* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis Practice
Promoter (genetics) wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Protein adsorption wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding RNA wikipedia , lookup
Molecular evolution wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Point mutation wikipedia , lookup
Messenger RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epitranscriptome wikipedia , lookup
Replication Transcription and Translation!!!! Name:_______________________________________Per:__________Date:__________ Now that you’re experts on the process of DNA replication and protein synthesis, let’s put it to the test! You’re ready to become a professional DNA/RNA code breaker. Write the complimentary base pairs for the segments of DNA or RNA below. DNA Replication REMEMBER: DNA copies itself using DNA polymerase to add new complimentary nucleic acid bases. 1. A T C G G G C G A C C G T A C ______________________________________________________ 2. T G C C G T A G C T A G C T A G _____________________________________ Transcription At this stage mRNA copies information from a strand of DNA. RNA Polymerase adds matching RNA bases. 3. A C G A T C G A T A G C ___________________________________ 4. C G A T C G T A G A T C G A T A G _________________________________________________ Translation Now mRNA takes the transcribed section out of the nucleus and is translated in the ribosome by tRNA. Write the complimentary tRNA anticodons for each mRNA codon. 5. AUG GUA GAU CUA CGA CGA UGA 6. AUG CGA CCU CUC CGU AGA CGU UAG Now, write the names of the amino acids that will correspond to each mRNA codon for these genes. Protein A: AUG GUA CGA UGA methionine_________________________________________________ Protein B: AUG CGA CCU AGA CGU UAG __________________________________________________________ GOOD WORK! Now let’s really try to trick you. Given the following mRNA strands, draw a circle around the START CODONS and the STOP CODONS. Number the 3-base pair codons in between. A whole protein need to have a series of codons between a start (AUG) and a stop codon (UGA, UAG or UAA). Which strands will build whole proteins? Example: This strand builds a whole protein 7. CGG AUG CGU CGC AAC GAG AGC GCG CGC GGA 1 2 3 4 5 6 8 9 UGA CCGGAAC Put a square around the start codon, then circle each additional codon, number it and label its amino acid. Square the stop codon when you get there. If there is no start or no stop, then it is not a complete protein. 8. AUGGAGGAGAUCUCUCGCGCUAGAGAUCGCGCGUAG C 9. C C C G G G G A A A U C G C U A G C C G G C U U A G G A U C 10. A U G G G G A U A G G A U G A G A U A G C G A U A G A G A G A U C 11. C G C G U U A U G C C G G G C C C C G G G U G A G C U G 12. A G A G U C U C U C G A A U G C G C A A A U A G A G U C G U A U G G Need Help? You Tube Crash Biology: Number 10: http://www.youtube.com/watch?v=8kK2zwjRV0M Number 11: http://www.youtube.com/watch?v=itsb2SqR-R0 Lastly, decode these DNA strands to mRNA then amino acids to make proteins using the amino acid decoder chart. The same chart is available in your books on p. 367. 1. DNA: TAC GCT CCG GGC AGA GGG ATT mRna: Amino Acid: 2. DNA: mRna: Amino Acid: TAC AAA GTA GTC ACT 3. DNA: mRna: Amino Acid: TAC AAA GTG AAG GTT ACT