Download Chapter 7 Review

Chapter 7 Review, pages 358–363
Knowledge
1. d
2. a
3. d
4. a
5. d
6. b
7. a
8. c
9. b
10. b
11. a
12. c
13. c
14. c
15. c
16. b
17. True
18. False. During the formation of a polypeptide, mRNA is transcribed from the DNA, exits the
nucleus, and is translated on a ribosome to tRNA molecules, which carry the amino acids to form
the polypeptide.
19. False. RNA polymerase does not require a primer when making a complementary strand.
20. False. rRNA binds with proteins to form ribosomes.
21. False. Eukaryotes use spliceosomes to remove introns during post-transcriptional
modification.
22. False. The process of alternative splicing results in different combinations of introns being
removed to synthesize multiple proteins from the one gene.
23. True
24. True
25. False. The formation of proteins is slower in eukaryotes than in prokaryotes because
polysomes cannot form in the nucleus, with no coupling of transcription and translation.
26. True
27. False. The trp repressor is activated by high concentrations of tryptophan.
28. False. When lactose is absent, the lac repressor is active and binds to the operator.
29. True
30. False. Silent mutations insert, delete, or change base(s) and have no effect on the protein.
31. False. Pseudogenes are mutated vestigial genes that have lost their evolutionary adaptive
value.
32. True
33. (a) iv
(b) iii
(c) i
(d) vi
(e) v
(f) ii
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-2
34. (a) iii
(b) iv
(c) vi
(d) ii
(e) i
(f) v
35. The amino acid sequence that corresponds to the DNA template strand
5'-GTTGATTTTCGC-3' is valine, aspartic acid, phenylalanine, and arginine.
36. Answers may vary. Students’ answers should include three of the following sequences:
GGTCATATT; GGTCATATC; GGTCATATA; GGTCACATT; GGTCACATC;
GGTCACATA; GGCCATATC; GGCCATATA; GGCCACATT; GGCCACATC;
GGCCACATA; GGACATATC; GGACATATA; GGACACATT; GGACACATC;
GGACACATA; GGGCATATC; GGGCATATA; GGGCACATT; GGGCACATC;
GGGCACATA.
37. Alternative spicing refers to the process in which multiple mRNAs are produced from the
parent pre-mRNA. In humans this accounts for the larger number of proteins produced from a
smaller number of genes.
38. snRNPs combine with pre-mRNA and proteins to form spliceosomes that excise introns from
pre-mRNA to form mRNA molecules.
39. The purpose of aminoacylation is to charge the tRNA with its amino acid.
40. There are several advantages that prokaryotes have over eukaryotes in protein synthesis,
including that transcription and translation can occur in the same location; no 5′ cap must be
added; prokaryotes have a higher rate of protein synthesis; and polysomes can transcribe almost
simultaneously with transcription.
41. The effects of the poly(A) tail include increased translation time.
42. It is important for cells to regulate genes because transcription and translation of genes are
metabolically expensive. In many cases, other than housekeeping genes, protein synthesis only
needs to occur for short periods of time or under specific conditions. Gene regulation prevents
the over- or under-transcription and translation of genes when they are not required.
43. The mRNA codons UAA, UGA, and UAG are stop codons that signal the end of a
polypeptide chain and cause the ribosome to terminate translation.
44. The types of mutagens are: chemical (for example, ethidium bromide), radiation (for
example, exposure to x-rays), and viral (for example, viruses cause some cancers).
45. Scientists believe these sequences help protect the DNA from damage and the shortfalls of
DNA replication.
46. The genomic structures found in viruses are single-stranded DNA, single-stranded RNA,
double-stranded DNA, and double-stranded RNA.
Understanding
47. You can conclude that this is RNA because it contains uracil. The nucleic acid is a singlestranded molecule because the bases do not have equal concentrations and the ratios of A:U and
C:G are not equivalent as you would find in a double-stranded molecule.
48. Garrod’s work with alkaptonuria helped him understand that there is a specific relationship
between genes and metabolism. He found that alkaptonuria was an “inborn error of metabolism.”
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-3
49.
50. The amino acid sequence Arg-Leu-Ser is a good example of the wobble hypothesis because
each of the amino acids is coded for by six different codons. Mathematically, a total of 216
(6 × 6 × 6) different sequences of nucleotides could code for this short sequence.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-4
51.
52. The longer 70 kbp gene belongs to the eukaryotic organism. It is longer because it contains
introns, unique to eukaryotic organisms, which are not found in the 20 kbp prokaryotic version
of the gene.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-5
53. A code could be sent by associating groups of RNA nucleotides with letters and symbols.
The message could be inserted into a host genome and lay dormant, controlled using a specific
nutrient “key” that would induce mRNA synthesis, which could be sequenced and analyzed.
