Download AtREM1, a Member of a New Family of B3 Domain

AtREM1, a Member of a New Family of B3 DomainContaining Genes, Is Preferentially Expressed in
Reproductive Meristems1
José M. Franco-Zorrilla, Pilar Cubas, José A. Jarillo, Begoña Fernández-Calvı́n, Julio Salinas, and
José M. Martı́nez-Zapater*
Departamento de Genética Molecular de Plantas, Centro Nacional de Biotecnologı́a, Campus de la
Universidad Autónoma de Madrid Cantoblanco, 28049 Madrid, Spain (J.M.F.-Z., P.C., J.A.J., J.M.M.-Z.); and
Departamento de Mejora Genética y Biotecnologı́a, Instituto Nacional de Investigación y Tecnologı́a Agraria
y Alimentaria, Carretera de La Coruña, 28040 Madrid, Spain (P.C., J.A.J., B.F.-C., J.S., J.M.M.-Z.)
We have isolated and characterized AtREM1, the Arabidopsis ortholog of the cauliflower (Brassica oleracea) BoREM1.
AtREM1 belongs to a large gene family of more than 20 members in Arabidopsis. The deduced AtREM1 protein contains
several repeats of a B3-related domain, and it could represent a new class of regulatory proteins only found in plants.
Expression of AtREM1 is developmentally regulated, being first localized in a few central cells of vegetative apical
meristems, and later expanding to the whole inflorescence meristem, as well as primordia and organs of third and fourth
floral whorls. This specific expression pattern suggests a role in the organization of reproductive meristems, as well as
during flower organ development.
Plant morphogenesis depends upon the mitotic activity of cells in the shoot apical meristem (SAM).
During the development of the plant, the SAM goes
through different developmental phases, characterized by the type and features of the organs produced:
leaves during the vegetative stage and flowers during the reproductive phase (Poethig, 1990). Transition from vegetative to reproductive development
depends, in most annual plant species, on the acquisition of competence by the SAM and the presence of
specific environmental conditions for temperature
and photoperiod (for review, see Bernier et al., 1993).
The use of experimental genetic systems like Arabidopsis and snapdragon (Antirrhinum majus) has
provided a tool to identify many of the genes involved in the regulation of flowering time and flower
meristem and organ identity in those species. More
than 80 genes whose mutations alter the time to
1
This work was supported by Comisión Interministerial de
Ciencia y Tecnologia (Spain; grant no. AGF98-0206). Support to
research activity at Centro Nacional de Biotecnologı́a is provided
through specific agreement between Consejo Superior de Investigaciones Cientificas and Instituto Nacional de Investigacion y
Tecnologia Agraria y Alimentaria. J.M.F.-Z. was funded by a predoctoral fellowship from Dirección General de Investigación Cientı́fica y Tecnológica (Spain). B.F.-C. was a recipient of a postdoctoral fellowship from Instituto Nacional de Investigacion y
Tecnologia Agraria y Alimentaria (Spain), and P.C. and J.A.J. are
recipients of postdoctoral Ministerio de Educación y Ciencia
(Spain) contracts.
* Corresponding author; e-mail [email protected]; fax
34 –91–5854506.
Article, publication date, and citation information can be found
at www.plantphysiol.org/cgi/doi/10.1104/pp.010323.
418
flower have currently been identified in Arabidopsis,
and many of them have been cloned and characterized at the molecular level (for review, see Koornneef
et al., 1998; Piñeiro and Coupland, 1998; Simpson et
al., 1999). In a similar way, mutations that alter the
identity of flower meristems in Arabidopsis have
allowed the identification of a set of genes required
for the acquisition of flower meristem identity such
as LEAFY and APETALA1 (Mandel et al., 1992; Weigel et al., 1992), as well as other genes like APETALA2
(AP2), CAULIFLOWER, and UNUSUAL FLORAL
ORGANS, whose mutations enhance the phenotype
of lfy and ap1 mutants (Jofuku et al., 1994; Ingram et
al., 1995; Kempin et al., 1995).
In spite of the important role played by the genetic
analysis in the identification of key genes in different
biological processes, the results of current Arabidopsis genome sequencing projects show that only 8% of
the gene sequences identified have been experimentally characterized to date (Lin et al., 1999; Mayer et
al., 1999). This is likely the result of the absence of
detectable phenotypic alterations for mutations at
many loci due to genetic or functional redundancy.
Molecular approaches designed to identify genes
with particular expression patterns have proved to
be useful complementary approaches for the identification of additional genes involved in specific biological processes (Sablowski and Meyerowitz, 1998).
To identify new genes involved in reproductive
development, we constructed a cauliflower (Brassica
oleracea) curd meristem cDNA library highly enriched in clones corresponding to transcripts specific
to reproductive meristems (Franco-Zorrilla et al.,
1999). Screening of this library allowed the character-
Plant Physiology, February
2002,from
Vol.on
128,
pp.14,
418–427,
www.plantphysiol.org
© 2002 American Society of Plant Biologists
Downloaded
June
2017 - Published
by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
AtREM1 Is Preferentially Expressed in Reproductive Meristems
ization of one gene, Brassica oleracea reproductive meristem gene 1 (BoREM1), whose expression was specific
to cauliflower curd meristems arrested in an earlyinflorescence stage of development. BoREM1 belongs
to a gene family in cauliflower and encodes a protein
with features of transcriptional activators, but does
not show homology to any protein of known function
(Franco-Zorrilla et al., 1999). To understand the function of this new gene family in plants, we have isolated the corresponding Arabidopsis gene. Here, we
report the molecular characterization of AtREM1, the
ortholog of BoREM1 in Arabidopsis. AtREM1 belongs
to a large gene family in Arabidopsis. Many REM
family members are present in clusters of tandemly
repeated genes. The deduced proteins of this family
are characterized by the presence of a specific domain that we have named the REM domain. This
domain shares some sequence similarity with the B3
domain found in the superfamily of B3-containing
transcriptional regulators such as VIVIPAROUS1/
ABSCISIC ACID INSENSITIVE 3 (VP1/ABI3; McCarty et al., 1991; Giraudat et al., 1992), FUSCA3
(FUS3; Luerssen et al., 1998), AUXIN RESPONSE
FACTORS (ARFs; Ulmasov et al., 1997, 1999), and
RAV1 (Kagaya et al., 1999). In situ hybridization
analysis shows that AtREM1 expression is restricted
to a few cells in the vegetative SAM and expands to
the whole meristem in the inflorescence. AtREM1 is
also expressed in the central zone of floral meristems
and becomes progressively restricted to specific carpel cell types during the development of the flower.
