deficient CGD, whose mRNA lacks the entire
Patients with this disease have recurrent, life-threatening insequence of two exons, namely exons 8 and 9. A single
fections with catalase-positive bacteria and fungi.’ The sunucleotide replacement found at position + l of intron 9
peroxide generating system in phagocytes and B lymphogreatly reduces the matching score of the splicing sequence
cytes’ consists of a membrane-bound catalytic component,
to the consensus29and seems to be responsible for the delecytochrome bSs8,and cytosolic components that seem to be
required for activation of the system. A functionally active
tion. Two exon skipping due to a point mutation at a splice
enzyme complex is formed on stimulation of macrophages
site has rarelybeen reported, and this is the first case in
or neutrophils by assembly of the necessary components on
CGD.
the plasma membrane. This complex carries an electron from
MATERIALS AND METHODS
reduced form of nicotinamide-adenine dinucleotide phosCase. The patient is a 24-year-old man with a history of recurphate to molecular oxygen to form superoxide anion, which
rent skin abscess, pneumonia, and cervical lymphadenitis, whose
isthen released to the outside of the cells or inside the
parents were first cousins. His first episode of cervical lymphadenitis
phagosomes.3
and gastroenteritis was at the age of 9. The patient’s neutrophils
The catalytic component, cytochrome bSs8,is composed
showed normal chemotaxis and phagocytosis, but failed to generate
of two subunits, gp91- and p22-phox (phagocyte oxidase).
02-(2.9%of control) on stimulation with FMLP.
Cytosolic components include p47- andp67-phoxand
a
Epstein-Barr virus transformation. B lymphoblast cell lines
small guanosine-triphosphate binding protein Ra~-p21.‘“~ were established by immortalization with Epstein-Barr virus (EBV)
These five proteins were shown to be sufficient to support
as previously de~cribed.’~
Briefly, the collected mononuclear cells
superoxide-generation in a cell free ~ y s t e m .Any
~ . ~ defect in
from the patient were exposed to EBV obtained from B95-8 culture
the four “phox” proteins causes CGD, which occurs either
medium for 2 hours, then cultured for 4 weeks.
as an X-linked or an autosomal di~order.~
The gene responsible for the former type of CGD codes for gp91-phox and
From The Institute of Medical Science, the University of Tokyo,
genes responsible for the latter for p22-, p47-, and p67-phox.
MitsubishiYuka Bio-Clinical Laboratories Inc, Tokyo, National
The mRNAs that code for allphox proteins have been cloned
Center of Pediatric Treatment, Setagaya-ku, Tokyo, Japan: and the
and sequenced and the genomic organizations r e p ~ r t e d . ~ ” ~National Institute of Allergy and Infectious Disease, National InstiIt is known that p67-phox deficiency is rare in the United
tutes of Health, Bethesda, MD.
States,” Europe,*’ and Japan (manuscript in preparation).
Submitted December 27, 1995; accepted April 25, 1996.
Supported in part by the grants in aid from the Ministry of EducaMutations that cause this type of CGD are heterogeneous,’
tion, Science and Culture of Japan.
in contrast to the cases in p47-phox deficiency, the majority
Address reprint requests to H . Nunoi, MD, The Instituteof Medical
of whichseem to be accounted for by a common dinucleotide
Science, the University of Tokyo, 4-6-1 Shiroganedai, Minatoku,
d e l e t i ~ n , ’although
~ ~ ~ ~ some patients were heterozygous for
Tokyo 108, Japan.
this deletion and had a second missense rnutaion in the other
The publication costs of this article were defrayed in part by page
allelle.’33’5We found a homozygous AG dinucleotide insercharge payment. This article must therefore be hereby marked
tion in one patient with p67-phox deficiency, which would
“advedsement” in accordance with 18 U.S.C. section 1734 solely to
bring about a frame shift into mRNA resulting in an early
indicate this fact.
stop codon.26de Boer et alZ7reported that a mutation re0 1996 by The American Society of Hematology.
sulting in a nonconservative amino acid change in p67-phox
0006-4971/96/8805-0016$3.00/0
C
Blood, Vol 88,No 5 (September l), 1996:pp 1841-1845
1841
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
AOSHIMAET AL
1842
Table 1. OligonucleotidePrimers Used for Reverse
Transcriptase-PCR
~~
~
No.
