Download Tubulin folding is altered by mutations in a putative GTP binding motif

Journal of Cell Science 109, 1471-1478 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
JCS3328
1471
Tubulin folding is altered by mutations in a putative GTP binding motif
Juan C. Zabala1,*, Ana Fontalba1 and Jesus Avila2
1Departamento de Biologia Molecular, Facultad de Medicina, Universidad de Cantabria, Spain
2Centro de Biologia Molecular, Facultad de Ciencias, Universidad Autonoma de Madrid (CSIC-UAM),
Spain
*Author for correspondence (e-mail: [email protected])
SUMMARY
Tubulins contain a glycine-rich loop, that has been implicated in microtubule dynamics by means of an intramolecular interaction with the carboxy-terminal region. As a
further extension of the analysis of the role of the carboxyterminal region in tubulin folding we have mutated the
glycine-rich loop of tubulin subunits. An α-tubulin point
mutant with a T150rG substitution (the corresponding
residue present in β-tubulin) was able to incorporate into
dimers and microtubules. On the other hand, four βtubulin point mutants, including the G148rT substitution,
did not incorporate into dimers, did not release monomers,
but were able to form C900 and C300 complexes (intermediates in the process of tubulin folding). Three other
mutants within this region (which approximately encompasses residues 137-152) were incapable of forming dimers
and C300 complexes but gave rise to the formation of C900
complexes. These results suggest that tubulin goes through
two sequential folding states during the folding process,
first in association with TCP1-complexes (C900) prior to
the transfer to C300 complexes. It is this second step that
implies binding/hydrolysis of GTP, reinforcing our
previous proposed model for tubulin folding and
assembly.
INTRODUCTION
stacked rings of 8 non-identical subunits (Lewis et al., 1992;
Kubota et al., 1994, 1995). Recently, TCP1 particles have been
implicated in actin and tubulin folding (Frydman et al., 1992;
Gao et al., 1992; Melki et al., 1993; Rommelaere et al., 1993;
Sternlicht et al., 1993; Yaffe et al., 1992). Additionally, TCP1containing chaperonin forms a binary complex with completely unfolded actin or tubulin expressed in E. coli (Gao et
al., 1992, 1993).
Folding of tubulins follows a complex pathway in which
different multimolecular complexes (termed C900 and C300)
have been implicated (Zabala and Cowan, 1992; Yaffe et al.,
1992; Fontalba et al., 1993, 1995; Campo et al., 1994; Fig. 1).
Soon after tubulin is synthesized it is bound to a TCP-1-containing chaperone particle (C900). Pulse-chase experiments
have shown that, in the presence of nucleotides tubulin dimers
and release factors, the disappearance of C900 complexes is
correlated with the formation of C300 complexes and
monomers and ultimately with the formation of tubulin dimers
(Campo et al., 1994). Recently, we have purified a molecular
chaperone named p14 responsible of the release of monomers
from C300 complexes (Campo et al., 1994). This protein, p14
(or a closely related protein, cofactor A) has also been identified as a factor that facilitates release of tubulin monomers
from the TCP1 complex by modulating the ATPase activity of
its cognate chaperonin (Gao et al., 1994), though the interaction of cofactor A with CCT complexes has not been
confirmed. Thus, p14 seems to have a pleiotropic role and is
important for tubulin subunit folding, via the TCP1 complex,
and via the C300 complex.
Protein folding in the cell is an intricate process that often
requires the assistance of preexisting proteins collectively
known as molecular chaperones (Ellis and van der Vies, 1991;
Georgopoulos and Welch, 1993; Craig et al., 1994; Morimoto
et al., 1994). Two major groups of heat-shock proteins are
established as molecular chaperones: the Hsp70 and the Hsp60
(or chaperonin) families. The chaperonin family is conserved
in all organisms. The first discovered chaperonin, more than
twenty years ago, was GroEL (Georgopoulos et al., 1973).
High-resolution crystal structures of GroEL have recently been
obtained (Braig et al., 1994). They show a porous cylinder of
14 subunits made of two heptameric rings. Also, an extensive
mutational analysis of GroEL has been reported (Fenton et al.,
1994). This analysis identified a putative polypeptide-binding
domain that is essential for binding of the co-chaperonin
GroES, which is required for productive polypeptide release.
GroEL in Escherichia coli, Hsp60 in mitochondria and
Rubisco-subunit binding protein (RBP) in chloroplasts having
similar primary and quaternary structures have been called
group I chaperonins (Willison and Kubota, 1994). Recently a
second group (group II) of chaperonins has been discovered in
archaebacteria and eukaryotes. They are significantly related to
the group I chaperonins (Kubota et al., 1994, 1995). The
eukaryotic cytosol contains TCP1-complexes, also called CCT,
TRiC or cytosolic chaperonin (Lewis et al., 1992; Frydman et
al., 1992; Gao et al., 1992). TCP1 is a 60 kDa subunit of the
cytosolic hetero-oligomeric chaperonin consisting of two
Key words: Native electrophoresis, Tubulin folding, GTP-binding,
Site-directed mutant
1472 J. C. Zabala, A. Fontalba and J. Avila
RF?
Mg
PU
UT
CCT
Mg
PT
ATP
AA
AA,AA
AA
RF (p14,?)
2+
GTP
ADP
C 300
2+
GDP
M, D
Fig. 1. Folding and incorporation of newly synthesized tubulin into
dimers. Newly synthesized (unfolded, UT) tubulin forms a binary
complex with CCT particles containing different subunits of TCP-1
related proteins. Tubulin subunits (prefolded, PT) released from CCT
particles form complexes of about 300 kDa (C300). p14 chaperone
releases β-tubulin monomers (M) from C300 complexes and dimer
(D) formation is dependent on GTP hydrolysis, Mg2+ ions and other
unidentified release factors (RF).
