Download mastering protein synthesis

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Epigenomics wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

DNA supercoil wikipedia , lookup

RNA-Seq wikipedia , lookup

Non-coding DNA wikipedia , lookup

Genomics wikipedia , lookup

Replisome wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

NEDD9 wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Gene wikipedia , lookup

Protein moonlighting wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

RNA wikipedia , lookup

Frameshift mutation wikipedia , lookup

Transfer RNA wikipedia , lookup

DNA vaccination wikipedia , lookup

Polyadenylation wikipedia , lookup

History of RNA biology wikipedia , lookup

Helitron (biology) wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Non-coding RNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Point mutation wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Expanded genetic code wikipedia , lookup

RNA-binding protein wikipedia , lookup

Primary transcript wikipedia , lookup

Genetic code wikipedia , lookup

Messenger RNA wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
Name _______________________________
Period _________
MASTERING PROTEIN SYNTHESIS
From this DNA, you have all the information you need to build protein.
5’ ATGGTTACAGTCTATTAGATGCTATTTCAACACCAATAA 3’
3’ TACCAATGTCAGATAATCTACGATAAAGTTGTGGTTATT 5’
mRNA (codons)
amino acids (use the codon chart in your book or notes)
CHECKING FOR UNDERSTANDING
1. The RNA that decodes the mRNA is called? __________________________________________
2. How many proteins were made from this strand of DNA?________________________________
3. A protein is made of _____________________________________________________________
4. What is a codon? ________________________________________________________________
5. Where does protein synthesis occur?_________________________________________________
6. The RNA that has an anticodon is called _____________________________________________
7. What is the anticodon for methionine? _______________________________________________
8. What is the anticodon for CGA? ____________________________________________________
9. The process of making an exact copy of DNA is called __________________________________
10. The process of making mRNA is called ______________________________________________
11. The process of decoding mRNA is called _____________________________________________
12. What would happen to the protein if the 6th codon on mRNA changed from
a. UAG to UAA? ___________________________________________________________
b. UAG to UAU? ___________________________________________________________
13. A protein is made up of 100 amino acids. How many bases would the mRNA have? __________
14. DNA is made of units called _______________________________________________________