Finally, plants carrying a T-DNA insertion in
AtREM1 coding sequence do not show any obvious
mutant phenotype, likely as a consequence of gene
duplication.
RESULTS
AtREM1 Belongs to a New Arabidopsis Gene Family
One Arabidopsis gene similar to BoREM1 was initially detected in DNA-blot hybridizations at moderate stringency conditions using different fragments
corresponding to BoREM1 as probes (data not
shown). As BoREM1 is expressed in the meristematic
domes of the cauliflower curd (Franco-Zorrilla et al.,
1999), we screened a cDNA library prepared from
young inflorescences of Arabidopsis (Weigel et al.,
1992) and we isolated a 1,775-bp cDNA. This cDNA,
named AtREM1, contained a long open reading
frame (ORF) starting at position 8, in agreement with
the translation initiation consensus sequence defined
for plants (Lütcke et al., 1987), and ending at position
1,561 (GenBank accession no. AF336344). Sequence
comparison between the AtREM1 cDNA clone and
the available genomic sequence of Arabidopsis revealed the existence of six introns in the AtREM1
genomic sequence and allowed its localization in bacterial artificial chromosome (BAC) clone F28 M20
(accession no. AL031004) from chromosome 4. AddiPlant Physiol. Vol. 128, 2002
tional information on the 5⬘-untranslated region of
AtREM1 was obtained from a genomic clone, and the
transcription start site was mapped 51 bp upstream
of the deduced initiation codon by primer extension
(data not shown).
The deduced AtREM1 protein consists of 517
amino acids with a calculated molecular mass of 58.4
kD (Fig. 1A). It is rich in Lys, Asp, and Glu residues,
which confer to the protein a pI of 5.24. Sequence
analysis revealed the presence of two long (positions
160–282 and 283–418) and one short (position 30–98)
semiconserved characteristic repeats in the AtREM1
deduced protein, referred to as the REM domains.
Approximately 50% of the residues are similar within
these repeats (Fig. 1B). AtREM1 also contains an
acidic domain near the amino terminus, where 75%
of the residues are negatively charged, two stretches
of basic residues, resembling bipartite NLSs (Raikhel,
1992), as well as a putative coiled-coil domain at the
carboxy terminus formed by eight hydrophobic repeats (Fig. 1A). The alignment between AtREM1 and
BoREM1 from cauliflower (Franco-Zorrilla et al.,
1999) showed 61% identity and 73% similarity (Fig.
1A). Proteins of known functions similar to AtREM1
could not be identified in the databases.
As previously observed for BoREM1 in cauliflower
(Franco-Zorrilla et al., 1999), AtREM1 (REM1) also
belongs to a gene family in Arabidopsis. Genomic
DNA sequences from the Arabidopsis Genome Initiative have revealed the existence of at least 23 sequences characterized by the presence of duplicated
REM domains (Table I; Fig. 2). Many of them also
have acidic domains and/or the heptad hydrophobic
repeats at their C-terminal regions. Fourteen of those
sequences are organized as arrays of tandemly repeated sequences. In fact, REM1 is part of a tandem
array of nine related genes in chromosome 4 (Fig.
2B), and there is one additional cluster formed by five
putative gene sequences in chromosome 2 (Fig. 2B).
The rest of the related sequences were found in independent chromosomal positions. REM1 showed
highest similarity to the corresponding BoREM1
from cauliflower, suggesting that AtREM1 is the ortholog gene of BoREM1 (Fig. 2C). Similarity searches
in databases using the REM repeats as a query did
not reveal any similar protein in yeast or animal
systems. However, a consensus sequence within the
REM domain showed similarity to conserved residues within the B3 domain of the superfamily of
B3-containing transcriptional regulators, composed
by VP1/ABI3, FUSCA3, ARFs, and RAVs (Fig. 2D;
McCarty et al., 1991; Giraudat et al., 1992; Ulmasov et
al., 1997, 1999; Luerssen et al., 1998; Kagaya et al.,
1999).
As the characteristic REM domain resembles a
DNA-binding domain and the deduced REM1 protein contains two stretches of basic residues that
could act as NLSs, we studied the subcellular localization of the REM1 protein. For this purpose, we
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
419
Franco-Zorrilla et al.
Figure 1. The deduced AtREM1 protein. A, Alignment of the deduced AtREM1 protein and its ortholog from cauliflower
(accession no. AF051772). Identical residues are in black, and conservative substitutions are in gray. Characteristic domains
of both proteins are as follows: REM domains, including putative nuclear localization signals (NLSs), are underlined. The
acidic domain is enclosed by a box and the putative coiled-coil domain is labeled with black dots under hydrophobic
residues. B, Amino acid alignment of the three REM domains found in AtREM1.
used a translational fusion between REM1 and the
Escherichia coli ␤-glucuronidase (GUS) in transient
expression assays (Varagona et al., 1991). REM1 targeted most GUS activity into the nucleus of onion
(Allium cepa) epidermal cells (Fig. 3). This nuclear
localization of REM1 supports the functionality of the
bipartite NLSs and a nuclear function for REM1.