Tubulins are GTP-binding proteins (Jacobs et al., 1974;
Weisenberg et al., 1976). β-tubulin is a GTPase, while αtubulin has no enzyme activity (Carlier, 1982). Tubulins have
an invariant region rich in glycines that is found in α-, β-, and
γ-chains and which is presumed to form a phosphate-binding
loop (Burns, 1995). The consensus phosphate binding site
(GXXXXGK) common to all non-tubulin GTP-binding
proteins does not occur in the forward direction (aminocarboxy) in the sequence of either α- or β-tubulin though it is
present in the backward direction (Sternlicht et al., 1987).
Davis et al. (1994) have shown that this region encompassing
amino acids 103-109, a highly conserved region of β-tubulins,
participates in GTP-binding and hydrolysis. A critical feature
of the phosphate binding sequence in non-tubulin NTP-binding
proteins is that it is contained in a glycine-rich loop that
contains a carboxy-terminal lysine residue (Möller and Amons,
1985). Computational analysis of α- and β-tubulin sequences
shows both to contain in the forward direction another glycinerich region, commonly observed in NTP-binding proteins
(each of which has the highest probability of forming a looped
structure); however, in neither case does the sequence contain
the lysine residue characteristic of the phosphate loops of nontubulin NTP-binding proteins. It is therefore unclear whether
this probable loop constitutes a phosphate binding site in
tubulins. The recent observation that a segment of the bacterial
FtsZ protein matches very well with the glycine-rich region in
tubulins supports its GTP-binding function. FtsZ is an essential
cell division protein in E. coli; it is a GTPase and it forms a
dynamic structure at the division site under cell cycle control
(de Boer et al., 1992; RayChaudhuri and Park, 1992). The systematic mutational analysis carried out on the yeast β-tubulin
gene has shown that the lethal substitutions are located in three
regions of the protein. One of these regions is the glycine rich
loop. Lethal alleles identify regions presumably more critical
for β-tubulin function (Reijo et al., 1994). Furthermore, it has
been discussed that a mutation in this putative phosphate
binding motif both reduces GTP binding and suppresses microtubule dynamics. For these reasons, Sage et al. (1995)
concluded that β-tubulin possesses a cryptic GTPase superfamily motif (GXXXXGK) as well a glycine-rich phosphate
binding motif (GGGTGSG). These results support the suggestion that this glycine-rich region is involved in the interaction
of tubulin with GTP (Burns, 1995).
It has previously been shown that incorporation of tubulin
subunits into tubulin dimers from C300 complexes and/or
monomers requires GTP hydrolysis (Fontalba et al., 1993).
Also, GTP is required for the stabilization of the monomeric
form once released, but incubation of C300 complexes with
GTPγS (a non-hydrolyzable GTP analog) prior to the addition
of purified p14 protein completely preclude the release of
monomers. Thus, it seems that GTP hydrolysis is required to
get monomers released from C300 complexes, as suggested by
pulse-chase experiments (Campo et al., 1994). These points
lead to the intriguing hypothesis that the hydrolysis required
for the folding of the native β-tubulin is an intrinsic property
of the β-tubulin protein. Since α-tubulin is a GTP-binding
protein that probably does not hydrolyze GTP (Carlier, 1982),
it would be possible to test this hypothesis by comparing the
effects on the folding process of equivalent mutations in α- and
β-tubulins.
Padilla et al. (1993) have proposed that in β-tubulin an
intramolecular interaction between the C terminus and the
putative GTP-binding loop may regulate the dynamic instability of microtubules. Deletion of the carboxy terminus of βtubulin slows down their dimerization rates. The C terminus is
important for the folding process itself facilitating the folding
of the nascent polypeptide, although proper folding takes place
in molecules lacking the C terminus (Fontalba et al., 1995).
Thus, we have proposed that the interaction of the GTP binding
region with the C terminus could stabilize the folded GTPbinding site during the whole process that ends with the
formation of the tubulin dimer. To test these hypotheses,
different mutated forms in the putative GTP-binding motif
were studied in relation to their coassembly properties and the
ability to form the different molecular forms that are found
during the folding and dimerization processes.
MATERIALS AND METHODS
Materials
Reticulocyte extracts were obtained from Promega, [35S]methionine
(>1,000 Ci/mmol) from Amersham, GTP and m7G(5′)ppp(5′) from
Boehringer Mannheim or Serva, and some of the oligonucleotides
from Isogen Bioscience (Amsterdam).
Generation of expression plasmids containing sitedirected mutations
To generate site-directed mutants of β1- or α4-tubulin, different
restriction fragments containing sequences encoding wild-type β1
and α4 tubulin (Wang et al., 1986; Villasante et al., 1986) were
isolated and cloned into M13 vectors. Briefly, a 0.84 kb BalI-SacI
fragment encoding internal sequences of β1 was isolated and cloned
into bacteriophage M13mp19 DNA digested with SmaI and SacI.
Oligonucleotide-directed changes (Table 1) were introduced using
the method of Kunkel (1985). Subcloned 0.75 kb AatII-SacI
fragments containing the site-directed changes were substituted for
wild-type β1-tubulin sequences contained in the β1-pSV expression
plasmid (Fig. 2). The correct substitution of fragments containing a
single amino acid change was confirmed by restriction analysis
using the appropriate enzyme for which a site was created or
destroyed and sequence analysis of the final construct. In the case
of double mutants β1M147K/G148T and β1M147F/G148T (Table
1), the 0.75 kb AatII-SacI fragments were substituted for β1K147
tubulin sequences contained in the β1K147-pSV expression plasmid.