1
2
3
4
5
6
7
8
9
10
Sequences Position
Direction
Sense
Antisense
Sense
Antisense
GGGTGTGCCTGAGACAAAAGAA Sense
Antisense
ATCCTTCATGCTGTCTTCTGAAAG
Sense
GCTGGAACACACTAAGCTGAGCTA
Antisense
TTTCTTCAGCTTTGTAGTGTGA
Sense
CTTAAAGAAGCCTTGATTCAGCTT
CGCAACTCAACTGGTTCAAGGTAG
Antisense
AGGCCTCCTAGTITCTACCTAATC
CCTCCTTCTTGGCATACATGAAAG
TTCGAGGGAACCAGCTGATAGACT
TTGAACATGACCGTGGCCCAGTTA
1-24
407-430
326-349
856-879
772-795
1237-1260
1182-1205
1612-1635
304-327
900-923
Set of primers 1 and 2,3 and 4,5 and 6,7 and 8, and 9 and 10 were
used for amplification targeting nucleotide 1-430, 326-879, 772-1260,
1182-1635 and 304-923, respectively.
I t n r n ~ o ~ M oar~al~sis.
t
Cytosolicfractionsfrom the B-cell lines
were subjected to sodium dodecyl sulfate-polyacrylamide
gel electrophoresis(SDS-PAGE).Proteinswere
blotted to polyvinylidine
difluoride (PVDF) membrane and detected with specific antibodies
against p67-p11o.r and p47-pho.r, as previously described.’
lsolntion of RNA nrld r w t l w s i s of cDNA. Total RNA was isolated from B-cell lines with an acid guanidinium thiocyanate-phenolchloroform method asdescribedpreviously.”
The first strandof
cDNA was synthesized from20 ng total RNA using Moloney murine
leukemia virus reverse transcriptase primed with 30 pmoles of random hexamer mixture. Subsequently, cDNA for p67-pho.~ was amplified by polymerase chain reaction (PCR)with the oligonucleotide
primers shown in Table I. The PCR was performed for 30 cycles
using the following conditions: denaturation
at 94°C for 1 minute,
annealing at 52°C for 1 minute. and extension at72°C for 30 seconds.
PCR productsofp67-phoxcDNAwere
run on l 9 lowmelting
agarose gel, excised from the gel, andpurified using a glass powderbased procedure (Gene Clean 11 Kit: Bio 101, Inc, La Jolla, CA).
Subsequently the PCR products of p67-phr~x cDNA were sequenced
directly.
Grnonlic DNA. GenomicDNAwasisolatedfromtheEBV
Bcell lines. PCR was performed with the specific primers designed
forexon8andadjacent
intron sequence(5’-TCCGATCAGTCAGAAATGCGG-3’assenseprimer,andS’-GTGTCAGCCCCACCACAGTC-3’ as antisense primer). and for exon 9 and adjacent
intron sequence (S’-TTGCAGTTAGATGTGGAGTT-3’ as sense
primer, and S’-AACTCAACTGGTTCAAGGTAGTTG-3‘ antisense
primer). The PCR products were purified with 2 9 low melting agarose gel and subcloned directly into a TA cloning vector (pCR 11:
Invitrogen. San Diego, CA). The recombinant plasmids were
prepared from transformant Esrhrrichia coli strains with an alkalineSDS method.
Singlr-srrrmd con!fonrlcrrion polymorphirrn. About 100 ng each
of PCR products in 12 pL of Tris-borate buffer (TBE) containing
l 9 Ficoll 400. 0.259 BromophenolBlue.0.25%Xylene
cyano1
were denatured at 80°C for 5 minutes, cooled on ice and run on a
cooled 10% polyacrylamide gel at 4°C as described by Hongyo et
al.”’ Subsequently,the gel wasstainedwiththesilver(2D-Silver
Stain 11; Daiichi Pure Chemicals, Inc. Tokyo, Japan).