AtREM1 Is Preferentially Expressed in
Inflorescence Apices
The expression of REM1 was analyzed by RNA-blot
hybridization using poly(A)⫹ RNA from different organs of adult plants. As shown in Figure 4A, a transcript of approximately 2 kb was detected in inflorescence apices, being apparently absent in the rest of the
organs analyzed. A similar result was also obtained in
RT-PCR experiments (Fig. 4B), which showed that
REM1 is also expressed in immature and mature flowers, and in siliques at lower level. To determine the
time course of expression of REM1 in the shoot apex,
we performed RT-PCR experiments using total RNA
isolated from the apex at different times after germination. The results showed that REM1 transcripts
could already be detected in apices excised from 6-dold seedlings grown in petri dishes under long-day
photoperiods, and that their levels slightly increased
as development progressed (Fig. 4C).
420
To analyze the distribution of AtREM1 transcripts
in the plant apex, we performed in situ hybridization
experiments on Arabidopsis apices collected at different times during the development of the plant.
Plants were grown under short-day photoperiods to
extend the period of vegetative development. Sections of plant tissue were hybridized with REM1
digoxygenin-labeled riboprobes. Under those experimental conditions, REM1 mRNA was not detectable
in young seedlings (data not shown). Later, during
vegetative development, 12 to 17 d after sowing
when the SAM was actively producing leaf primordia, REM1 was detected at low levels in the inner cell
layers of the SAM (Fig. 5A). At flowering, the SAM
shape changes and starts producing flower meristems at its periphery. At this time, REM1 was also
detected in the SAM, but its expression differed
quantitatively and qualitatively from the vegetative
expression. The signal was higher and spread
throughout the meristem cell layers (Fig. 5, B and C).
During reproductive development, REM1 was expressed in the shoot apex and during flower development. Although REM1 expression was absent at
stage 1 of flower meristems, it appeared at stage 2 in
the central area of the flower meristem (Fig. 5C). In
later stages 3 and 4, when sepal primordia initiate
and grow to enclose the bud, the AtREM1 hybridization signal became excluded from the developing
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
AtREM1 Is Preferentially Expressed in Reproductive Meristems
Table I. Predicted REM genes found in Arabidopsis databases
REM1
REM2
REM3
REM4
REM5
REM6
REM7
REM8
REM9
REM10
REM11
REM12
REM13
REM14
REM15
REM16
REM17
REM18
REM19
REM20
REM21
REM22
REM23
BAC Accession
Chr.
Gene
AL031004
AL031004
AL031004
AL031004
AL031004
AL031004
AL031004
AL031004
AL031004
AC006954
AC006954
AC006954
AC006954
AC006954
AF013293
AL035678
AC006535
AC005310
AC007504
AL132966
AC018907
AL096859
AL353994
4
4
4
4
4
4
4
4
4
2
2
2
2
2
4
4
1
2
1
3
3
3
5
F28M20.200
F28M20.190
F28M20.190
F28M20.180
F28M20.170
F28M20.160
F28M20.150
F28M20.130
F28M20.120
F27A10.1
F25P17.1
F25P17.2
F25P17.5
F25P17.5
IG5I10.15
F17M5.40
T24P13.6
F19D11.1
F13F21.8
F4P12.10
F28L1.16
T6H20.200
F17I14.30
sepals (Fig. 5, C and D). During stages 5 and 6, when
petal and stamen primordia first became visible, the
hybridization signal was further restricted to the central area of the floral meristem that gives rise to the
gynoecium and to small groups of cells at the tip and
at the base of stamens (Fig. 5, E and F). This latter
group of cells could correspond to the presumptive
nectaries (data not shown). After stage 6, REM1 expression was restricted to the developing gynoecium
being further restricted, during late stage 7, to the
medial ridge of cells (Fig. 5, G and H). At stage 9,
different regions of the gynoecium became morphologically distinct from one another and REM1 mRNA
was detected in the septum, style, and stigma (Fig.
5I). This expression was maintained until the end of
flower development (Fig. 5J). REM1 was also detected in lateral shoot meristems with a similar pattern to that shown in the primary SAM (data not
shown). Thus, in agreement with the results of RNAblot hybridizations and RT-PCR experiments, REM1
was expressed in SAMs throughout development,
although quantitative and qualitative differences
were observed between vegetative and reproductive
expression patterns. Furthermore, REM1 was also expressed in floral meristems from stage 2, with an
expression pattern that became progressively restricted to the gynoecium area that gives rise to the
style, stigma, and septum. Transgenic plants expressing the GUS reporter gene (Jefferson et al., 1987) fused
to the 5⬘-flanking region of REM1 (from ⫺1,212 to
⫹62, relative to the transcriptional start site) reproducibly showed a GUS expression pattern consistent with
the results of RNA-blot hybridization, RT-PCR, and in
situ hybridization (data not shown).
Plant Physiol. Vol. 128, 2002
AtREM1 Knockout Plants Do Not Show
Conspicuous Abnormalities
An Arabidopsis line carrying a T-DNA insertion in
REM1 was identified by PCR screening of the T-DNA
tagged lines obtained by Feldmann (1991). Segregation analysis for resistance to kanamycin revealed the
presence of a unique T-DNA insertion in this line.
Plants homozygous for the insertion were identified
by PCR genotyping, which allowed the amplification
of a single 1-kb PCR product with primers corresponding to the left border of the T-DNA and the 3⬘
end of REM1 sequence, and failed to amplify the 2-kb
fragment with 5⬘ and 3⬘ primers corresponding to the
wild-type genomic sequence (Fig. 6). Sequence determination of the LB/3⬘-PCR product indicated that
the T-DNA was inserted in the coding region of
REM1 just before the Gln codon in position 299 and,
therefore, it might be a null mutation. In fact, RNAblot hybridization and RT-PCR analysis with RNA
obtained from inflorescence apices of this mutant
(rem1-1) failed to detect the accumulation of REM1
transcripts, as well as other mRNA species that could
be derived from alternate splicing of the disrupted
REM1 gene (Fig. 6B). Mutant plants were grown and
analyzed under short- and long-day photoperiodic
conditions and no phenotypic differences were detected regarding flowering time or reproductive development compared with sibling wild-type plants.