The correct substitution of fragments containing two amino acid
changes was confirmed by restriction analysis with AvaI and
Site-directed mutagenesis of tubulins 1473
Table 1. Single and double amino acid substitutions introduced into β1- and α4-tubulins
Oligonucleotide primers (5′-3′)
*CCATGC(C/A)TGAG(C/G)CCGTGC(C/G)T(C/T)CACCCA
”
GAGCAGGGTGCCCTTGCCCGAGCCCGTGCC
GAGCAGGGTGCCAAAGCCCGAGCCCGTGCC
GAGCAGGGTG(G/C)TCATGCCCGAGCCCGTGCC
”
CATGAGCAGGCTGCCCATGCCCGAGCCCGTGCC
CATGAGCAGGGTGGTCTTGCCTGAGCCCGTGCC
CATGAGCAGGGTGGTAAAGCCTGAGCCCGTGCC
CAGCAGAGAGC(T/C)GAAGCCAGAGCC
”
CAGCAGAGAGGTC(T/A)TGCCAGAGCCGGT
”
Complementary
sequence (nt)
Mutations
416-442
”
424-453
”
”
”
424-456
”
”
436-459
”
433-459
”
β1G141E
β1G146C
β1M147K
β1M147F
β1G148S
β1G148T
β1T149S
β1M147K/G148T
β1M147F/G148T
α4T150G
α4T150S
α4F149K
α4F149M
Nucleotide changes were introduced into the cDNAs encoding murine wild-type β1- and α4 tubulin isotypes by site-directed mutagenesis (see Materials and
Methods). Oligonucleotides used and their complementary coding sequences are shown. Several oligonucleotides were synthesized with ambiguities to obtain
several mutants from each. Nucleotides in brackets mean 50% each. The first oligonucleotide (*) was used to produce several mutants from which only β1G141E
and β1G146C were used in this work. Nucleotide changes introduced to produce amino acid substitutions appear in bold. Nucleotide changes that created or
destroyed a restriction site without an amino acid substitution were introduced in some cases and appear underlined (see Materials and Methods).
Fig. 2. Construction of mutant β1
cDNA-containing plasmids.
The BalI-SacI fragment of β1 was
cloned into M13mp19 DNA
digested with SmaI and SacI.
Oligonucleotide changes (Table
1) were introduced using the
method of Kunkel (1985).
Subcloned AatII-SacI fragments
were substituted for wild-type β1sequences previously cloned into
the pSV-expression plasmid.
These constructs were used for in
vivo copolymerization
experiments (see Materials and
Methods). In the case of double
mutants (Table 1) these fragments
were substituted for β1K147sequences (see Materials and
Methods). In order to carry out
the in vitro experiments, mutant
sequences contained in the pSV
expression plasmid were isolated
and cloned into the SP6-plasmid
pSP64. Restriction sites: L (BalI),
A (AatII), S (SacI), H (HindIII), E
(EcoRI) and M (SmaI). The
arrowhead indicates the position
at which nucleotide changes were
introduced.
1474 J. C. Zabala, A. Fontalba and J. Avila
sequence analysis of the final construct. To generate equivalent constructs under the control of the SP6 promoter, the 1.3 kb HindIIIEcoRV fragments with either single or double amino acids changes
were substituted for wild-type or β1K147 tubulin sequences
contained in the SP6-plasmid pSP64.
To create equivalent constructs of α4 mutants, 0.5 kb BamHI-PstI
and 0.6 kb EcoRI-SphI fragments encoding internal sequences of α4
were isolated and cloned into bacteriophage M13mp18 DNA digested
with BamHI-PstI or EcoRI-SphI. Oligonucleotide-directed changes
(Table 1) were introduced using the method of Kunkel (1985).
Subcloned fragments containing the site-directed changes were substituted for wild-type α4-tubulin sequences contained in the α4-pSP64
expression plasmid. The correct substitution of fragments containing
each amino acid change was confirmed by restriction analysis and
sequence analysis of the final construct.
Non-coupled in vitro transcription and translation
cDNAs encoding wild-type or mutant α4- and β1-tubulins (Lewis et
al., 1985; Villasante et al., 1986; Wang et al., 1986) cloned into SP6
vectors were used as templates for in vitro transcription (Melton et
al., 1984). Plasmids were linearized with ScaI, PvuI or HindIII and
transcribed in vitro using SP6 RNA polymerase in the presence of
m7G(5′)ppp(5′). Transcribed mRNAs were translated in a rabbit reticulocyte cell-free system (Pelham and Jackson, 1976) in the presence
of [35S]methionine (Amersham; >1,000 Ci/mmol) for 1 hour at 30°C.
β-TUBULIN
E
140
Other techniques
Purified brain tubulin was prepared by consecutive passages through
phosphocellulose and cation-exchange FPLC as described (Zabala
and Cowan, 1992; Fontalba et al., 1993). Copolymerization of in vitro
synthesized wild-type and mutant tubulins with microtubule proteins
were performed essentially as previously described (Zabala and
Cowan, 1992; Fontalba et al., 1995). Native gel electrophoresis was
carried out as previously described (Zabala and Cowan, 1992;
Fontalba et al., 1993, 1995; Campo et al., 1994).