DNA sequencing. Cyclesequencingreactionswereperformed
using Taq Dye Deoxy Terminator Cycle Sequencing
Kit (PerkinElmer,Chiba,Japan).Sequencingwasperformedusinganautomated sequencer (AB1 model 373A: Perkin-Elmer). A total of 1 p g
of the cloned plasmid or 80 ng of the PCR products were used as
template.
RESULTS
The patient was diagnosedwith CCD by the lack of superoxide dismutase sensitive cytochrome c reducing activity of
his neutrophils on stimulation. In contrast to the cytosol of
the EBV-transformed B-cell lines from normal volunteers,
which supported the superoxide generating activity of neutrophil membrane in vitro, that from the patient did not support activity. Normal levels of the large and small subunits
of cytochrome bSsRwere found in the patient’s neutrophils
by Western blots. Cytosol of the patient’s neutrophils
and
EBV-transformed B-cell line contained a significant amount
of p47-phox, but no detectable p67-phox protein (Fig I ) .
Total RNA was isolated from thepatient’sEBV-transformed B-cell linesand used to obtainfirst-strand cDNA
by reverse transcription, then amplified with a set of four
overlapping sense and antisense primers designed to cover
the entire coding sequenceof p67-phox (Table 1). As shown
in Fig 2, PCR products using two sets of primers, 112 and
7/8, were detected, but not the product of primers 314 (lane
F ) and 5/6 (laneG). The result suggests there wasa deletion
in theregionbetweennucleotides
326and 1260. Subsequently, another set of primers (9/10) that span nucleotides
304 to 923were synthesized and the cDNA amplified to find
the deletion in the p67-phox cDNA. The fragment obtained
fromthe patient’s RNAwassingleand
shorter than that
from control RNAby about 200 bp (lanesI and J). By direct
sequence of the fragment, the deleted part was determined
l
2 PMN
Fig 1. lmmunoblot analysis of transformed B-cell lines, cytosolic
fraction, with antibodies against p67-phox and p47-phOX. Lane l,Xlinked CGD;lane 2, this case; PMN, normal neutrophil.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
TWO EXONSKIPPING IN p67-ph0x-DEFlClENT CGD
M
A
B
C
1843
D
E
F
G
H
\I
I
.I
Fig 2. Reverse transcriptase-PCR for p67-phox cDNA. PCR products amplified with the five sets of primers (1/2, 3/4, 5/6, 7/8, and 9/10]
shown in Table 1. Lanes A and E,PCR product obtained with primer 1/2; lanes B and F,PCR product obtained with primer 3/4; lanes C and
G, PCR product obtained with primer 5/6; lanes D and H,PCR product obtained with primer 7/8; lanes I and J, PCR product obtained with
primer 9/10, Lanes A,B,C,D, and I, PCR products fromRNA prepared from controlEBV B cells; lanes E, F, G, H, and J, PCR products from RNA
prepared from patient's EBV B cells. Lane M, DNA size marker &X174/Hae 111 digest. PCR products were run on 1.5% gel (the left panel) and
3% gel (the rightpanel).
to be nucleotides 694 to 879, which correspond to the entire
sequence of exons 8 and 9 (Fig 3).
To investigate the cause of the deletion, genomic DNA
fragments of exons 8 and 9 and adjacent introns were amplified from the patient's cell line and compared with those of
a normal control. The PCR products fromthepatientand
control were found to be the same length. However, the PCR
product from the patient's specimen that includes the splice
junctions of exon 9 exhibited different mobility when singlestrand conformational polymorphism analysis was performed (data not shown). The results suggested the mutation
was located in the splice junction of exon 9. The fragment
including exon 8 or 9 was subcloned into TA cloning vector.