54. Alternative splicing is a mechanism that enables eukaryotes to synthesize more than one
protein per gene by modifying the splicing of exons. This is an important feature that increases
protein variation by enabling more than one protein to be synthesized for each gene.
55. The A site is the location where the tRNA enters the ribosome with an amino acid. The P site
is the site in the middle of the ribosome where amino acid from the A site is joined to the amino
acid chain. The E site is the location where the tRNA is released after it has released its amino
acid to the growing peptide chain.
56. Peptide elongation cannot occur while erythromycin blocks ribosomal translocation. Any
peptide that was being synthesized prior to the administration of the drug would be locked into
the ribosome since the A site could not advance and eject the de-acylated tRNA.
57. Table 1
C G A A T T A C C
DNA
template
strand
G C T T A A T G G
DNA
other
strand
G C U U A A U G G
mRNA
C G A A U U A C C
tRNA
Alanine
Stop
Trp
amino
codon
acids
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-6
58.
59. It is believed that the post-translational modification by the addition of ubiquitin helps cells
mark proteins that require degradation. Ubiquitin is seen as a marker to aid the cellular
machinery in the degradation of proteins.
60. Answers may vary. Sample answer: Most mutation are not harmful; many are silent
mutations. Additionally, the wobble hypothesis allows for some variation in the genetic code,
which allows for some base-pair substitutions in the DNA that will not correspond to a change in
the amino acid. Many mutations that do have effects allow organisms to adapt to their
environment. Most traits could be defined as mutations.
61. Non-coding sequences are no longer referred to as referred to as “junk” DNA because of the
role they play in epigenetic regulation. Non-coding sequences play different roles in epigenetics
by modifying gene expression in different ways. Telomeres protect the important coding regions.
Transposable elements have the ability to recruit silencing machinery, single genes, and large
chromosomal regions.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-7
62. Answers may vary. Sample answer:
63. Retro virus replication process:
Retro virus injects RNA into cell.
Reverse transcriptase copies viral RNA making complementary DNA.
Reverse transcriptase synthesizes second DNA complement to first strand.
Integrase incorporates new DNA into host cell.
Host now transcribes viral RNA and translates it into viral proteins.
Analysis and Application
64. (a) Students should use the formula yn ≥ number of amino acids, where n = number of
nucleotides per codon, y = total number number of nucleotides, in this case,6n ≥ 180. One
solution is to simply substitute 1, 2, 3... for n. There must be a minimum of 3 nucleotides per
codon and 63 = 216 combinations.
(b) Students should use the formula yn ≥ number of amino acids, where n = number of
nucleotides per codon, y = total number number of nucleotides, in this case,6n ≥ 356. A simple
substitution shows at least 4 nucleotides per codon are required.
65. During RNA transcription, mRNA does not bind to template DNA. mRNA is produced at
many initiation points along a template strand, serves to produce a template RNA and is short
term. During DNA replication, DNA polymerase synthesizes DNA, a primer is required to
initiate synthesis, and DNA replication continues until it runs out of DNA on a strand. DNA
replication follows helicase as it unwinds the double helix.
66. Table 2
Number of
Number of
Number of
exons
introns
possible
genes
5
1
5
5
2
20
5
3
60
5
4
120
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-8
67. The sample that unwinds at 60 °C more likely contains the promoter, as it unwinds at a lower
temperature. This is because the promoter region contains the TATA box and has a larger
concentration of adenine and thiamine. Adenine and thiamine share only two hydrogen bonds
versus the three in guanine and cytosine. The smaller number of hydrogen bonds requires less
energy to break and break at lower temperatures.
68. During treatment A the fluorescent label would be present throughout the cell in the cytosol
as free uracil and incorporated into the various RNA structures, for example, mRNA, tRNA, and
rRNA. During treatment B the fluorescent label would only be localized in RNA structures still
active in the cell, for example, mRNA, rRNA, and tRNA, and will not be freely distributed in the
cytosol or the nucleus.
69. When tetracycline associates with the ribosome and prevents the aminoacyl-tRNA from
binding to the ribosome, no proteins can be produced. This prevents the cell from performing
most metabolic processes, thus the infecting organism dies.
70. Answers may vary. Sample answer: Since there are 20 amino acids, there should be at least
20 tRNA. The wobble hypothesis suggests that more tRNA are available, allowing the third base
to change (wobble) while allowing the codon to still code for a particular amino acid.
71. (a) The three stop codons tRNA sequences do not code for any amino acid.
(b) Answers may vary. Sample answer: To determine their function you could perform an
experiment that places the stop codon immediately after the start codon or in the middle of a
gene. Your expected result would be methionine only or a shorter protein than usual for that
gene.