RESULTS
Analysis of in vitro synthesized site-directed α- and
β-tubulin mutants
Fontalba et al. (1993, 1995) proposed a general pathway for
tubulin folding and dimer assembly (Fig. 1). In this model,
newly synthesized tubulin forms a complex with the chaperonin
TCP-1 before it is transferred to C300 complexes as intermedi-
GGGTGSGMGT
149
K-T
F-T
100
200
300
400
AA
AA
C
N
α-TUBULIN
MG
KS
142
GGGTGSGFT(A)S 151
100
N
Transfection of cultured cells and immunofluorescence
analyses
Adherent HeLa cells or BSC-1 monkey fibroblast cells free of
mycoplasma contamination were grown on glass coverslips placed on
Petri dishes in Dulbecco’s modified Eagle medium containing 10%
defined calf serum. The cells were transfected by calcium phosphate
precipitation with pSV vectors (Mulligan and Berg, 1981) containing
full-length cDNAs encoding either wild-type β1-tubulin (Wang et al.,
1986) or site-directed mutants.
Forty-eight hours after transfection, cells were fixed, permeabilized
and analyzed by double label indirect immunofluorescence (Osborn
and Weber, 1982) using the rabbit β1-specific antibody (Lewis and
Cowan, 1988) (to detect the expression of transfected sequences)
together with a guinea pig anti-α-tubulin antibody (to detect
endogenous α-tubulin isotypes). Visualization was done after incubation with the secondary antibodies, FITC-conjugated goat antirabbit IgG (Boehringer Mannheim) and rhodamine-conjugated goat
anti-guinea pig IgG (Cappel). Cells were viewed with an immunofluorescence microscope using a Zeiss Plan-Neofluar ×63 objective and
photographed.
FT
C KS S
200
300
400
AA
AA
C
Fig. 3. Site-directed mutagenesis in the glycine rich loop. Diagrams
for murine α- and β-tubulins show the glycine-rich loop as a black
box. Hatched regions illustrate the divergent carboxy-terminal
domain. Dotted regions represent one of the most conserved regions
present in tubulins close to the carboxy terminus. The white box at
the amino terminus of β-tubulin denote the position of first four
aminoacids implicated in an autoregulatory mechanism (Pachter et
al., 1987). Amino acid numbers are shown as superscripts. Sitedirected changes are shown both in α- and β-tubulins (summarized
in Table 1). All of them contain single amino acid changes except FT and K-T, which contain double amino acid changes. Shaded
symbols represent mutant β-tubulins that stop in the C900 step of the
folding process. Outline symbols represent mutant β-tubulins that
stop after the C300 step. Unmodified symbols represent mutant
proteins that behave as wild-type tubulins. The shadowed symbol in
α-tubulin represents the altered mutant described in the text. Amino
acid sequences are presented in the one letter code.
ates in the assembly of the heterodimer. Tubulin is a GTPbinding protein (Jacobs et al., 1974) that, in the absence of GTP,
quickly loses its functional conformation. Thus, tubulin should
bind GTP during its folding process. We have used site-directed
mutagenesis to study the effect of mutations of the GTP binding
site in the formation of the different multimolecular complexes,
monomers and dimers, which takes place during the folding
process. We constructed several site-directed mutations within
the glycine-rich loop, which approximately encompasses
residues 137-152, and are indicated in Fig. 3.
We first analyzed the products of in vitro translation of αand β-tubulin mutants by electrophoresis in an SDS-polyacrylamide gel. Under these denaturing conditions, each
polypeptide has a mobility indistinguishable from the mobility
of the corresponding native tubulin, or from in vitro translated
wild-type α- or β-tubulins (data not shown). Fig. 4 shows the
analysis of nine β-tubulin and four α-tubulin different mutants
under non-denaturing conditions and in the presence of GTP.
All of the α4-tubulin mutants except one (α4F149K) gave a
Site-directed mutagenesis of tubulins 1475
Fig. 4. Analysis of altered α- and β-tubulins under non-denaturing
electrophoresis. Translation products analyzed by electrophoresis
under non-denaturing conditions through 7% (A) and 4.5% (B)
polyacrylamide gels. C900, C300, D and M denote the position of
different multimolecular complexes, dimers and monomers,
respectively.
pattern indistinguishable from that of wild-type α4-tubulin. In
the case of mutant α4F149K, the dimeric band characteristic
of wild-type α4-tubulin (Zabala and Cowan, 1992) was not
observed, suggesting that this mutation interferes with the
ability to fold and dimerize and thus to incorporate into microtubules. Beta-tubulin mutants β1M147K, β1G148S, β1G148T
and β1M147F/G148T result in a similar pattern. In each of
these mutants, neither of the two faster migrating bands
(monomers and dimers) characteristic of wild-type β-tubulin
was observed. The bands corresponding in mobility to the
most prominent bands characteristic of wild-type β1-tubulin
(C300) are also evident. β1G141E, β1G146C and
β1M147K/G148T mutants gave neither the bands corresponding to monomers and dimers nor the ones corresponding to C300 complexes. Finally, other mutants (β1M147F and
β1T149S), gave patterns indistinguishable from those of wildtype β-tubulin. To address if those mutants that behave differently from the wild-type β-tubulin give the band corresponding to the complex with TCP-1 (C900), aliquots of in
vitro translation reactions were analyzed on 4.5% polyacrylamide gels (Fontalba et al., 1993). All mutants that gave rise
to the formation of C300 complexes form C900 complexes too
(data not shown). Fig. 4B shows the analysis of mutants
β1G141E, β1G146C, and β1M147K/G148T in which the
Fig. 5. Analysis of the coassembly properties of site-directed mutants
of β1- and α4-tubulins. (A and B) Coassembly experiments with
altered tubulin β1G148T. (C and D) Coassembly experiments with
mutant tubulin β1T149S. E and F show coassembly experiments with
altered tubulin α4T150G. (G and H) Corresponding coassembly
experiments with mutant tubulin α4F149K. Aliquots containing the
same amount of total protein from two consecutive and complete
cycles of assembly/disassembly were analyzed in two ways: by SDSpolyacrylamide gel electrophoresis (data not shown), and by nondenaturing gel electrophoresis in the presence of GTP (see Materials
and Methods). (A,C,E,G) Gels were stained with Coomassie blue;
(B,D,F,H) autoradiograms of the same gels as in A, C, E and G,
respectively. Tracks: T, aliquots of the in vitro translation reactions;
S1 and S2, supernatants after the first and second cycles; P1 and P2,
pellets from the first and second cycles; C and D indicate the position
of C300 complexes and dimers, respectively, after non-denaturing
electrophoresis.
presence of the band characteristic of C900 complexes can be
observed but not the one corresponding to the other molecular
forms. These results support our previous suggestion that the
formation of the C300 complexes occurs after tubulin is
released from TCP-1-complexes (Fontalba et al., 1993).
