Download Nucleolar targeting of BN46/51 - Journal of Cell Science

1159
Journal of Cell Science 112, 1159-1168 (1999)
Printed in Great Britain © The Company of Biologists Limited 1999
JCS0136
Cloning, sequencing, and nucleolar targeting of the basal-body-binding
nucleolar protein BN46/51
Gina M. Trimbur, Jennifer L. Goeckeler, Jeffrey L. Brodsky and Charles J. Walsh*
Department of Biological Sciences, University of Pittsburgh, Pittsburgh, PA 15260, USA
*Author for correspondence (e-mail: [email protected])
Accepted 22 January; published on WWW 23 March 1999
SUMMARY
BN46/51 is an acidic protein found in the granular
component of the nucleolus of the amebo-flagellate
Naegleria gruberi. When Naegleria amebae differentiate
into swimming flagellates, BN46/51 is found associated with
the basal body complex at the base of the flagella. In order
to determine the factors responsible for targeting BN46/51
to a specific subnucleolar region, cDNAs coding for both
subunits were isolated and sequenced. Two clones, JG4.1
and JG12.1 representing the 46 kDa and 51 kDa subunits,
respectively, were investigated in detail. JG12.1 encoded a
polypeptide of 263 amino acids with a predicted size of 30.1
kDa that co-migrated with the 51 kDa subunit of BN46/51
when expressed in yeast. JG4.1 encoded a polypeptide of
249 amino acids with a predicted size of 28.8 kDa that comigrated with the 46 kDa subunit of BN46/51. JG4.1 was
identical to JG12.1 except for the addition of an aspartic
acid between positions 94 and 95 of the JG12.1 sequence
and the absence of 45 amino acids beginning at position
113. The predicted amino acid sequences were not closely
related to any previously reported. However, the sequences
did have 26-31% identity to a group of FKPBs (FK506
binding proteins) but lacked the peptidyl-prolyl cis-trans
isomerase domain of the FKBPs. Both subunits contained
two KKE and three KKX repeats found in other nucleolar
proteins and in some microtubule binding proteins. Using
‘Far Western’ blots of nucleolar proteins, BN46/51 bound
to polypeptides of 44 kDa and 74 kDa. The 44 kDa
component was identified as the Naegleria homologue of
fibrillarin. BN46/51 bound specifically to the nucleoli of
fixed mammalian cells, cells which lack a BN46/51 related
polypeptide. When the JG4.1 and JG12.1 cDNAs were
expressed in yeast, each subunit was independently
targeted to the yeast nucleolus. We conclude that BN46/51
represents a unique nucleolar protein that can form specific
complexes with fibrillarin and other nucleolar proteins. We
suggest that the association of BN46/51 with the MTOC of
basal bodies may reflect its role in connecting the nucleolus
with the MTOC activity for the mitotic spindle. This would
provide a mechanism for nucleolar segregation during the
closed mitosis of Naegleria amebae.
INTRODUCTION
structures. CMT often seem to arise from these surrounding
components, rather than from the basal bodies themselves (see,
for example, Fulton, 1971).
In the amebo-flagellate Naegleria gruberi two of the
potential roles of basal bodies, organization of the flagellar
axoneme and the sites of MTOC activity for CMT, are
temporally separated. Naegleria amebae lack centrioles as well
as basal bodies and CMT while flagellates possess basal
bodies, flagella and CMT (Fulton and Dingle, 1971; Walsh,
1984). During the differentiation of amebae into swimming
flagellates, basal bodies form 55 to 60 minutes after initiation
and about 10 minutes before the flagella become visible on the
cell surface (Dingle and Fulton, 1966; Fulton and Dingle,
1971; Walsh, 1984). However it is not until some 20 minutes
later, when the flagella have elongated to near their full length,
that a large complex of CMT forms from the basal body region
(Walsh, 1984).
To characterize the non-tubulin components of the Naegleria
Basal bodies and centrioles are frequently associated with
microtubule organizing centers (MTOCs). In the case of
centrioles it seems clear that it is not the centrioles themselves
but the surrounding material, the centrosome or pericentriolar
material, that is the site of MTOC activity (reviewed by
Baluska et al., 1997; Joshi, 1994). The role of basal bodies, if
any, in MTOC activity is less well understood.