DISCUSSION
The identification of AtREM1 demonstrates the validity of using cauliflower meristems to isolate Arabidopsis genes specifically expressed in its reproductive apex. Using a strategy based on the search for
specific expression patterns in pools of enhancer- or
gene-trap lines, Campisi et al. (1999) reported the
isolation of promoter trap lines exhibiting GUS staining patterns in the inflorescence. In fact, one of them
carries one insertion between REM3 and REM4
showing specific inflorescence apex expression
(Campisi et al., 1999; T. Jack, personal communication). Thus, both strategies may contribute to the
identification of new genes expressed in a small
number of cells. Consistent with this, REM genes are
underrepresented in expressed sequence tag (EST)
databases. Only two ESTs from Arabidopsis corresponding to REM-containing genes have been identified. One of them (GenBank accession no.
AV566479), isolated from a green siliques cDNA library, corresponds to REM2, whereas the other one
(accession no. H76710) does not correspond to any
gene listed in Table I. In addition, a rice (Oryza sativa)
EST (accession no. AU30260) from immature leaves
including apical meristems, as well as two tomato
(Lycopersicon esculentum) ESTs from fruits and carpels
(accession nos. AW441198 and AI489095, respectively) can be identified.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
421
Franco-Zorrilla et al.
Figure 2. The REM gene family in Arabidopsis. A, Schematic representation of the deduced REM proteins from predicted
genes found in databases. The REM domains are shown as black boxes. Short stretches of acidic residues are represented
as oval chains, and putative NLSs are represented as triangles. Only seven of the deduced proteins related to REM1 have
heptad hydrophobic repeats at their C terminus (vertical bars in an open box). B, Physical map of a 29-kb genomic region
including REM1 and related sequences in tandem in chromosome 4 and another cluster of related genes in chromosome 2.
ORFs are represented by white boxes and introns are shown with black bars. The direction of the deduced ORFs are
indicated with arrows. DUB-1 corresponds to a gene sequence with similarity with a deubiquitinating enzyme. C, Unrooted
phylogenetic tree showing the relationships among the Arabidopsis REM proteins and BoREM1. Branches with a support of
50 or more are indicated. D, Alignment of consensus sequences from REM domain and B3 domains from ARFs and RAVs
proteins. A consensus at 60% for REM domain was obtained by alignment of one deduced REM domain from each predicted
gene. A consensus for B3 domain from ARFs was obtained from alignment of ARF1 to ARF10 as shown in Ulmasov et al.
(1999), and that corresponding to RAV from alignment of RAV1 and RAV2 as shown in Kagaya et al. (1999). Identical
residues are in black, and conservative substitutions are in gray. Hydrophobic residues (L, V, I, W, F, and Y) are represented
as ␺ and aromatic amino acids (W, F, and Y) are represented as ⌽. Hyphens are introduced for optimization of the alignment.
AtREM1 Contains Three Repetitions of a B3-Related
DNA-Binding Domain
The REM1 deduced protein has features characteristic of regulatory proteins (Figs. 1 and 2). It contains
a distinctive repetition of a basic domain that we
have named the REM domain. This domain is related
to the B3 domain of the VP1/ABI3-ARF family of
transcriptional regulators (McCarty et al., 1991; Giraudat et al., 1992; Ulmasov et al., 1997), which has
been shown to bind DNA in vitro and in vivo (Suzuki
et al., 1997; Ulmasov et al., 1997). In addition to
VP1/ABI3 and ARFs, RAV1 and RAV2 constitute
another group of B3-containing proteins (Okamuro et
al., 1997; Kagaya et al., 1999). This group shows an
additional AP2-DNA-binding domain and it has
been shown that AP2 and B3 domains maintain autonomous DNA-binding activities to different DNA
motifs (Kagaya et al., 1999). Consensus sequences
alignment in Figure 2D shows that the REM domain
shares 28% to 30% similarity to both types of B3
422
domains, which are more related between them (45%
similarity). Therefore, the REM domain is more distantly related to the B3 domain found in ARFs and
RAVs families of transcriptional regulators. The presence of a putative DNA-binding domain, a functional
NLS, and the acidic domain, which has been proposed to function as an activation domain (Mitchell
Figure 3. Subcellular localization of REM1 protein. A, Histochemical GUS detection in a transient expression analysis on epidermal
onion cells of a REM1-GUS fusion protein. B, 4,6-Diamidino-2phenylindole staining of the same group of cells.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
AtREM1 Is Preferentially Expressed in Reproductive Meristems
genes become expressed in complementary regions.
Another B3-containing gene, ETT/ARF3, is also expressed in inflorescence meristems and in developing flowers, although flower expression pattern does
not coincide with that of REM1 (Sessions et al., 1997).
Thus, the pattern of expression of REM1 in the SAM,
flower meristems, and in carpels suggests a role for
this gene in different aspects of reproductive development. The lack of an obvious phenotypic alteration
in the T-DNA insertion mutant of REM1, likely due
to genetic redundancy, precludes having a clue of the
role of this gene in plant development. In this way, at
least one homologous gene in the REM1 cluster,
REM3, could also have a redundant function because
its promoter-driven GUS expression suggests that it
is expressed with a similar pattern (T. Jack, personal
communication).