Coassembly properties of in vitro synthesized βtubulin mutants
To assess the ability with which mutant tubulin polypeptides
incorporate into microtubules in vitro, we performed two
complete cycles of assembly/disassembly with added bovine
brain microtubules in vitro (Fig. 5). The products generated
were analyzed by electrophoresis under denaturing (data not
1476 J. C. Zabala, A. Fontalba and J. Avila
shown) and native conditions. The results found were
analogous for all the polypeptides that behave similarly when
analyzed by electrophoresis under native conditions. All
mutants which gave rise to the formation of the different
molecular species were capable of incorporating as dimers into
microtubules in vitro (i.e. β1T149S and α4 T150G; Fig. 5D,F);
in a similar fashion to that of the wild-type β1 or α4-tubulin
isotypes (data not shown). Mutants that cannot form the corresponding molecular forms were not incorporated into microtubules (i.e. β1G148T and α4F149K; Fig. 5B,H).
Expression of wild-type and mutant β-tubulin
proteins in vivo
To assess the ability of tubulin mutants to form heterodimers
and to coassemble into microtubules in vivo, each mutation was
introduced into sequences encoding a β-tubulin isotype, β1
(Wang et al., 1986). This isotype is not normally expressed in
tissue culture cells, but is freely incorporated into all microtubules in these cells without effect on cell growth or viability
when expressed from transfected DNA constructs (Lewis et al.,
1987). The mutant tubulin cDNAs were cloned into an
expression vector, and the expression of transfected DNAs was
monitored by indirect double label immunofluorescence using
tubulin isotype-specific antisera (Lewis and Cowan, 1988; Gu
et al., 1988) that distinguish the expression of introduced DNA
from endogenously expressed tubulin genes. Data from such
experiments are shown in Fig. 6. Mutants that gave a normal
pattern when analyzed by non-denaturing electrophoresis (Fig.
4) or coassembled into microtubules in vitro (Fig. 5) coassembled in vivo to give a microtubule pattern that was essentially
identical to that detected using a general α-tubulin antibody
(e.g. Fig. 6A,B). On the other hand, several mutants (β1G141E,
β1G146C, β1M147K, β1G148S, β1G148T, β1M147F/G148T
and β1M147K/G148T) gave either a pattern of diffuse punctate
spots (Fig. 6D) or cytoplasmic aggregates (Fig. 6F). In either
case, these patterns differ radically from the normal microtubule
network present in the transfected cells (Fig. 6C,E). These
results are consistent with the data obtained from in vitro experiments, which showed that these mutants behave differently on
non-denaturing gels (Fig. 4) and on the in vitro copolymerization experiments (Fig. 5) from wild-type β1 as well as from all
other mutants tested. Furthermore, the altered polypeptides are
not colocalized with α-tubulin in vivo in the double label experiments (Fig. 6C,E). Therefore, it seems probable that these
Fig. 6. Coassembly properties of β-tubulin mutants.
(A,C,E) General α-tubulin antibody. (B,D,F) Fields
identical to A,C,E, respectively, stained with the
isotype-specific anti-β1-tubulin antibody (Lewis et al.,
1987). (B) Phenotype (in HeLa cells) of wild-type β1tubulin. Note the presence of an untransfected cell
that labels with the general anti-α-tubulin antibody
(A, arrowed) but not with the anti-β1-specific
antibody (B). (D and F) Phenotypes of mutants
β1G141E (in BSC-1 cells) and β1G146C (in HeLa
cells) (see Table 1). Cells were analyzed by double
label indirect immunofluorescence (Osborn and
Weber, 1982) using the rabbit β1-specific antibody
(Lewis and Cowan, 1988) (to detect the expression of
transfected sequences) and a general guinea pig antiα-tubulin antibody (to detect endogenous α-tubulins).
Bar, 20 µm.
Site-directed mutagenesis of tubulins 1477
mutant β-tubulins are incapable of forming heterodimers with
any endogenous α-tubulin isotype, in vivo.
DISCUSSION
Tubulin is a GTP-binding protein (Jacobs et al., 1974; Weisenberg et al., 1976) composed of two subunits (α and β). GTP
binds to both subunits but whereas the β-subunit could interchange the bound GTP with exogenous nucleotides, a tight nonexchangeable binding was observed for the tubulin α-subunit.
Thus, it is conceivable that tubulin subunits bind GTP during
their folding process (probably in a different way for each
subunit), in a process that occurs by the formation of different
multimolecular complexes, in addition to monomers and dimers.