72. Answers may vary. Sample answer: Gene regulation in eukaryotes is performed by several
different mechanisms during transcription, post-transcription, translation, and post-translation,
including the control of transcription and the rate of transcription, promoters, alternative exon
and intron splicing, and post-translation regulation of protein functionality. Prokaryotes use only
the operon system in which certain proteins can turn off the transcription of a gene or a group of
genes.
73. This is a silent mutation; it does not affect expression of the gene. The substitution of
cytosine with thymine yields the same amino acid threonine before and after the mutation.
74. The inversion mutation would result in the following sequence: 5′-GGT AAT CGG ACA-3′.
The original polypeptide would be Cys-Pro-Iso-Thr while the new sequence would be
Pro-Leu-Ala-Cys. Depending on the protein, this could have a range of effects from none to
serious.
75. Answers may vary. Sample answer: In drug manufacturing the next important
pharmaceutical step is gene therapy. The guidelines that the Government of Canada adopts
should allow companies to patent therapeutic genes and vectors that will be used in treatment of
numerous genetic related disorders.
Evaluation
76. (a) This statement refers to the wobble hypothesis, or redundancy, in which the third codon
can vary and still produce the desired amino acid.
(b) The total number of sense codons is 61. The ratio of sense codons that have synonyms to
sense codons that do not is 59:2.
(c) Degeneracy protects a cell from mutations by allowing for a change in one of the nitrogenous
bases in a codon, without changing the amino acid that is built from that codon.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-9
(d) Answers will vary but should focus on testing a non-variant line versus a normal population.
For example: How would a viral infection affect a population of genetic clones versus a wild
type population?
77. Cyclohexamide only blocks eukaryotic protein synthesis; the mitochondria still manufacture
their own proteins. Therefore this protein is being produced by the mitochondria, not the DNA in
the nucleus.
78. (a) The insulin is not being synthesized because the human insulin gene has been inserted
into a prokaryote. The protein is too long as the prokaryote will include both introns and exons
that are normally excised after the formation of pre-mRNA in a eukaryote prior to the formation
of mRNA.
(b) In order for the process to work, the gene must have the introns removed so that the gene
only contains exons prior to insertion into the E. coli.
79. Gene regulation, either through environmental or internal mechanisms, plays an important
part in transcription and translation, which ultimately determines not only which genes are read
but also the duration and frequency. In this way your body’s internal environment and your
external environment can cause genes to be turned on and off. Since you are made of proteins
this makes you a product of your environment.
80. The promoter region, shown as the rectangle, occurs on the 3' side of the start of translation.
The mRNA is synthesised in a 5' to 3' direction and the transcription is stopped at the terminator
region on the 5' side of the start of translation on the DNA.
81. Since Actinomycin D is claimed to be a transcription inhibitor, you would sample the
concentration of mRNA:proteins before and after the administration of the drug. If the claim
were true, you would expect to see the mRNA concentration decrease, as they are not
transcribed. Initially there may be an increase in protein concentration but only as a result of
mRNA synthesized prior to the administration of the medication.
82. (a) Sequence B is from a eukaryote because it is longer and contains introns that the
prokaryotic gene does not contain.
(b) Sequence A has 3 promoter regions and sequence B has 2 promoter regions, identified by the
TATA box.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-10
(c) There are 3 copies of the gene in sequence A, and 2 copies of the gene in sequence B.
Example: Sequence A:
5'GCAGGCCATATAAAATAGCGCCATACTAGATACGGGCCATATTATTGCATATCCGCCG
ATTACAGGATTTAATTTGGGAATTCCCCGATTAACGCGATCGATCGGGCCATATCGAT
ATGCATCGTAATCCGGTAGATTCACAGGTAG-3';
Sequence B: 5'GCATACCCAAATTAATAACGGCGGTAGGCGACTCATTCTGATATACGCATCGGCATTT
ACCTACGGCCGGCCGGCCGGCCGGCCTAGATTTACCGCATTTACCGGCCGCATCGGA
TCGGGATTAGCATAATTAAAATGCATCGGCGTAGTAGGCAATCGGCGCAGCCGAGC
CACCTCCCGGAGAATCATCTCATCATCATCATCATCATCATCATCATCATCATACGG
ATAGATCCATTACCATGCGATTTAAAGGCCATTCATGGGCCCCCGATTTATCCATTT
AGGCCGGATTCCATGGATTCATTTCCATTTTTCGGCATCATCATCATCATCATCATCA
TCATCA TCATCATCATCATCATCAT-3'.
83. (a) Individual A has a frame shift mutation because of a T deletion.
(b) Individual B has a silent mutation, as the substitution of A for G did not affect the amino acid
sequence.
(c) Individual C has had a frameshift mutation caused by the removal of the ATA codon and the
addition of extra nucleotides GCTA.