Three kinds of microtubules are usually associated with
basal bodies. The doublet microtubules of the flagellar
axoneme are direct extensions of the triplet microtubules of the
basal body wall while the single central pair microtubules of
the axoneme arise from the distal surface of the basal body. In
addition many basal bodies are associated with arrays of
cytoplasmic microtubules (CMT). However, it is unclear where
the MTOC activity lies that gives rise to these CMT. Basal
bodies frequently exist as complexes with various accessory
Key words: Naegleria, BN46/51, Fibrillarin, Nucleolus, Yeast,
FK506
1160 G. M. Trimbur and others
basal body complex, monoclonal antibodies (mAbs) were
developed against proteins derived from a basal body fraction
(Trimbur and Walsh, 1992). The mAb BN5.1 was identified
based on its specific reaction to the basal body region. BN5.1
also reacts with the large central nucleolus of both amebae and
flagellates. The BN46/51 antigens from both the basal body
complex and from nucleoli were isolated, characterized and
proved to be identical. When solubilized from nucleoli or from
basal body fractions, the antigen was a complex of
approximately equal amounts of two subunits with molecular
masses of 46 kDa and 51 kDa and pIs of 5.0 and 4.9,
respectively (Trimbur and Walsh, 1992). Both subunits were
recognized by BN5.1. This protein was named BN46/51.
Analysis of the cytoplasmic appearance of BN46/51 during
the differentiation demonstrated that BN46/51 is absent when
basal bodies form or as the flagellar axoneme elongates, but
BN46/51 appears when the cytoplasmic microtubule complex
elongates from the basal body region. When flagellates
spontaneously revert to amebae with the abrupt loss of the
CMT, BN46/51 disappears from the cytoplasm, although the
nucleolar concentration of BN46/51 remains constant during
the formation of flagellates and the reversion to amebae
(Trimbur and Walsh, 1992).
BN46/51 is restricted to the granular component (GC) of
Naegleria nucleoli (Trimbur and Walsh, 1993), a region where
ribosomes are assembled and from which they exit the nucleus
(reviewed by Hadjiolov, 1985). BN46/51 is also restricted to
the GC-like cortex of nucleolus-like particles (NLPs) which
assemble in vitro from extracts of Naegleria nucleoli (Trimbur
and Walsh, 1993). Thus BN46/51 is specifically targeted to a
subnucleolar region both in vivo and in vitro and BN46/51 has
the unusual property of associating with the basal body region
only when this region acts as an MTOC.
The mechanism of nucleolar targeting is poorly
understood (reviewed by Olson, 1990; Shaw and Jordan,
1995). To test whether nucleolar targeting of BN46/51 is
intrinsic to the individual subunits or the heterodimer, or
requires additional components, we have further
characterized the genetic, cellular and biochemical
properties of this protein. We describe two cDNA clones,
JG4.1 and JG12.1, that represent the mRNAs for the 46 kDa
and the 51 kDa subunits of BN46/51. We also measured the
in vitro association of BN46/51 with nucleoli of mammalian
cells, the binding of BN46/51 to other nucleolar proteins on
western blots, and the in vivo targeting of both BN46/51
subunits to yeast nucleoli. We conclude that BN46/51 is a
novel nucleolar protein that binds specifically to fibrillarin
and other nucleolar proteins in vitro and to the nucleoli of
fixed cells, and that the BN46/51 subunits are individually
targeted to the nucleolus in vivo.
MATERIALS AND METHODS
Cell culture and fluorescence microscopy
Amebae of Naegleria gruberi strain NB-1 (Fulton, 1970, 1977) were
grown on NM agar with a lawn of Klebsiella pneumoniae as
previously described (Fulton and Dingle, 1967). Amebae were
harvested and washed free of bacteria in ice-cold 2 mM Tris-HCl (pH
7.6).
M15 cells (M1536-B3, parietal endoderm-like mouse cell line)
(Chung et al., 1977) were maintained in DMEM (Dulbecco’s modified
eagle medium, Gibco) supplemented with 10% fetal calf serum
(Gibco-heat inactivated), 2 mM glutamine and 0.1 mM βmercaptoethanol at 37°C in a humidified incubator with 5% CO2.