The interaction of tubulin with the chaperone particle containing TCP-1 appears to be a fast initial step in the folding
process (Yaffe et al., 1992; Campo et al., 1994). This particle
seems to contain, in addition to TCP-1 related proteins (Kubota
et al., 1994), two Hsp70 proteins (Lewis et al., 1992). Different
chaperones assist in the folding of other unrelated proteins
along complicated pathways from the unfolded state to the final
correctly folded protein (Ellis and van der Vies, 1991). Hsp70
has been involved in binding to microtubules at the carboxy
terminus of tubulin, like other microtubule-associated proteins
(Sanchez et al., 1994). Moreover, genetic analysis in culture
cells suggested the implication of Hsp70 in the folding process
of tubulin (Ahmad et al., 1990). Completely denatured tubulins
form binary complexes with TCP-1-containing particles in the
absence of GTP (Gao et al., 1993), though the release of completely folded tubulin from C300 complexes requires GTP
hydrolysis (Fontalba et al., 1993). The purpose of this work was
to analyze the different steps in tubulin folding through the
study of the effect of single amino acid substitutions in the
putative phosphate binding motif of the tubulin molecule.
The choice of mutations in the glycine-rich loop for analysis
is made difficult because, in the absence of the lysine residue
common to the phosphate-binding consensus sequence in nontubulin GTP-binding proteins, it is impossible to confidently
align the glycine residues in tubulins with the consensus sequence
glycine residues. Therefore, we elected to analyze the behavior
of mutations in which one or more of the residues in the β-tubulin
glycine-rich loop were changed (Fig. 3). Alpha and β-tubulins
differ from one another in their nucleotide-binding properties:
while β-tubulins bind GTP and hydrolyze it during microtubule
assembly, it is thought that α-tubulins bind GTP in a nonexchangeable manner (Carlier, 1982). Also, β-tubulins have a
lower affinity site that accepts ATP as well as GTP, in addition
to the very specific GTP site, while α-tubulins have a site more
specific for ATP (Jayaram and Haley, 1994). For these reasons,
α- and β-tubulins may belong to two different classes of GTPbinding proteins (Dever et al., 1987). Thus, they would differ in
some of the regions implicated in GTP hydrolysis. Though αand β-tubulins are very closely related, we decided to introduce
those amino acids present in the glycine-rich loop in α-tubulins
at the corresponding positions in β-tubulins and vice versa.
Two types of mutant tubulins were found: (i) mutant polypeptides able to associate with C900 and C300 complexes; and (ii)
mutant polypeptides that only associate with C900 complexes. A
glycine substitution at position 148 of β1 for threonine, the corresponding residue present in murine α-tubulins, affected the
capacity of the mutant tubulin to be released as monomers and
to incorporate into dimers. This mutant is still able to associate
with C900 and C300 complexes. On the other hand, a threonine
substitution at position 150 in α4 for the corresponding residue
in β-tubulins, glycine, did not affect the ability of the mutant αtubulin to incorporate into dimers and microtubules and thus,
proper folding. This result is in agreement with the presence of
amino acids different from threonine in that location of the αtubulin subunit from other organisms (Burns and Surridge, 1994).
Due to the fact that the most prominent difference between αand β-tubulins resides in their GTP-binding and hydrolysis properties and that the glycine-rich loop has been implicated in this
phenomenon, the implication of this glycine in the binding
and/or hydrolysis of GTP in the case of β-tubulins seems likely.
Also, since the GTP bound to β-tubulin subunit could be
hydrolyzed and taking into account the results observed for its
related protein, FtsZ, it could be suggested that GTP hydrolysis
in β-tubulin would be required for dimer formation. Although it
is difficult to establish whether a given mutation prevents the
proper folding by interfering with GTP binding and/or hydrolysis or by disrupting folding in a GTP-independent manner, the
point explained above strengthens our suggestion. Also, more
striking substitutions in the glycine-rich loop of both α- and βtubulins, generated mutants (i.e. β1M147K/G148T) able to
associate with C900 complexes (to which tubulin associates in a
denatured form; Gao et al., 1993) but not with C300 complexes.
In these cases, it is more probable that the mutations we introduced disrupted the complete folding of tubulins. In any case,
every mutant which was able to associate with C300 complexes
gave rise to the formation of C900 complexes, suggesting that
tubulin emerges during the folding process in at least two
different folding states, first in association with C900 prior to its
transfer to the second, in association with C300 complexes. These
results support our previously proposed model for tubulin
folding and assembly (Fontalba et al., 1993).
The results found with the above mutants suggest that the
presence of glycine at position 148 is indeed required for a
functional GTP binding site and that β-tubulin GTPase activity
is required for β-tubulin monomer release from C300
complexes. It could be instructive to study whether microtubules assembled with the equivalent α-tubulin mutant in
yeast might have altered stabilities as well as to demonstrate
that these mutations do affect β-tubulin GTPase activity.
We thank our colleagues in Santander, Juan M. Garcia-Lobo and
Fernando de la Cruz, for helpful discussions, advice and critical
comments on the manuscript; Rafael Campo for technical assistance;
Maria Lizama for corrections to the English; and Nicholas J. Cowan
for providing us with some of the oligonucleotides used in this work
and for the opportunity to realize the immunofluorescences with
isotype-specific antibodies in his laboratory. We also would like to
acknowledge the comments and suggestions of one of the reviewers.
This work was supported by DGICYT (to J.C.Z.).
REFERENCES
Ahmad, S., Ahuja, R., Venner, T. J. and Gupta, R. S. (1990). Identification
of a protein altered in mutants resistant to microtubule inhibitors as a member
of the major heat shock protein (hsp70) family. Mol. Cell. Biol. 10, 51605165.
Braig, K., Otwinowski, Z., Hedge, R., Boisvert, D. C., Joachimiak, A.,
Horwich, A. and Sigler, P. B. (1994). The crystal structure of the bacterial
chaperonin GroEL at 2.8 Å. Nature 371, 578-586.
Burns, R. G. and Surridge, C. D. (1994). Tubulin: conservation and structure.