Patient
a
Each six clones were sequenced in full-length. As shown in
Fig 4, there is a G to A replacement at position + 1 of intron
9, the first base of the splice consensus sequence in the splice
doner site (5' splice site), which was found to be the sole
mutation in the fragment. Matching of splice donor and acceptor sequences to the consensus can be quantified using a
scoring system described by Shapiro and Senapathy.'" According to the formula they proposed, we calculated the
scores for the splice donor and acceptor sites of the p67phox gene to see if the point mutation found in the splice
donor site of intron 9 affected the matching score. As shown
in Table 2, the score of the donor site (5' splice site) of
intron 9 in normal p67-plrm is 82.7, whereas the G to A
mutationat + l in the CGD gene was64.6. The acceptor
a Control
cwnY
I
mmnY
A C G G G C A G G T A T G C A G
b
b Control
1
exon 7 exon 8
exon C)
I cxnn In
..CTCTGCAACCACAG,GCAGCTGAGCCTC.....TGlTCAACGGGCAG,AAGGGCCTTGlTC..
Patient
v
eson 7
Patient
A C
G
G
exnny
G C A
I
lnmnY
G[A]T
A
T
G C
A
G
e3'
I exon In
...GCCCCTCTGCAACCACAGAAGGGGClTGlTCCCT...
Fig 3. Sequence analysis of the p67-phoxcDNA. (a) This patient;
(b) alignment of the sequence of cDNA from control (upper)
and this
case (lower).
Fig 4. Sequence analysis of genomic DNA. (a) Control sequence
around theexon 9, intron 9 boundary; (b) sequence around theexon
9, intron 9 boundary from patient.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1844
AOSHIMA ET AL
Table 2. Scores for Splice Site Sequence for the p67-phox Gene
Donor Site
Intron 1
Intron 2
Intron 3
Intron 4
Intron 5
Intron 6
Intron 7
Intron 8
Intron 9
Intron 10
Intron 11
Intron 12
Intron 13
Intron 14
Intron 15
81.4
96.7
87.6
95.4
86.3
86.3
95.4
100.0
82.7 (64.6)
81 .o
96.7
80.1
90.9
88.9
92.2
Acceptor Site
88.1
95.0
78.2
85.9
87.4
81.4
71.2
96.9
81.6
93.0
98.6
91.6
87.7
97.0
84.4
The scores for splice acceptor site were calculated from nucleotide
sequences at the position from -14 to +l, and donor sites were
from the sequence at the position from -2 to +6. The formula was
proposed by Shapiro and Senapathy.”The score for aG to A mutation
at +l in intron 9 is given in parentheses.
site (3’ splice site)of intron 7 has a score of 71.2, the lowest
score among all donor and acceptor sites in p67-phox.
DISCUSSION
Sequenceanalysis of cDNA from a CGD patient with
p67-phox deficiency has shown that the patient’s mRNA for
this protein lacks a region between nucleotides 694 and 879.
The deleted nucleotides correspond to the entire sequence
of exons 8 and 9 in the gene and to aminoacid residues 231
to 293. Nevertheless, even though thedeletion was in-frame,
no protein was found in thepatient’s neutrophils or in EBVtransformed B-cell lines from the patient. The residues includeone of twoSrchomologysequence
3 consensus
regions (SH3; residues 245 to 295) and a part of the prolinerich sequence(residues227to
234)presentin
wild-type
p67-phox. It is knownthat the SH3domain binds to the
proline-rich sequence and the mutant protein may have lost
its stability due to a loss of these sequences. The sequences,
therefore, contributetoprotein stabilitythrough intra-or
intermolecular association of p67-phox with itself or with
other proteins such as p47-phox or p40-phox that contain
similar sequences.”-”
When sequence in the vicinity of exons 8 and 9 in p67phox genomic DNA was analyzed, a homozygous substitution of G to A at position + l of intron 9 was found as the
sole mutation. The results suggest that the mutated splice
donor site of intron 9 influenced site recognition and caused
skipping of the upstream exon(s). Point mutations affecting
splice donor sites often cause the loss of an entire upstream
exon.34 In the case of CGD, mutations located in the genes
for gp91-phox, p22-phox. and p67-phox that include nucleotide changes at positions + 1 or + 2 of the splice donor sites
of introns have been reported to cause the skipping of the
immediate
upstream
Decreased
interaction
of a
ribonucleoproteinparticle
involvedinsplicingwiththe
splice donor site of an intron may influence its binding to
the splice acceptor site of the preceding intron, resulting in
a skip of the intervening exon.”’