Figure 4. Expression analysis of REM1. A, An RNA blot containing
1.5 ␮g of poly(A)⫹ RNA from different organs of Arabidopsis was
hybridized with the cDNA REM1 and a probe corresponding to
ribosomal protein L3 as a control for gel loading (RBP4; Kim et al.,
1990). B, Expression analysis of AtREM1 and AP2 by reverse transcriptase (RT)-PCR in different organs from adult plants. RT-PCR
products were blotted onto membranes and hybridized with the
corresponding probes. C, RT-PCR analysis of expression of REM1 in
apices from young seedlings at different stages of development. C,
Cotyledon and hypocotyl from young seedlings; IA, inflorescence
apex; IF, immature flower, before anthesis; L, leaf; MF, flower at
anthesis; R, root; S, stem; Sq, silique.
and Tjian, 1989), suggests that REM1 can function as
a transcriptional regulator. In addition, the presence
of a putative coiled-coil domain in its carboxy terminus suggests that it could specifically interact with
other proteins (O’Shea et al., 1989).
AtREM1 Expression Pattern Suggests a Role in
Reproductive Development
Different B3-containing proteins have been involved in different aspects of plant development
from seed maturation (ABI3) and embryo development (MON/ARF5) to reproductive development
(ETT/ARF3) (Giraudat et al., 1992; Sessions et al.,
1997; Hardtke and Berleth, 1998). REM1 has a very
specific pattern of transcript accumulation in the
SAM, starting in a few cells in the L3 layer of the
vegetative SAM and expanding to the three meristematic layers in the inflorescence meristem (Fig. 4,
A and B). Some genes are involved in flower transition, such as AGL20 in Arabidopsis, SaMADS A, the
putative ortholog of AGL20 in white mustard (Sinapis
alba), and AGL8/FRUITFUL are also expressed in the
SAM (Mandel and Yanofsky, 1995; Menzel et al.,
1996; Gu et al., 1998; Lee et al., 2000). Furthermore,
the expression pattern of REM1 during flower development from stage 2 until stage 7 is coincident to that
observed for AGL8/FUL (Fig. 4). Expression of REM1
and AGL8/FUL differs from that stage on, when both
Plant Physiol. Vol. 128, 2002
The REM Gene Family
REM1 belongs to a large gene family characterized
by the presence of one to six REM repeats. Most of
them also show predicted acidic regions and potential NLSs, but the predicted coiled-coil region is a
feature characteristic of REM1 and other deduced
proteins in the cluster on chromosome 4 (Fig. 2A).
Thus, the presence of the B3-related domain or REM
domain identifies a new gene family formed by more
than 20 putative genes in Arabidopsis. As with other
groups within the B3 superfamily of transcription
factors, the REM family is present only in plants; no
related proteins have been found in any bacterial,
fungal, or animal sequence present in databases.
Successive genome duplication events have likely
generated the repeated intragenic structure, as well
as the tandem duplicated arrays of REM genes found
in different chromosomes. The low sequence similarity observed between REM sequences in the cluster of
chromosome 2 and those in the cluster on chromosome 4 indicates that they do not derive from a recent
duplication event. In fact, BAC F28 m20 containing
REM1 is part of a 664-kb region in chromosome 4 that
is duplicated in chromosome 2 (Blanc et al., 2000). In
general, REM genes are more related within each
cluster than between clusters. In this way, most of the
deduced proteins encoded by gene sequences in the
chromosome 4 cluster contain heptad hydrophobic
repeats at their C terminus (Fig. 2A) that are absent in
other REM family members. Thus, REM genes in the
cluster on chromosome 4, with the exception of
REM7, could constitute a subgroup within the REM
family. It is likely that duplications and divergence
within clusters were originated after the chromosome duplication.
Among all the REM sequences found in Arabidopsis, AtREM1 is the most related at nucleotide and
amino acid sequence level to BoREM1 from cauliflower (Figs. 1A and 2C). Furthermore, AtREM1 is
more related to BoREM1 than to any other REM-like
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
423
Franco-Zorrilla et al.
Figure 5. Expression patterns of REM1 during Arabidopsis development. RNA in situ hybridization of Arabidopsis (ecotype
Col) probed with REM1. All sections are longitudinal. A, 17-short-day rosette. The SAM, vm, produces leaves in its periphery.
REM1 signal is absent from L1 and is not detected in leaf primordia. B, Inflorescence SAM, im, and young floral meristems.
Signal is detected in all three layers of the im. In stage 1 flower, REM1 mRNA is not detectable. In stage 2 flowers, REM1
is expressed in the central area of the floral dome. Arrows indicate the sepal anlagen. C, Stage 2 and 3 flowers showing REM1
expression excluded from the sepal anlagen. D, Stage 3 and 4 flower. E, Stage 5 flower. Stamen primordia are now visible.
REM1 signal becomes restricted to the carpel anlagen. F, Stage 6 flower. G, Stage 7 flower. H, Stage 7 and 8 flower, REM1
mRNA accumulates in the medial ridge. I, Stage 9 flower. REM1 is expressed in the septum, style, and stigma. J, Stage 12
flower shortly before anthesis. REM1 expression is detected in the stigma and septum. Controls using REM1 sense probes
gave no signal (not shown). vm, Vegetative SAM; im, inflorescence SAM; l, leaf primordia; s, sepal; p, petal; st, stamen; c,
carpel. The numbers indicate stages according to Smyth et al. (1990).
sequence in the Arabidopsis genome. This would
indicate that the chromosomal duplication that gave
rise to segments of chromosomes 2 and 4, as well as
former events of gene duplication within the
AtREM1 cluster, predate the divergence of the Brassica and Arabidopsis genus. This conclusion is consistent with previous observations of extensive duplication and colinearity between Brassica and
Arabidopsis genomes (Schmidt, 2000).