1478 J. C. Zabala, A. Fontalba and J. Avila
In Microtubules (ed. J. S. Hyams and C. W. Lloyd), pp. 3-31. Wiley-liss,
John Wiley and Sons, Inc., publication, New York.
Burns, R. G. (1995). Analysis of the γ-tubulin sequences: implications for the
functional properties of γ-tubulin. J. Cell Sci. 108, 2123-2130.
Campo, R., Fontalba, A., Sanchez, L. M. and Zabala, J. C. (1994). A 14 kDa
release factor is involved in GTP-dependent β-tubulin folding. FEBS Lett.
353, 162-166.
Craig, E. A., Weissman, J. S. and Horwich, A. L. (1994). Heat shock proteins
and molecular chaperones: mediators of protein conformation and turnover
in the cell. Cell 78, 365-372.
Carlier, M. F. (1982). Guanosine 5′ triphosphate hydrolysis and tubulin
polymerization. Mol. Cell. Biochem. 47, 97-113.
Davis, A., Sage, C. R., Dougherty, C. A. and Farrel, K. W. (1994).
Microtubule dynamics modulated by guanosine triphosphate hydrolysis
activity of β-tubulin. Science 264, 839-841.
de Boer, P., Crossley, R. and Rothfield, L. (1992). The essential bacterial celldivision protein FtsZ is a GTPase. Nature 359, 254-256.
Dever, T. E., Glynias, M. J. and Merrick, W. C. (1987). GTP-binding
domain: three consensus sequence elements with distinct spacing. Proc. Nat.
Acad. Sci. USA 84, 1814-1818.
Ellis, R. J. and van der Vies, S. M. (1991). Molecular chaperones. Annu. Rev.
Biochem. 60, 321-347.
Fenton, W. A., Kashi, Y., Furtak, K. and Horwich, A. L. (1994). Residues in
chaperonin GroEL required for polypeptide binding and release. Nature 371,
614-619.
Fontalba, A., Paciucci, R., Avila, J. and Zabala, J. C. (1993). Incorporation of
tubulin subunits into dimers requires GTP hydrolysis. J. Cell Sci. 106, 627-632.
Fontalba, A., Avila, J. and Zabala, J. C. (1995). β-tubulin folding is
modulated by the isotype-specific carboxy-terminal domain. J. Mol Biol.
246, 628-636.
Frydman, J., Nimmesgern, E., Erdjument-Bromage, H., Wall, J. S.,
Tempst, P. and Hartl, F. U. (1992). Function in protein folding of TRiC, a
cytosolic ring complex containing TCP1 and structurally related subunits.
EMBO J. 11, 4767-4778.
Gao, Y., Thomas, J. O., Chow, R. L., Lee, G.-H. and Cowan, N. J. (1992). A
cytoplasmic chaperonin that catalyzes β-actin folding. Cell 69, 1043-1050.
Gao, Y., Vainberg, I. E., Chow, R. L. and Cowan, N. J. (1993). Two
cofactors and cytoplasmic chaperonin are required for the folding of α- and
β-tubulin. Mol. Cell Biol. 13, 2478-2485.
Gao, Y., Melki, R., Walden, P. D., Lewis, S. A., Ampe, C., Rommelaere, H.,
Vandekerckhove, J. and Cowan, N. J. (1994). A novel cochaperonin that
modulates the ATPase activity of cytoplasmic chaperonin. J. Cell Biol. 125,
989-996.
Georgopoulos, C. P., Hendrix, R. W., Casjens, S. R. and Kaiser, A. D.
(1973). Host participation in bacteriophage lambda head assembly. J. Mol.
Biol. 76, 45-60.
Georgopoulos C. and Welch, W. J. (1993). Role of the major heat shock
proteins as molecular chaperones. Annu. Rev. Cell Biol. 9, 601-634.
Gu, W., Lewis, S. A. and Cowan N. J. (1988). Generation of antisera that
discriminate among mammalian α-tubulins: introduction of specialized
isotypes into cultured cell results in their coassembly without disruption of
normal microtubule function. J. Cell Biol. 106, 2011-2022.
Jacobs, M., Smith, H. and Taylor, E. W. (1974). Tubulin: nucleotide binding
and enzymatic activity. J. Mol. Biol. 89, 455-468.
Jayaram, B. and Haley, B. E. (1994). Identification of peptides within the base
binding domains of the GTP- and ATP-specific binding sites of tubulin. J.
Biol. Chem. 269, 3233-3242.
Kubota, H., Hynes, G., Carne, A., Ashworth, A. and Willison, K. (1994).
Identification of six Tcp-1-related genes encoding divergent subunits of the
TCP-1-containing chaperonin. Curr. Biol. 4, 89-99.
Kubota, H., Hynes, G. and Willison, K. (1995). The chaperonin containing tcomplex polypeptide 1 (TCP-1). Multisubunit machinery assisting in protein
folding and assembly in the eukaryotic cytosol. Eur. J. Biochem. 230, 3-16.
Kunkel, T. A. (1985). Rapid and efficient site-specific mutagenesis without
phenotypic selection. Proc. Nat. Acad. Sci. USA 82, 488-492.
Lewis, S. A., Lee, M. G.-S. and Cowan, N. J. (1985). Five mouse tubulin
isotypes and their regulated expression during development. J. Cell Biol.
101, 852-861.
Lewis, S. A., Gu, W. and Cowan, N. J. (1987). Free intermingling of
mammalian β-tubulin isotypes among functionally distinct microtubules.
Cell 49, 539-548.
Lewis, S. A. and Cowan, N. J. (1988). Complex regulation and functional
versatility of mammalian α- and β-tubulin isotypes during the differentiation
of testis and muscle cells. J. Cell Biol. 106, 2023-2033.