In the present case, both exons 8 and 9 were skipped due
to a point mutation at the splice donor siteof intron 9. Such
a mutation has been reported in only a limited
number of
cases. A point mutation caused by ultraviolet irradiation at
theacceptorsite ofintron 1 in the hypoxanthine-guanine
phophoribosyltransferase gene resulted in a loss of exons 2
and 3, or exon 2 alone.34 In maple syrup urine disease, the
E1P subunit of the branched-chain a-keto acid dehydrogenase (BCKDH) wasreported to have a point mutation at the
donor site of intron 5 that is responsible for the loss
of exons
5 and 6.” Most of the mRNA for BCKDH in this disease
lacked exon 5, but some normallyspliced and two exonskipped mRNA were also found.
Althoughthe mechanism of twoexonskipping
isnot
known, the low matching scores of the splicing sequences
to the consensus atthe acceptorsite of intron7 and the
mutated splice donorsite of intron 9in thepresent case seem
to affect site recognition. Shapiro and Senapathy” proposed
that such matching scores area useful wayto predictrecognition of the splice site. In the BCKDH case, matching scores
to the consensus at the mutated donor and the acceptor sites
of intron 5 were 70.4 and 78.1, respectively. In p67-phox
deficiency, the low scores of the acceptor site of intron 7
(71.2) and the mutated donor site of intron 9 (64.6) are as
low as that of themutatedsitein
the BCKDH case. The
splicing machinery may not be able to recognize sequences
with these low scores quite as well, resulting in the deletion
of one or more exons.
If actualsplice sites have alow score,othersequence
signals have been proposed that direct splicing in addition
to the splice junction sequence
signal^.^' These regulatory
elements, termedsplicing enhancers, arelocated downstream
and stimulate splicing efficiency for binding of the splicing
machinery. Since theacceptor site ofintron7has
a very
lowscore in thepresent case, it is possiblethatsuch
an
enhancer element is present downstream, but is affected by
the mutation at the splice donor site of intron 9 or by exon 9
skipping. In addition to the splice site sequences andpossible
enhancer sequence, the size of an exon seems to influence
exon skipping.” Exon 8 of the p67-phox gene has only 44
bases, andthis small size may also contribute to the skipping
of this exon. Further studiesmay help clarify the unusual two
exon skipping mechanism that led to CGD in this patient.
REFERENCES
1. Smith M, Cumutte T: Molecular basis of chronic granulomatous disease. Blood 77:673, 1991
2. Kobayashi S, Imajoh-Ohmi S, Kuribayashi F, Nunoi H, Nakamura M, Kanegasaki S: Characterization of the superoxide-generating system in human peripheral lymphocytes and lymphoid lines. J
Biochem 117:758, 1995
3. Makino R, Tanaka T, lizuka T, Ishirnura Y, Kanegasaki S:
Stoichiometric conversion of oxygen to superoxide anion during the
respiratory burst in neutrophile. J Biol Chem 261:11444, 1986
4. Nunoi H, Rotrosen D, Gallin JI, Malech HL: Two forms of
autosomal chronic granulomatous disease lack distinct neutrophil
cytosol factors. Science 242:1298, 1988
S . Rotrosen D, Yeung CL, Katkin JP: Production of recombinant
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
TWO EXON SKIPPING IN PB~-~~OX-DEFICIENT
CGD
cytochrome bSssallows reconstitution of the phagocyte NADPH oxidase solely from recombinant proteins. J Biol Chem 268:14256,
1993
6. Segal AW, West I, Wientjes F, Nugent JH, Chavan AJ, Haley
B, Garcia RC, Rosen H, Scrace G: Cytochrome b-245 is a flavocytochrome containing FAD and the NADPH-binding site of themicrobicidal oxidase of phagocytes. Biochem J 284:781, 1992
