Download Model 1: Elongation Phase of Translation

Bio200 Cell Biology Activity – Translation
Autumn 2014
Directions: Answer the questions below alone or with a partner. Be prepared to help other
students answer the Elongation Integration Questions on p. 3
Model 1: Elongation Phase of Translation
1. Label as many components of the cartoon as you can.
2. Label the 5' and 3' sides of each codon and anticodon.
3. a. How many nucleotides are there in a codon? __________ In an anticodon? _________
b. Do codons overlap? __________
c. Which molecule contains codons? ___________ Which contains anticodons? ________
d. How many amino acids does each tRNA carry? ______
4. The following statements are partially correct. Write a better statement for each one that is
completely correct and describes the process more accurately.
a) The codons bind to anticodons and then the anticodon makes a protein.
b) If the anticodon is attached to the wrong amino-acid, then the ribosome will still use the anticodon
but no protein will be formed.
5. Translation ALWAYS begins with a tRNA carrying the amino acid Met.
a. What is the sequence of the "Start Codon"? Label with 5' and 3'.
_________________
b. In which direction must the ribosome move ("translocate") along the mRNA? ________
(From 5' to 3' or from 3' to 5'?). How did you decide this?
1
Bio200 Cell Biology Activity – Translation
Autumn 2014
Integration Questions
Learning goal: synthesize information from all three phases
of translation with your new group
General questions for all group members
1. What is the purpose of translation?
2. Orient yourself to the schematic on the right. Identify the
following: f-Met, tRNA, mRNA, ribosome and anticodon.
3. In the chart below, fill in the function of each of the components
and whether they are necessary for the different stages of translation
Component
Function
Necessary for
initiation?
mRNA
Necessary for
elongation?
Yes
Necessary for
termination?
f-Met tRNA
ribosome
release
factor
anticodon
"Platform" and catalyst for
translation
No
-----------------------------------------------------------------------------------------------------------------------------Initiation Integration Questions: Initiation Expert helps other group members answer the following
questions.
1. Imagine you replace four purines with pyrimidines in a ribosome binding site.
Which of the following statements would be true?
T F The rate of formation of peptide bonds will decrease
T F The affinity of the small ribosomal subunit for ribosome binding site will decrease
T F The rate of initiation will decrease
T F The affinity of large ribosome subunit for small ribosome subunit will decrease
2. What establishes the reading frame? (circle the correct answer)
A. The ribosome binding site
B. The start codon
C. The 5’ end of the mRNA
D. The distance between the ribosome binding site and the start codon
3. What is the next codon that will be read by the ribosome in the schematic above? _________
4. Stop and reflect. All group members should now be able to explain 1) how the reading frame is
established, 2) the purpose of the ribosome binding site and 3) the triplet nature of codons.
2
Bio200 Cell Biology Activity – Translation
Autumn 2014
Elongation Integration Questions: Elongation Expert helps other group members
answer the following questions
1. A covalent bond between which two molecules keeps the growing protein chain attached to the
ribosome?
2. Which direction will the ribosome move in the model shown above? __________________
3. What is the function of the tRNA?
4. What would happen if all the tRNAs in a cell with anticodons for lysine carried glycine amino acids
instead of lysine amino acids? Circle the correct answer.
A. Translation would still occur but the protein product would contain glycines in place of lysines
B. Translation would stop at the first lysine codon
C. Translation would still occur but there would be no lysines or glycines in the protein
D. Translation would still occur but the protein product would contain lysines in place of glycines
5. Stop and reflect. All group members should now be able to explain 1) the relationship between
codons and anticodons, 2) how the structure of a tRNA impacts its function and 3) why the ribosome
moves in a 5’ to 3’ direction.
-----------------------------------------------------------------------------------------------------------------------------Termination Integration Questions: Termination Expert helps other group
members answer the following questions
1. Identify the release factor in the model to the right
2. Compare and contrast a release factor to a tRNA: How are they different?
How are they similar?
Different:
Similar:
3. What has to happen for the growing protein to be released from the ribosome?
(Hint: look back at Elongation Integration Question 1)
4. How does the structure of the release factor impact its function?
5. Stop and reflect. All group members should now be able to explain 1) the role of a release factor
during termination and 2) how the structure of the release factor impacts its function.
------------------------------------------------------------------------------------------------------------------------------
3
Bio200 Cell Biology Activity – Translation
Autumn 2014
On your own questions for practice:
The reaction catalyzed by the ribosome is
shown to the right.
1. Label an arrow pointing to...
... an "Amino-acyl tRNA"
... the "Peptidyl tRNA"
... the "Empty tRNA"
amino acid
tRNA with the
nucleotide at one end
shown much larger
than the rest of the
molecule
2. Which end of the tRNA is attached to
the amino acid, 5' or 3'?
_________
3. a. In the top half of the model...
... circle the two atoms that will be
connected
by a new bond.
... draw a slash through the bond that
will be
broken.
b. In the bottom half of the model, circle
the newly formed bond.
2. The drawing to the right shows a short protein of 8
amino acids that is complete, but is still in the ribosome.
a. Label the amino terminus and the soon-to-be-carboxyl terminus
of the protein.
b. Circle the bond that needs to be broken before the protein
can be used.
c. What molecule catalyzes the reaction in "b"? _________________
d. Draw a square around a peptide bond.
4
Bio200 Cell Biology Activity – Translation
Summer 2014
3. This is the sequence of a complete mRNA from a bacterial cell:
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label the amino
(N) and carboxyl (C) termini of the protein.
b. How many tRNAs will bind to the ribosome to make this protein? _________
c. Which of the following sequences within the mRNA most likely contains the ribosome binding site?
(Circle ONE)
5'UAGCUAGCA3' 5'UUAAUGG3' 5'AAGGAGGC3' 4. For each different mutant cell described
below, assume that ONE specific molecule
or part of a molecule is mutated in that cell
so that the molecule’s function has
changed. Name as many molecules that
could result in the description (but
remember that for the mutant phenotype,
you are considering each mutation by
itself).
Cell 1: In many different types of proteins,
there is the amino acid Thr (threonine)
where an Ala (alanine) should be.
________________________
Cell 2: Many different types of proteins
are much shorter than in a normal cell, but
have the correct sequence up to that point.
tRNA levels are normal in the cell.
________________________
Cell 3: About a third of all new proteins in a mutated cell are not doing their jobs correctly. When you
compared to proteins in a healthy cell, these proteins appear much larger overall.
________________________________
5