Download Advanced Genetics Unit 2: DNA Structure and Processes Quiz Bowl

Advanced Genetics
Unit 2: DNA Structure and Processes
Quiz Bowl
1. Chemist from California who laid down a number of the rules regarding molecular
bonds. [Linus Pauling]
2. She was a master at X-ray crystallography. [Rosalind Franklin]
3. His rule states G:C::1:1. [Chargaff]
4. Scraped pus samples together for his discovery of “nuclein.” [Miescher]
5. Their revelation in 1953 announced the beginning of the biological revolution.
[Watson and Crick]
6. 1 N-rich base + 1 5-C sugar + 1 phosphate group = 1 ___________________
[nucleotide]
7. Sugar molecule used to build RNA molecules. [ribose]
8. Name any double-ringed base. [A, G]
9. A “friend” told me he saw a nucleotide floating around in a cell’s nucleoplasm
which was constructed from a ribose sugar AND a T base. You know he was
lying to me. How do you know? [Ribose-based nucleotides only used to build
RNA. No T bases in RNA.]
10. The 2 ends of a single strand of DNA are known as the ___ end and the ____
end. [3’, 5’]
11. Because the 2 strands of the DNA molecule run in opposite directions, the
molecule is said to be … [antiparallel]
12. The component of the DNA molecule which makes it acidic. [phosphate groups]
13. There are 3 hydrogen bonds holding these 2 bases together. [G and C]
14. We have mapped at least how much of the human genome? [93%]
15. When looking at one side of the DNA strand from a chromosome, we find that the
number of A’s is about equal to the number of T’s and the number of G’s is about
equal to the number of C’s. This tells us this DNA has no … [strand bias]
16. That DNA in our cells which does show strand bias however is found … [in the
mitochondria]
17. Our DNA shows a deficiency in the ____ dinucleotide. [CG]
18. The frequencies of CG dinucleotides on a chromosome is a direct indicator of
that chromosome’s … [gene density]
19. It seems that a significant portion of our junk DNA is made up of … [simple
sequence repeats]
20. This area of the DNA molecule in chromosomes is made up of long repeating
stretches such as alpha satellites. [centromeres]
21. It would seem that “protein-coding genes” only make up about _______% of the
DNA in our cells? [1-2%]
22. RNA type responsible for shuttling amino acids to ribosomes during protein
construction. [tRNA]
23. Name any type of regulatory RNA. [miRNA, siRNA, snRNA, snoRNA]
24. What does siRNA stand for? [small interfering RNA]
25. DNA tends to be well-shielded from mutations. One reason for this is that the
DNA molecule wraps itself around these proteins. [histones]
26. When the DNA molecule unzips, it is said to … [denature]
27. Term used to describe the process of DNA replication since the 2 new strands
are both ½ old and ½ new. [semiconservative]
28. New DNA strands can only be built in what direction? [5’ to 3’]
29. New DNA strands are synthesized during replication one ________________ at
a time. [nucleotide]
30. The sequence of DNA where the unzipping first begins during replication. [origin
of replication]
31. The entire stretch of DNA one replication bubble will eventually encompass.
[replicon]
32. Helicase can be found at this junction during replication. [replication fork]
33. DNA polymerase cannot climb onto the DNA strand until this enzyme “sets up”
the strand. [Primase]
34. The primer which primase puts into place during replication is a short stretch of
… [RNA]
35. DNA polymerase builds new DNA strands fragmentally on the ____________
strand. [lagging]
36. Those fragments of DNA strand in the previous question are known as …
[Okazaki fragments]
37. These proteins act like door stops, preventing the 2 parent DNA strands from
coming back together again and re-annealing during replication. [SSB proteins]
38. This enzyme “seals the nicks” left behind on the DNA strand by DNA
polymerase. [DNA ligase]
39. DNA polymerase works continually and uninterrupted on the ____________
strand. [leading]
40. Proteins can be constructed from _____ different amino acids, [20]
41. How many nucleotides code for 1 amino acid? [3]
42. With 3 bases coding for 1 amino acid, how many total codons are possible? [64]
43. The process whereby DNA builds mRNA is known as … [transcription
44. The enzyme needed for transcription is … [RNA polymerase]
45. The first stage of transcription is known as … [initiation]
46. Name a specific sequence within a promoter region. [TATA box, CG
dinucleotide]
47. Transcription is over when RNA polymerase reaches the __________ sequence.
[terminator]
48. Why helicase is not needed during transcription. [RNA polymerase does this as
well as build the mRNA molecule]
49. During the editing process, this is added to the trailing end of the mRNA
molecule. [poly-A tail]
50. Those stretches of the mRNA molecule that actually code for protein. [exons]
51. Location for the splicing and editing of mRNA molecules. [nucleoplasm of the
nucleus]
52. How many stop codons are there? [3]
53. The links which hold 2 amino acids together are known as … [peptide bonds]
54. Possess anticodons. [tRNA molecules]
55. The “t” in tRNA stands for … [transfer]
56. Ribosomes are composed of _____ subunits. [2]
57. Newly arriving tRNA molecules enter the ribosome at its _____ site. [A{
58. A tRNA molecule cannot leave the ribosome until this has formed. [peptide
bond between 2 amino acids]
59. The correct protein is built because a tRNA with a specific _____ only carries one
specific amino acid … [anticodon]
60. … AND that particular anticodon will only match up with the specific _________
being read inside the ribosome. [codon]
61. A stretch of DNA reads:
TACCCCCGCACGCTACGGTATTTTACT
How would codon #3 read? [GCG]
62. What would amino acid #2 be? [Gly]
63. Level of protein structure at which you will find a pleated sheet. [secondary]
64. If a polypeptide must get together with other polypeptides to serve its function,
this protein has achieved the _____________________ level of structure.
[quaternary]
65. A random coil wraps itself around a pleated sheet. This describes the
achievement of which level of structure by a protein? [tertiary]
66. Collagen, elastin, and keratin are 3 proteins which provide an animal body with
… ]structure]
67. Proteins which are important fighters against foreign invaders inside our bodies
are known as … [antibodies]
68. Actin and myosin are important proteins which provide these organs with
function. [muscles]
69. If a protein loses its _____________, it loses its function. [shape, 3-D
configuration]