7. Roos D: The genetic basis of chronic granulomatous disease.
Immunol Rev 138:121, 1994
8. Royer PB, Kunkel LM, Monaco AP, Goff SC, Newburger PE,
Baehner RL, Cole FS, Curnutte JT, Orkin SH: Cloning the gene for
an inherited human disorder-chronic granulomatous disease-on
the basis of its chromosomal location. Nature 322:32, 1986
9. Teahan C, Rowe P, Parker P, Totty N, Segal AW: The Xlinked chronic granulomatous disease gene codes for the beta-chain
of cytochrome b-245. Nature 327:720, 1987
IO. Rotrosen D, Yeung CL, Let0 TL, Malech HL, Kwong CH:
Cytochrome b5s8: The flavin-binding component of the phagocyte
NADPH oxidase. Science 256:1459, 1992
11. Parkos CA, Allen RA, Cochrane CC, Jesaitis AJ: Purified
cytochrome b from human granulocyte plasma membrane is com,O
O
prised of two polypeptides with relative molecular weights of 91O
and 22,000. J Clin Invest 80:732, 1987
12. Parkos CA, Dinauer MC, Walker LE, Allen RA, Jesaitis AJ,
Orkin SH: Primary structure and unique expression of the 22-kilodalton light chain of human neutrophil cytochrome b. Roc Natl Acad
Sci USA 85:3319, 1988
13. Lomax KJ, Leto TL, Nunoi H, Gallin JI, Malech H L Recombinant 47-kilodalton cytosol factor restores NADPH oxidase in
chronic granulomatous disease [published erratum appears in Science 246:987, 19891. Science 245:409, 1989
14. Let0 TL, Lomax U,Volpp BD, Nunoi H, Sechler JM,
Nauseef WM, Clark RA, Gallin JI, Malech HL: Cloning of a 67kD neutrophil oxidase factor with similarity to a noncatalytic region
of p6Oc-src. Science 248:727, 1990
15. Kenney RT, Malech HL, Epstein ND, Roberts RL, Let0 TL:
Characterization of the p67-phox gene: Genomic organization and
restriction fragment length polymorphism analysis for prenatal diagnosis in chronic granulomatous disease. Blood 82:3739, 1993
16. Abo A, Pick E, Hall A, Totty N. Teahan CC, Segal AW:
Activation of the NADPH oxidase involves the small GTP-binding
protein p2lracl. Nature 353:668, 1991
17.KnausUG, Heyworth PG, Evans T, Curnutte JT, Bokoch
GM: Regulation of phagocyte oxygen radical production by the .
GTP-binding protein Rac 2. Science 254:1512, 1991
18. Didsbury J, Weber RF, Bokoch GM, Evans T, Snyderman R:
rac, a novel ras related family of proteins that are botulinum toxin
substrates. J Biol Chem 264:16378, 1989
19. Volpp BD,NauseefWM, Donelson JE, Moser DR, Clark
RA: Cloning of the cDNA and functional expression of the 47kilodalton cytosolic component of human neutrophil respiratory
burst oxidase. Proc Natl Acad Sci USA 86:7195, 1989
20. Clark R, Malech H, Gallin J, Nunoi H, Volp B, Pearson D,
Nauseef W, Curnutte J: Genetic variants of chronic granulomatous
disease: Prevalence of deficiencies of two cytosolic components of
NADPH oxidase system. N Engl J Med 321547, 1989
21. Casimir CM, Chetty M, Bohler MC, Garcia R, Fischer A,
Griscelli C, Johnson B, Segal AW: Identification of the defective
NADPH-oxidase component in chronic granulomatous disease: A
study of 57 European families. Eur J Clin Invest 22:403, 1992
22. Casimir CM, Bu-Ghanim HN, Rodaway AR, Bentley DL,
Rowe P, Segal AW: Autosomal recessive chronic granulomatous
disease caused by deletion at a dinucleotide repeat. Proc Natl Acad
Sci USA 88:2753, 1991
1845
23. Volpp BD, Lin Y:In vitro molecular reconstitution ofthe
respiratory burst in B lymphoblasts from p47-phox-deficient chronic
granulomatous disease. J Clin Invest 91:201, 1993
24. Iwata M, Nunoi H, Yamazaki H, Nakano T, Niwa H,Tsuruta
S, Ohga S, Ohmi S, Kanegasaki S , Matsuda I: Homologous dinucleotide (GT or TG) deletion in Japanese patients with choronic granulomatous disease with p47-phox deficiency. Biochem Biophys Res
Commun 199:1372, 1994
25. Chanock SJ, Barrett DM, Curnutte JC, Orkin SH: Gene structure of the cytosolic component, phox-47 and mutations in autosomal
recessive chronic granulomatous disease. Blood 78:165a, 1991
(abstr, suppl 1)
26. Nunoi H, Iwata M, Tatsuzawa S, Onoe Y, Shimizu S, Kanegasaki S, Matsuda I: AG dinucleotide insertion in a patient with chronic
granulomatous disease lacking cytosolic 67-kD protein. Blood
86:329, 1995
27. de Boer M, Hilarius SP, Hossle JP, Verhoeven AJ, Graf N,
Kenney RT, Seger R, Roos D:,Autosomal recessive chronic granulomatous disease with absence of the 67-kD cytosolic NADPH oxidase
component: Identification of mutation and detection of carriers.
