Download Biology 0200

ID: ____________________________________
Biology 0200
Third Exam
April 18, 2012
11:00 AM – 11:55 AM
1) Please check to be sure that you have all 10 numbered pages.
2) Please write your Banner ID # at the top of this page, and ALSO on
the back of the exam in the upper right-hand corner, as shown at
right:
Banner ID
ID
Answer all questions in the space provided.
If you need more room continue on the other side of the paper.
The questions on the exam are worth a total of 100 points.
Questions
Value
1-8) Objective
32
9) Gene Expression
15
10) Genetic Code
19
11) Homeostasis
18
12) Cardiovascular
16
Total
100
Score
Bio 0200 - 2012 – 3rd Exam
Multiple Choice -
32 points total
In each of the questions, select the answer which you believe is most nearly correct and write it in the
blank. If more than one answer seems to be correct, pick the single answer you believe to be the best.
1)
Dideoxynucleotides are used for DNA sequencing reactions because they
A) can start a DNA strand without need of a primer.
B) have a different density than ordinary nucleotides.
C) base pair with RNA more tightly than ordinary deoxynucleotides.
D) lack phosphate groups, causing the growing chain to terminate.
E) None of the above.
2)
Southern blotting is a technique that makes it possible to identify which bands on a gel
contain a particular DNA sequence by blotting with a labeled RNA “probe.” Which of the
following best describes the way in which the probe is used in this technique?
A) It produces a double-strand break in DNA in the region of the sequence.
B) It marks a starting site for DNA polymerase to amplify the sequence.
C) It serves as a primer for RNA transcription at the location of the sequence.
D) It hybridizes to a RFLP containing the sequence.
E) None of the above.
3)
The allele for Sickle Cell Anemia is the result of which of the following types of
mutations?
A) Frame shift.
B) Chromosomal translocation.
C) Missense.
D) Inversion.
E) Deletion.
4)
Human iPS (induced pluripotent stem cells) can be obtained
A) by insertion of certain genes into differentiated somatic cells.
B) from the inner cell mass of the blastocyst.
C) from the germ cells of aborted fetuses.
D) by the injection of somatic nuclei into egg cytoplasm.
E) All of the above.
Page 2
Bio 0200 - 2012 – 3rd Exam
5)
All of the following statements about homeostasis are true EXCEPT
A) Large fluctuations in the value of a physiological measure always indicate a loss of
homeostatic control.
B) In general, homeostatic mechanisms are regulated by negative feedback.
C) A difference between setpoint and the current value of some physiological measure will
result in activation of effector systems.
D) Effector systems can involve physiological changes within an organism or changes in
behavior of the organism.
E) In humans, the tissue with the narrowest range of acceptable values for factors regulated by
homeostasis is nervous tissue in the brain.
6)
You are observing a neuron that is firing 5 action potentials every second. Which of
the following manipulations is most likely to cause this neuron to fire more action potentials?
A) An increase in the concentration gradient for potassium across the cell membrane.
B) Fewer sodium leak channels.
C) Preventing the voltage-gated sodium channels from inactivating.
D) An increase in the number of potassium leak channels.
E) An increase in the number of voltage-gated sodium channels.
7) ____ _______ All of the following are true concerning neurons EXCEPT
A) Vm is closest to the equilibrium potential of potassium during the undershoot
B) Myelination increases the speed with which the signal travels
C) Leak channels establish the negative resting membrane potential
D) The ions that move in to cause the rise in membrane potential during an action potential must
be pumped back out in order to return the membrane to the resting potential.
E) Ion channels can be gated by voltage and be selectively permeable to only certain ions.
8)
Your friend keeps feeling dizzy and feinting when they stand up quickly from a
reclined position. Which of the following would be the most effective way to help prevent this
dizzy feeling? Give them a drug that
A) stimulates the parasympathetic nervous system.
B) stops their heart.
C) causes precapillary sphincter muscles to contract.
D) increases blood pressure in the pulmonary artery.
E) decreases the volume of blood in their body.
Eion = RT ln[ion]out
zF
[ion]in
Eion = 58mV
z
log [ion]out
[ion]in
∆P = CO x TPR
CO = HR x SV
Page 3
Bio 0200 - 2012 – 3rd Exam
9) Control of Gene Expression (15 points).
As you may remember, the tryp operon is a group of 5 genes that code for proteins important in the
biosynthesis of the amino acid tryptophan.
The structure of the operon is shown below:
Important facts about the tryp operon:
• a Repressor for the operon is coded for by the trpR gene, found elsewhere in the genome.
• tryptophan itself serves as a co-repressor for the operon
• The five gene products of the operon (the proteins coded for by tryp E, tryp D, etc...) are enzymes
in a pathway that converts chorismic acid to tryptophan.
Answer, in a simple sentence or two, the following questions about the operon:
A) When cellular levels of tryptophan are relatively high, what will the state of the tryp Repressor
protein be (will it or will it not be bound to DNA?) If it is bound to DNA, where will it be bound? And
how will this affect transcription of the operon? 3 pts.