Cells were prepared for indirect immunofluorescence by growth on
sterile microscope slides. When the cells were 60-70% confluent, the
slides were rinsed briefly 3 times with TBS (50 mM Tris-HCl, pH 7.4,
200 mM NaCl) followed by either immersion into ice-cold methanol
for 10 minutes or ice-cold SPMG (63 mM sucrose, 25 mM sodium
phosphate pH 7.2, 2.5 mM MgCl, and 0.5 mM EGTA) – 1%
formaldehyde for 10 minutes followed by immersion in ice-cold
methanol for 10 minutes. M15 cells were incubated with antibody as
described below. Either fixation method was satisfactory for labeling
with the AH6 mAb, although the DE6 mAb labeled nucleoli more
consistently when the cells were fixed first in formaldehyde.
3T3 cells grown on coverslips, as above, were lysed by incubation
in 80 mM Pipes-KOH, pH 6.8, 1 mM MgCl2, 1 mM EGTA, 0.5%
Triton X-100 and 10% glycerol (lysis buffer) for 5 minutes at 30°C
(Lieuvin et al., 1994). Following lysis, cells were fixed in −20°C
methanol for 6 minutes. Fixed cells were incubated in a Triton X-100
soluble extract of amebae containing BN46/51 (Trimbur and Walsh,
1992) or in buffer for 30 minutes at room temperature in a humid
atmosphere. Following 3 washes with lysis buffer, coverslips were
incubated in primary antibody for 60 minutes at 37°C, washed 3 times
with TBS, incubated for 60 minutes at 37°C in FITC-labeled goat antimouse IgG and washed 3 times in TBS before being mounted in 90%
glycerol, 10% 0.1 M Na2CO3 pH 9.6, containing 100 mg/ml of 1,4diazabicyclo[2.2.2]octane (Langanger et al., 1983). Photography was
carried out as previously described (Trimbur and Walsh, 1992).
Yeast cells were initially grown as described below, fixed in
formaldehyde, and the cell wall digested as described (Kilmartin and
Adams, 1984). In later experiments cells were fixed in formaldehyde,
digested with zymolase, placed on polylysine coated slides, and
stained with first and second antibody as described (Pringle et al.,
1991). Images in Fig. 10 were collected with a digital camera
(Hamamatsu) and graphics were prepared using Photoshop software
(Adobe V.4.0.1).
Characterization and expression of BN46/51 cDNAs
RNA was isolated from mid-log phase amebae (Chomczynski and
Sacchi, 1987). Poly(A)+ RNA was isolated using an oligo(dT) column
as previously described (Shea and Walsh, 1987). A cDNA library was
prepared in the Lambda ZAPII vector using oligo(dT) as a primer and
the kit provided by Stratagene. Plaques expressing the antigen
recognized by BN5.1 were identified by the plaque lift technique
(Sambrook et al., 1989) and purified by three rounds of subcloning.
Positive clones were excised into the Bluescript II SK− phagemid
(Stratagene) according to the manufacturer’s specifications. Both
strands of the cDNAs were sequenced by the dideoxy method (USB
corporation).
For expression in Saccharomyces cerevisiae, cDNAs were excised
with EcoRI and XhoI and subcloned into the identical sites of the
GAL1-inducible pYES2 expression vector (Invitrogen). After initial
selection on complete medium lacking uracil and containing glucose,
cells were grown overnight in complete medium supplemented with
either 2% glucose or 2% galactose.
Antisense RNA probes were produced by cutting the JG4.1 and
JG12.1 clones with HindIII and XhoI to remove approximately 500
nucleotides from their 3′-ends. This removed a region that is identical
in both original clones. Antisense probes produced from the resulting
constructs designated JG4.1X and JG12.1X would be expected to
provide an unambiguous detection of the 45 nucleotide region present
in JG12.1 but absent in JG4.1. Antisense probes were synthesized
using T7 RNA polymerase and a MAXIscript kit (Ambion). Total
RNA was isolated and RNase protection assays were performed
(Ambion). RNA fragment sizes were determined using labeled
fragments produced with an Ambion Century Marker Plus kit.
Nucleolar targeting of BN46/51 1161
Isolation of nucleoli, preparation of nucleolus-like
particles (NLPs), preparation of cell extracts and BN46/51
binding assays
Nucleoli, nucleolar extracts, NLPs and Triton X-100 extracts of
amebae were prepared from Naegleria amebae as previously
described (Trimbur and Walsh, 1992, 1993). Yeast cell extracts of
BN46/51 expressing cells were prepared as described (Brodsky et al.,
1998). In earlier experiments total yeast protein used for analysis of
mAbs was isolated from spheroplasts prepared as described
(Kilmartin and Adams, 1984) except that the fixation step was
omitted. Proteins were fractionated on 7.5% or 10% SDS
polyacrylamide gels (PAGE) and transferred to nitrocellulose by
electroblotting (Trimbur and Walsh, 1992). Immunoblots were probed
with the mAbs BN5.1, AH6 and DE6 (Trimbur and Walsh, 1992)
followed by horseradish peroxidase-coupled second antibody and
visualized with either 4-chloro-1-naphthol and H2O2 (Trimbur and
Walsh, 1992) or using the ECL method (Amersham).