In conclusion, we have identified a new family of
putative regulatory proteins in Arabidopsis. The specific tissue expression patterns of at least two of the
424
members (Campisi et al., 1999) suggest a role for
some of the encoded proteins in the regulation of the
vegetative to reproductive transition, as well as in
carpel development. Unfortunately, genetic redundancy precludes the generation of mutant phenotypes, and the tandem array of the genes requires
strategies that allow the generation of knockouts for
several genes simultaneously. We hope that deletion
of several or all the REM related genes in BAC F28
m20 on chromosome 4 would provide information
about the role of this set of genes in Arabidopsis
reproductive development.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
AtREM1 Is Preferentially Expressed in Reproductive Meristems
Figure 6. A, Isolation of a mutant line carrying a T-DNA insertion in REM1. Map of the insertion of the T-DNA in the coding
sequence of REM1. Exons are represented with boxes and characteristic domains of REM1 are as in Figure 1. Between the
left border of the T-DNA (LB) and REM1, a 16-bp fragment of unknown derivation was found (underlined sequence). B,
REM1 expression in wild-type and in two rem1 homozygous lines. 1 and 2 denote different concentrations of cDNA
employed in PCR reactions (see “Materials and Methods”). PCR corresponding to Trp synthase ␤-subunit was used as a
control.
MATERIALS AND METHODS
Plant Materials and Growth Conditions
Arabidopsis plants used in this work belonged to Landsberg erecta, Columbia (Col), and Wassilewskija-2 ecotypes.
Plants were grown at 22°C under long-day (16 h of light) or
short-day (8 h of light) conditions, at an intensity of 140 ␮E
m⫺2 s⫺1 in a mixture of soil:vermiculite (3:1). For some
experiments, plants were grown under sterile conditions in
petri dishes containing Murashige and Skoog salts supplemented with 1% (w/v) Suc and solidified with 0.8% (w/v)
agar.
Isolation of cDNA and Genomic Clones
Corresponding to AtREM1
A cDNA library prepared from young inflorescences of
Arabidopsis (ecotype Landsberg erecta; Weigel et al., 1992)
was screened (5 ⫻ 105 pfu) with the CM6.2 fragment (287
bp) corresponding to the 3⬘ end of BoREM1 (FrancoZorrilla et al., 1999). Hybridization was performed at 55°C
using standard procedures (Sambrook et al., 1989). Eight
phages giving positive hybridization were identified, and
plasmids were excised in vivo and converted into EcoRIXhoI inserts in pBS SK (Stratagene, La Jolla, CA). A
genomic clone was isolated from an Arabidopsis (ecotype
Col) genomic DNA library in a ␭GEM11 (Promega, Madison, WI) after screening with the AtREM1 cDNA using
standard procedures (Sambrook et al., 1989). A 4-kb EcoRI
restriction fragment was cloned in pBS KS, and different
restriction fragments were subcloned for sequence determination. The transcription start site for AtREM1 was identified by primer extension analysis (Sambrook et al., 1989)
using the primer 5⬘-AATGGTTTGTCTCCGGTACG-3⬘ for
reverse transcription and 1 ␮g of poly(A)⫹ RNA from
inflorescence apices as template.
DNA Sequencing and Analysis
Sequencing was carried out using Sequenase Ver 2.0
(U.S. Biochemical Corp., Cleveland) and synthetic primers.
All sequences were analyzed for similarity to databases
using the internet site of the National Center for BiotechPlant Physiol. Vol. 128, 2002
nology Information (http://www.ncbi.nlm.nih.gov) and
The Arabidopsis Information Resource (http://www.
Arabidopsis.org), running the BLAST programs (Altschul
et al., 1990). Other sequence analysis and manipulations
were carried out using the PC-Gene (IntelliGenetics, Mountain View, CA) and GCG (Genetics Computer Group, Madison, WI) packages. To construct the phylogenetic tree,
predicted proteins were aligned with CLUSTALW, 100
bootstrapped data sets were obtained with SEQBOOT, distance matrices were calculated with PROTDIST-Dayhoff
PAM matrix algorithm, trees were constructed with
NEIGHBOR, and a consensus tree was obtained with CONSENSE. SEQBOOT, PROTDIST, NEIGHBOR, and CONSENSE are from the PHYLIP package (Felsenstein, 1989).
RNA Isolation and Analysis
Isolation of total and poly(A)⫹ RNA and northern hybridizations were previously described (Franco-Zorrilla et al.,
1999). Minipreparations of plant RNA were performed using the FastRNA Green Kit (Bio 101, Vista, CA) followed by
a treatment with RNase free DNaseI (Roche Molecular Biochemicals, Summerville, NJ). RNAs were quantified and
their integrity was tested in ethidium bromide-stained agarose gels. For RT-PCR reactions, 250 ng (for 50-␮L reactions)
of RNA was used as template in one-step RT-PCR reactions
with GeneAmp Thermostable rTth Reverse Transcriptase
RNA PCR kit (PerkinElmer, Norwalk, CT). First-strand
synthesis was accomplished from downstream primer
5⬘-CCGTCTTCTCCGATATGTTC-3⬘. PCR with the same
primer and the oligonucleotide 5⬘-TACCGGAGACAAACCATTTC-3⬘ subsequently allowed the amplification of a 397-bp cDNA fragment. As a control for RT-PCR
reactions, we used the AP2 gene as in Putterill et al.
(1995). In all cases, reverse transcription was carried out at
63°C for 30 min, followed by a PCR reaction at 94°C for
45 s and 63°C for 45 s for 30 cycles. PCR reactions were
loaded in 1.7% (w/v) agarose gels, transferred onto Hybond N⫹ membranes, and hybridized with the corresponding DNA probes. RT-PCR experiments were performed at least twice with different RNA samples, and a
representative result is presented.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
425
Franco-Zorrilla et al.
In Situ Hybridization
Digoxygenin labeling of RNA probes, tissue preparation,
and hybridization were done as described by Coen et al.
(1990). The REM1 probe used was designed to prevent
cross-hybridization with other REM genes. To obtain a
3⬘-1,250-bp insert as a template for REM1 riboprobes synthesis, the REM1 cDNA was digested with XbaI and religated in pBS SK. The hybridized sections were visualized
with Nomarski optics.