Blood 83531, 1994
28. Tanugi-Cholley LC, Issartel J, Lunardi J, Freycon F, Morel
F, Vignais PV: A mutation located at the 5’ splice junction sequence
of intron 3 in the p67-phox gene causes the lack of p67-phox mRNA
in a patient with chronic granulomatous disease. Blood 85:242, 1995
29. Shapiro MB, Senapathy P: RNA splice junctions of different
classes of eukaryotes: Sequence statistics and functional implications
in gene expression. Nucleic Acids Res 15:7155, 1987
30. Hongyo T, Buzard GS, Calvert RJ, Weghorst M: ‘Cold
SSCP’: A simple, rapid and non-radioactive method for optimized
single-strand conformation polymorphism. Nucleic Acids Res
21:3637, 1993
31. Uhlinger DJ, Tyagi SR, Inge U, Lambeth JD: p67-phox
enhances the binding of p47-phox to the human neutrophil respiratory burst oxidase complex. J Biol Chem 269:22095, 1994
32. Sumimoto H, Kage Y, Nunoi H, Sasaki H, Nose T, Fukumaki
Y, Ohno M, Minakami S, Takeshige K: Role of Src homology 3
domains in assembly and activation of the phagocyte NADPH oxidase. Proc Natl Acad Sci USA 915345, 1994
33. de Mendez I, Garrett M, Adams A, Let0 T: Role of p67-phox
SH3 domains in assembly of the NADPH oxidase system. J Biol
Chem 269:16326, 1994
34. Steingrimsdottir H, Rowley G, Dorado G, Cole J, Kehmann
A: Mutations which alter splicing in the human hypoxanthine-guanine phosphoribosyltransferase gene. Nucleic Acids Res 20: 1201,
1992
35. de Boer M, Bolscher BC, Dinauer MC, Orkin SH, Smith CI,
Ahlin A, Weening RS, Roos D: Splice site mutations are a common
cause of X-linked chronic granulomatous disease. Blood 801553,
1992
36. de Boer M, de KA, Hossle JP, Seger R, Corbeel L, Weening
RS, Roos D: Cytochrome bSs8-negative,autosomal recessive chronic
granulomatous disease: Two new mutations in the cytochrome bSss
light chain of the NADPH oxidase (p22-phox). Am J Hum Genet
51:1127, 1992
37. Hayashida Y, Mitsubuchi H, lndo Y,Ohta K, Endo F, Wada
Y, Matsuda I: Deficiency of the E10 subunit in the branched-chain
cy-keto acid dehydrogenase complex due to a single base substitution
ofthe intron 5 , resulting in two alternatively spliced mRNAsin
a patient with maple syrup urine disease. Biochim Biophys Acta
1225:317, 1995
38. Watanabe A, Tanaka K, Shimura Y: The role of exon sequences in splice site selection. Genes Dev 7:407, 1992
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1996 88: 1841-1845
Two-exon skipping due to a point mutation in p67-phox--deficient
chronic granulomatous disease
M Aoshima, H Nunoi, M Shimazu, S Shimizu, O Tatsuzawa, RT Kenney and S Kanegasaki
Updated information and services can be found at:
http://www.bloodjournal.org/content/88/5/1841.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.