Lewis, V. A., Hynes, G. M., Zheng, D., Saibil, H. and Willison, K. (1992). Tcomplex polypeptide-1 is a subunit of a heteromeric particle in the eukaryotic
cytosol. Nature 358, 249-252.
Melki, R., Vainberg, I. E., Chow, R. L. and Cowan, N. J. (1993).
Chaperonin-mediated folding of vertebrate actin-related protein and γtubulin. J. Cell Biol. 122, 1301-1310.
Melton, D. A., Kreig, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K. and
Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA
hybridization probes from plasmids containing a bacteriophage SP6
promoter. Nucl. Acids Res. 12, 7035-7056.
Möller, W. and Amons, R. (1985). Phosphate-binding sequences in
nucleotide-binding proteins. FEBS Lett. 186, 1-7.
Morimoto, R. I., Tissieres, A. and Georgopoulos, C. (1994). Progress and
perspectives on the biology of heat shock proteins and molecular chaperones.
In The Biology of Heat Shock Proteins and Molecular Chaperones (ed. R. I.
Morimoto, A. Tissieres and C. Georgopoulos), pp. 1-30. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Mulligan, R. C. and Berg, P. (1981). Selection for animal cells that express the
Escherichia coli gene coding for xanthine-guanine phosphoribosyl
transferase. Proc. Nat. Acad. Sci. USA 78, 2072-2076.
Osborn, M. and Weber, K. (1982). Immunofluorescence and
immunocytochemical procedures with affinity purified antibodies: tubulin
containing structures. Meth. Cell Biol. 244, 98-129.
Pachter, J. S., Yen T. J. and Cleveland, D. W. (1987). Autoregulation of
tubulin expression is achieved through specific degradation of polysomal
tubulin mRNAs. Cell 51, 283-292.
Padilla, R., Otin, C. L., Serrano, L. and Avila, J. (1993). Role of the carboxyterminal region of β-tubulin on microtubule dynamics through its interaction
with the GTP phosphate binding region. FEBS Lett. 325, 173-176.
Pelham, H. R. B. and Jackson, R. J. (1976). An efficient mRNA-dependent
translation system from reticulocyte lysates. Eur. J. Biochem. 67, 247-256.
RayChaudhuri, D. and Park, J. T. (1992). Escherichia coli cell-division gene
ftsZ encodes a novel GTP-binding protein. Nature 359, 251-254.
Reijo, R. A., Cooper, E. M., Beagle, G. J. and Huffaker, T. C. (1994).
Systematic mutational analysis of the yeast β-tubulin gene. Mol. Biol. Cell 5,
29-43.
Rommelaere, H., Van Troys, M., Gao, Y., Melki, R., Cowan, N. J.,
Vandekerckhove, J. and Ampe, C. (1993). Eukaryotic cytosolic
chaperonin contains t-complex polypeptide 1 and seven related subunits.
Proc. Nat. Acad. Sci. USA 90, 11975-11979.
Sage, C. R., Dougherty, C. A., Davis, A. S., Burns, R. G., Wilson, L. and
Farrell, K. W. (1995). Site-directed mutagenesis of putative GTP-binding
sites of yeast β-tubulin: Evidence that α-, β-, and γ-tubulins are atypical
GTPases. Biochemistry 34, 7409-7419.
Sanchez, C., Padilla, R., Paciucci, R., Zabala, J. C. and Avila, J. (1994).
Binding of heat-shock protein 70 (hsp70) to tubulin. Arch. Biochem.
Biophys. 310, 428-432.
Sternlicht, H., Yaffe, M. B. and Farr, G. W. (1987). A model of the
nucleotide binding site of tubulin. FEBS Lett. 214, 226-235.
Sternlicht, H., Farr, G. W., Sternlicht, M. L., Driscoll, J. K., Willison, K. and
Yaffe, M. B. (1993). The t-complex polypeptide 1 complex is a chaperonin for
tubulin and actin in vivo. Proc. Nat. Acad. Sci. USA 90, 9422-9426.
Villasante, A., Wang, D., Dobner, P., Dolph, P., Lewis, S. A. and Cowan, N.
J. (1986). Six mouse α-tubulin mRNAs encode five distinct isotypes: testisspecific expression of two sister genes. Mol. Cell Biol. 6, 2409-2419.
Wang, D., Villasante, A., Lewis, S. A. and Cowan N. J. (1986). The
mammalian β-tubulin repertoire: hematopoietic expression of a novel,
heterologous β-tubulin isotype. J. Cell Biol. 103, 1903-1910.
Weisenberg, R. C., Deery, W. J. and Dickinson, P. J. (1976). Tubulinnucleotide interactions during the polymerization and the depolymerization
of microtubules. Biochemistry 15, 4248-4252.
Willison, K. and Kubota, H. (1994). The structure, function and genetics of
the chaperonin containing TCP-1 (CCT) in eukaryotic cytosol. In The
Biology of Heat Shock Proteins and Molecular Chaperones (ed. R. I.
Morimoto, A. Tissieres and C. Georgopoulos), pp. 1-30. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Yaffe, M. B., Farr, G. W., Miklos, D., Horwich, A. L., Sternlicht, M. L. and
Sternlicht, H. (1992). TCP1 complex is a molecular chaperone in tubulin
biogenesis. Nature 358, 245-248.
Zabala, J. C. and Cowan, N. J. (1992). Tubulin dimer formation via the
release of α- and β-tubulin monomers from multimolecular complexes. Cell
Motil. Cytoskel. 23, 222-230.
(Received 11 September 1995 - Accepted 29 February 1996)