Transient Transformation of Onion (Allium cepa)
Epidermis Cells
The construct for transient expression was generated by
fusing a PCR-amplified full-length REM1 cDNA in frame
to the GUS reporter gene into the vector pBI221 from
CLONTECH (Palo Alto, CA). Transformation of onion epidermal cells using a PDS 1000 helium particle gun (BioRad, Hercules, CA) and histochemical staining were performed as described in Varagona et al. (1991).
Isolation of the Insertional T-DNA Line rem1
A total of 6,000 Arabidopsis (ecotype Wassilewskija-2)
T-DNA-tagged lines (Feldmann, 1991) in six pools of 1,000
lines each was PCR-screened for an insertion in REM1 with
oligonucleotides ARA6 5⬘-AAATTTCGTACCGGAGACAAACCATTTCTC-3⬘ and ARA7 5⬘-TCTTTGTTTCTTTCCCCATCTTCAGTCTCAC-3⬘ corresponding to 5⬘ and 3⬘
ends of REM1, respectively, and LB-RB primers as in
Krysan et al. (1996) for T-DNA borders. After identification
of a positive pool, a bidimensional secondary screening
(Azpiroz-Leehan and Feldmann, 1997) was performed with
oligonucleotides LB and ARA7 on 20 DNA pools from 100
lines each, which allowed the identification of a 10-line
subpool. Seeds corresponding to 10 individual lines were
grown to isolate the rem1 mutant. PCR performed with
ARA6 and RB primers failed to amplify any fragment,
probably due to a partial deletion of the region of the right
border homologous to RB primer. PCR reactions were performed in a 2400 thermocycler (PerkinElmer) at 94°C for
30 s, at 68°C for 1 min, and at 72°C for 1 min 30 s, 35 cycles.
For RT-PCR expression studies in rem1 homozygous lines,
5 ␮g of total RNA from inflorescence apices was treated
with DNase and was employed in first-strand cDNA synthesis using SuperScript II (Gibco-BRL, Grand Island, NY)
and an oligo T17 as primer. cDNAs were 250- and 500-fold
diluted in subsequent PCR reactions. Primers used in these
experiments were ARA6 and ARA7 for REM1 expression
and CTCATGGCCGCCGGATCTGA and CTTGTCTCTCCATATCTTGAGCA corresponding to TS␤1 as a control
(Berlyn et al., 1989).
ACKNOWLEDGMENTS
We thank the Arabidopsis Biological Resource Center,
Ohio State University (Columbus), for providing the DNA
pools corresponding to the Feldmann collection and the
cDNA library, and Dr. Nigel Crawford for supplying the
426
genomic DNA library. We thank Dr. Thomas Jack for sharing unpublished results and for his critical reading of the
manuscript.
Received April 4, 2001; returned for revision June 13, 2001;
accepted August 11, 2001.
LITERATURE CITED
Altschul F, Gish F, Miller W, Myers EW, Lipman DJ
(1990) Basic local alignment search tool. J Mol Biol 215:
403–410
Azpiroz-Leehan R, Feldmann KA (1997) T-DNA insertion
mutagenesis in Arabidopsis: going back and forth. Trends
Genet 13: 152–156
Berlyn MB, Last RL, Fink GR (1989) A gene encoding the
tryptophan synthase beta subunit of Arabidopsis thaliana.
Proc Natl Acad Sci USA 86: 4604–4608
Bernier G, Havelange A, Houssa C, Petitjean A, Leujeune
P (1993) Physiological signals that induce flowering.
Plant Cell 5: 1147–1155
Blanc G, Barakat A, Guyot R, Cooke R, Delseny M (2000)
Extensive duplication and reshuffling in the Arabidopsis
genome. Plant Cell 12: 1093–1101
Campisi L, Yang Y, Yi Y, Heilig E, Herman B, Cassista AJ,
Allen DW, Xiang H, Jack T (1999) Generation of enhancer trap lines in Arabidopsis and characterization of
expression patterns in the inflorescence. Plant J 17:
699–707
Coen ES, Romero JM, Doyle S, Elliott R, Murphy G,
Carpenter R (1990) floricaula: a homeotic gene required
for flower development in Antirrhinum majus. Cell 63:
1311–1322
Feldmann KA (1991) T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum. Plant J 1: 71–82
Felsenstein J (1989) PHYLIP: Phylogeny Inference Package
(Version 3.2). Cladistics 5: 164–166
Franco-Zorrilla JM, Fernández-Calvı́n B, Madueño F,
Cruz-Alvarez M, Salinas J, Martı́nez-Zapater JM (1999)
Identification of genes specifically expressed in cauliflower reproductive meristems: molecular characterization of BoREM1. Plant Mol Biol 39: 427–436
Giraudat J, Hauge BM, Valon C, Smalle J, Parcy F, Goodman HM (1992) Isolation of the Arabidopsis ABI3 gene by
positional cloning. Plant Cell 4: 1251–1261
Gu Q, Ferrándiz C, Yanofsky MF, Martienssen R (1998)
The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125: 1509–1517
Hardtke CS, Berleth T (1998) The Arabidopsis gene
MONOPTEROS encodes a transcription factor mediating
embryo axis formation and vascular development.