B) When cellular levels of tryptophan are relatively low, what will the state of the tryp Repressor
protein be? (will it or will it not be bound to DNA? And where will it be bound?). And how will that
affect transcription of the operon? 3 pts.
Page 4
Bio 0200 - 2012 – 3rd Exam
C) Using molecular techniques, you delete the tryptophan binding site on the tryp Repressor protein,
leaving the rest of the protein otherwise unchanged in structure and function Explain how the deletion
of this binding site will affect the regulation of the operon. 3 pts.
D) Your colleague has produced an inversion mutation in which the positions of the P and O regions of
the operon are reversed:
Predict the effect of this mutation on the regulation of the operon. 3 pts.
E) Is the tryp operon an example of positive or negative control of gene expression? Why? 3 pts.
Page 5
Bio 0200 - 2012 – 3rd Exam
10) Transcription & Translation (19 points)
Analyzing the human genome, you locate a gene that may code for protein QB487, whose amino acid
sequence was determined way back in 1975. Consulting that "ancient" sequence, you discover that the
last 3 amino acids of this protein are valine, methionine, and proline, in that order:
— val—met—pro—C
5’ - ... GCCAUUUAGGGUAAUGCCCUGAAAUGGCGAG - 3'
The 3' end of the mRNA molecule produced by this
gene is shown above. As you know, the genetic
code contains three possible stop codons: UGA,
UAG, and UAA. Interestingly, a quick glance at
the sequence shows that all three of these seem to
be present near the 3' end of the mRNA (note the
underlining in the sequence above).
A) Use your knowledge of the genetic code to
determine which of the three possible stop codons
actually functions as the stop codon in this mRNA.
Write down the actual stop codon in the box below
(3 points):
The actual stop codon is:
B) Explain (briefly) why the other two potential stop codons would not be able to stop translation in
this mRNA, while the one you chose would (4 points):
Page 6
Bio 0200 - 2012 – 3rd Exam
C) Each of the following terms refers to something involved in either transcription or translation.
First identify which process each is directly involved in (transcription or translation), and then define or
describe, in a single sentence, the role it plays in that process (12 points). Use the example below as a
model for your answers:
STOP CODON
Translation. A 3-base codon that causes the termination of translation and
the release of a newly-synthesized protein from the ribosome.
ANTICODON
RIBOSOMAL RNA
INTRON
TATA BOX
Page 7
Bio 0200 - 2012 – 3rd Exam
11) Homeostasis (16 points)
(or, “Fun things to do with a rectal probe!)
A study compared body temperatures of two groups of humans living in the same town, in a very
warm climate. One group had lived in this climate for many generations and the other group had
recently migrated from a more temperate (moderate) climate. At night, body temperature of both
groups dropped to 36.2°C. During the day however, the temperature of individuals from warmclimate cultures rose to 38° C while those from moderate-climate cultures rose to just 37° C.
Warm climate group
Moderate climate group
Lowest Nighttime Temperature
36.2 deg C
36.2 deg C
Highest Daytime Temperature
38.0 deg C
37.0 deg C
A) One of your colleagues says, “Gee! That is surprising. Individuals from warm-climate cultures
are not as good as moderate climate individuals at regulating their body temperature during the day.
There must be something wrong with their cooling systems.” Refute your colleague’s hypothesis
and explain why, in terms of 1) resource cost and 2) energy cost, it makes sense for the individuals
from cultures adapted to warm climates to allow their body temp to rise higher during the day. (8
pts)
B) If you were to point to one part of the body in the warm-climate group where changes have
occurred over generations to explain the differences seen in daytime temperature where would it
be? What kind of cells occupy this part of the body and are responsible for the differences in
daytime body temperatures? (4 pts)
Page 8
Bio 0200 - 2012 – 3rd Exam
C) The individuals from the above experiment are kept in a cool room overnight until all body
temperatures are around 36.2 degrees C. They are then placed into a very warm environment and
their body temperatures begin to rise, which group is more likely to complain that they “feel warm”
first? Why? (4 pts)
Page 9
Bio 0200 - 2012 – 3rd Exam
12) Cardiovascular (16 points)
A) Explain how sympathetic stimulation of the veins leads to greater cardiac output. (4pts)
B) A very large horse has about the same body size as a giraffe (2200 lbs) however the heart of a
horse is typically less than half the size of that of a giraffe (10 lbs vs. 25 lbs…yes a 25 lb heart!).
Explain the physiological reason why the giraffe has a disproportionately large heart. (6pts)
C) Current blood pressure in the systemic circulatory system is monitored in a particular location
within the circulatory system and this information is used by the body to modulate cardiovascular
system function.
Where in the systemic circulatory system is blood pressure monitored (name the general location or
the structure itself). (3pts)
Why does it make sense to locate the body’s pressure sensing mechanism here? (3pts)
Page 10