84. Answers may vary. Answers should include some of the following information:
In support of continued sale: adults have the freedom to choose and information about the risks is
easily available. It also brings in tax dollars. By selling these products legally you reduce the
price and increase access, eliminating a great deal of crime. Alcohol has been shown to have
health benefits in reducing the effects of stress and lowering blood pressure.
Refuting of continued sale: the health effects cause lost productivity and take resources out of the
health care system. The sale of these products results in a great deal of criminal activity and lost
police time for their enforcement.
Reflect on Your Learning
85. Answers may vary. Sample answer: Though genes do code for enzymes, a better statement
would have been genes code for proteins and enzymes are a type of proteins. Although the
statement is true, it is not accurate, since not all proteins are enzymes.
86. Answers may vary. Sample answer: This information makes me realize that science is about
the question, and sometimes an experiment can point you in the direction of an answer but not
directly produce an answer. In both these situations their experiments were designed to show the
existence of an answer, but not necessarily solve the puzzle.
87. Answers may vary. Answers should show insight into the students’ knowledge and
understanding of genetics. Students should give examples of concepts that they used to
understand different mechanisms of genetic maintenance. They should reflect on how this
knowledge alters their perspective of life in general.
88. Answers may vary. Answers should focus on the knowledge that each cell type has specific
machinery that can be interfered with. This machinery is cell specific and medicines are designed
to only interfere with these specific pathways.
89. Answers may vary. Answers should focus on viral structure, reproductive methods, and
genetic makeup. Humans have learned a great deal about our cellular machinery as a result of
working on the genetically simple virus genome.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-11
Research
90. (a) The “RNA world” hypothesis is supported by the fact that RNA can act as both a gene
and an enzyme. There have been in vitro studies that have shown self-contained spontaneously
replicating systems composed entirely of RNA. The absence of this quality in DNA and proteins
suggests RNA existed first.
(b) Sequences of RNA can form polymers that can process complex tertiary structures that allow
them to act as an enzyme and catalyze the formation of RNA polymers.
(c) This hypothesis suggests that life on earth was started with simple RNA interactions and then
associated into proteins to form virus-type molecules and then more complex membrane bound
organisms.
91. (a) Answers may vary. Answers should show that eukaryotic ribosomes are larger than
prokaryotic ribosomes and use different proteins in their structures. Sample answer:
Table 3
Prokaryotic ribosomes
Eukaryotic ribosomes
50S
30S
60S
40S
Subunits
23S (2900)
16S (1540)
28S (4800)
18S (1900)
rRNA
5.8S (160)
species (and 5S (120)
5S (120)
number of
bases)
L1, L2, L3
S1, S2, S3
L1, L2, L3
S1, S2, S3
Proteins
(total: 31)
(total: 21)
(total: 50)
(total): 33)
bind with
rRNA
(b) Erythromycin disrupts bacterial ribosomes by binding to the 23S rRNA molecule of the
bacterial ribosome blocking the exit of the growing peptide chain.
92. Answers may vary. Projects should include information about the ability of bacteria to
become resistant to antibiotics. Students should relate the use of antibiotics to the resistant
bacteria. Viruses cannot be stopped with typical antibiotics. However, some antiviral drugs exist
and act to inhibit certain viral proteins or to mask viral genetic material.
93. Answers may vary. Answers should include information about how vaccines work and
difficulties faced with HIV. Most vaccines stimulate immunologic memory without blocking the
actual infection. Most successful vaccines induce potent antibody production. Viruses are hard to
develop because the HIV virus has a high rate of mutation and a population that is polymorphic.
94. (a) Answers may vary. Sample answer: Genetically engineered bacteria might displace
naturally occurring bacteria, altering the present ecosystem.
(b) Answers may vary. Answers should include information about the safety of transgenic food
and the potential movement of genetic information from the modified species into the natural
population.
(c) Answers may vary. Sample answer: Legislation should require labeling indicating how a
food is genetically modified. Some students could take this further and suggest that legislation
about the farmers and processes with which the food is grown should be more secure and
monitored.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-12
95. (a) The epigenome is the expression of genes based on their environment.
(b) MVPs are used to examine gene activity, tissue type, and health and are used as a measure of
epigenetics.
(c) Scientists use MVPs because they alter the structure of the DNA and this causes changes to
the expression of proteins. Scientists can then examine the alterations in structure to infer
evolutionary patterns.
(d) Answers may vary. Pamphlets should discuss how the degree of methylation is thought to be
a measure of the healthiness of a genome. In general, cells that are highly methylated tend to be
at a higher risk of forming cancers or having embedded viral DNA components.
96. Answers may vary. Answers should mention that UV radiation can cause mutations in
genetic material, which can result in aging and diseases like cancer. Students should include an
explanation of UV radiation and why tanning beds cause similar damage to that caused by the
Sun.
Copyright © 2012 Nelson Education Ltd.
Chapter 7: Genes and Protein Synthesis
7-13