EMBO J 17: 1405–1411
Ingram GC, Goodrich J, Wilkinson MD, Simon RD,
Haughn GW, Coen ES (1995) Parallels between unusual
floral organs and fimbriata, genes controlling flower development in Arabidopsis and Antirrhinum. Plant Cell 7:
1501–1510
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 128, 2002
AtREM1 Is Preferentially Expressed in Reproductive Meristems
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: ␤-glucuronidase as a sensitive and versatile gene
fusion marker in higher plants. EMBO J 6: 3901–3907
Jofuku KD, den Boer BGW, Van Montagu M, Okamuro
JK (1994) Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 6:
1211–1225
Kagaya Y, Ohmiya K, Hattori T (1999) RAV1, a novel DNA
binding protein, binds to bipartite recognition sequence
through two distinct DNA-binding domains uniquely
found in higher plants. Nucleic Acids Res 27: 470–478
Kempin SA, Savidge B, Yanofsky MF (1995) Molecular
basis of the cauliflower phenotype in Arabidopsis. Science
267: 522–525
Kim Y, Zhang H, Scholl RL (1990) Two evolutionary divergent genes encode a cytoplasmic ribosomal protein in
Arabidopsis thaliana. Gene 93: 177–182
Koornneef M, Alonso-Blanco C, Peeters AJM, Soppe W
(1998) Genetic control of flowering time in Arabidopsis.
Annu Rev Plant Physiol Plant Mol Biol 49: 43–48
Krysan PJ, Young JC, Tax F, Sussman MR (1996) Identification of transferred DNA insertions within Arabidopsis
genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA 93: 8145–8150
Lee H, Suh SS, Park E, Cho E, Ahn JH, Kim SG, Lee JS,
Kwon YM, Lee I (2000) The AGAMOUS-LIKE 20 MADS
domain protein integrates floral inductive pathways in
Arabidopsis. Genes Dev 14: 2366–2376
Lin X, Kaul S, Rounsley S, Shea TP, Benito MI, Town CD,
Fujii CY, Mason T, Bowman C, Barnstead M et al.
(1999) Sequence and analysis of chromosome 2 of the
plant Arabidopsis thaliana. Nature 402: 761–768
Luerssen K, Kirik V, Herrmann P, Misera S (1998)
FUSCA3 encodes a protein with a conserved VP1/ABI3like B3 domain which is of functional importance for the
regulation of seed maturation in Arabidopsis thaliana.
Plant J 15: 755–764
Lütcke HA, Chow KC, Mickel FS, Moss KA, Kern HF,
Scheele GA (1987) Selection of AUG initiation codons
differs in plants and animals. EMBO J 6: 43–48
Mandel MA, Gustafson-Brown C, Savidge B (1992) Molecular characterization of the Arabidopsis floral homeotic
gene APETALA1. Nature 360: 273–277
Mandel MA, Yanofsky MF (1995) The Arabidopsis AGL8
MADS box gene is expressed in the inflorescence meristems and is negatively regulated by APETALA1. Plant
Cell 7: 1763–1771
Mayer K, Schuller C, Wambutt R, Murphy G, Volckaert
G, Pohl T, Dusterhoft A, Stiekema W, Entinn KD,
Terryn N et al. (1999) Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana. Nature 402:
769–777
McCarty DR, Hatori T, Carson CB, Vasil V, Lazar M,
Vasil IK (1991) The Viviparous-1 developmental gene of
maize encodes a novel transcriptional activator. Cell 66:
895–905
Plant Physiol. Vol. 128, 2002
Menzel G, Apel K, Melzer S (1996) Identification of two
MADS box genes that are expressed in the apical meristem of the long-day plant Sinapis alba in transition to
flowering. Plant J 9: 399–408
Mitchell PJ, Tjian R (1989) Transcriptional regulation in
mammalian cells by sequence-specific DNA binding proteins. Science 245: 371–378
Okamuro JK, Caster B, Villarroel R, Van Montagu M,
Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in
Arabidopsis. Proc Natl Acad Sci USA 94: 7076–7081
O’Shea EK, Rutkowski R, Kim PS (1989) Evidence that the
leucine zipper is a coiled coil. Science 243: 538–542
Piñeiro M, Coupland G (1998) The control of flowering
time and floral identity in Arabidopsis. Plant Physiol
117: 1–8
Poethig RS (1990) Phase change and the regulation of
shoot morphogenesis in plants. Science 250: 923–930
Putterill J, Robson F, Lee K, Simon R, Coupland G (1995)
The CONSTANS gene of Arabidopsis promotes flowering
and encodes a protein showing similarities to zinc finger
transcription factors. Cell 80: 847–857
Raikhel N (1992) Nuclear targeting in plants. Plant Physiol
100: 1627–1632
Sablowski RWM, Meyerowitz EM (1998) A homolog of
NO APICAL MERISTEM is an immediate target of the
floral homeotic genes APETALA3/PISTILLATA. Cell 92:
93–103
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
Schmidt R (2000) Synteny: recent advances and future
prospects. Curr Opin Plant Biol 3: 97–102
Sessions A, Nemhauser JL, McColl A, Roe JL, Feldmann
KA, Zambryski PC (1997) ETTIN patterns the Arabidopsis
floral meristem and reproductive organs. Development
124: 4481–4491
Simpson GG, Gendall AR, Dean C (1999) When to switch
to flowering. Annu Rev Cell Dev Biol 15: 519–550
Smyth DR, Bowman JL, Meyerowitz EM (1990) Early
flower development in Arabidopsis. Plant Cell 2: 755–767
Suzuki M, Kao CK, McCarty D (1997) The conserved
domain of VIVIPAROUS1 has a cooperative DNA binding activity. Plant Cell 9: 799–807
Ulmasov T, Hagen G, Guilfoyle TJ (1997) ARF1, a transcription factor that binds to auxin response elements.
Science 276: 1865–1868
Ulmasov T, Hagen G, Guilfoyle TJ (1999) Dimerization
and DNA binding of auxin response factors. Plant J 19:
309–319
Varagona MJ, Schmidt RJ, Raikhel NV (1991) Monocot
regulatory protein Opaque-2 is localized in the nucleus
of maize endosperm and transformed tobacco plants.
Plant Cell 3: 105–113
Weigel D, Alvarez J, Smyth DR, Yanofsky MF, Meyerowitz EM (1992) LEAFY controls floral meristem identity
in Arabidopsis. Cell 68: 843–859
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2002 American Society of Plant Biologists. All rights reserved.
427