For the isolation of nuclei, M15 cells grown to confluence in 25
cm2 flasks were washed twice with ice-cold TBS followed by the
addition of 10 ml Rootlet Lyse Buffer (RLB, 30 mM Tris-HCl, pH
8.0, 50% glycerol, 1 mM EGTA, 1 mM DTT, 10 mM ε-amino-ncaproic acid, containing 0.5% Triton X-100, 0.005% PMSF and 0.02
mM leupeptin) (Trimbur and Walsh, 1992) to each flask, as described
in part (Muramatsu and Onishi, 1977). Briefly, the flasks were kept
on ice for 5 minutes followed by vigorous tapping to detach the cells
from the flask. Glycerol was diluted to a final concentration of 25%
by the addition of an equal volume of RLB without glycerol (LB) and
nuclei were pelleted by centrifugation at 4,080 g for 10 minutes in an
HB-4 swinging bucket rotor. The pellet was resuspended in 4 ml of
0.5 M sucrose-LB, the suspension was underlayed with 2 ml of 1 M
sucrose-LB and centrifuged as above. The pellet, which contained
nuclei with visible nucleoli as judged by phase contrast microscopy
(data not shown), was resuspended in 0.2 ml of LB. An equal volume
of 2× SDS-sample buffer was added to the nuclear suspension and
immediately heated in a boiling water bath for 3 minutes. The
resulting viscous solution was vortexed extensively and used as a
source for M15 nuclear proteins on immunoblots.
Affinity chromatography was carried out as previously described
(Trimbur and Walsh, 1992). Columns were prepared using ascites
fluids containing either the BN5.1 or DE6 monoclonal antibodies
(Trimbur and Walsh, 1993). The antigens recognized by the DE6 mAb
were separated from the other components that elute from a DE6
affinity column (see Fig. 5) by addition of 0.1 M Na2CO3, pH 11,
followed by elution with 0.1 M Na citrate, pH 2.9, 3 M urea.
Components not recognized by DE6 elute at pH 11 while those
recognized by DE6 are retained and elute at pH 2.9 (cf. Fig. 8, panel
‘CB’, lane 2, with Fig. 5A, lane 2). A variety of controls demonstrated
the specificity of the affinity columns. Most importantly a BN5.1
column failed to bind the components retained by the DE6 column
and vice versa, demonstrating the binding specificity of the
monoclonal antibody coupled to the resin (Trimbur and Walsh, 1993).
‘Far Western’ binding assays were carried out on western blots
containing fractionated NLP proteins or proteins eluted from affinity
columns. After staining with 0.2% Ponceau S in 0.3% acetic acid for 5
minutes, blots were cut into strips, blocked for 1 hour in 10% horse
serum in TBS and incubated in Triton X-100 soluble extracts of amebae
containing BN46/51 for 60 minutes at room temperature. After
incubation all strips were washed 4 times for 5 minutes with gentle
shaking in TBS-0.5% Tween-20 followed by a rinse in TBS. Following
incubation with amebae extracts and washing, strips were incubated
with mAb BN5.1, washed, incubated with horseradish peroxidase
coupled second antibody, washed, and visualized with 4-chloro-1naphthol and H2O2 as previously described (Trimbur and Walsh, 1992).
The mAbs P2G3, P1D10, P2B11, and P1G12, directed against
distinct epitopes on fibrillarin, were a gift from Dr Mark Christensen
(Christensen and Banker, 1992). Purified Nop1p was a gift from Dr
John Woolford (Department of Biological Sciences, Carnegie Mellon
University, Pittsburgh, PA 15213). M15 and 3T3 cells were a gift from
Marcia Lewis and Dr Albert Chung (Department of Biological
Sciences, University of Pittsburgh, Pittsburgh, PA 15260).
RESULTS
Cloning and sequencing BN46/51 cDNAs
A cDNA library was constructed in the Lambda ZAP II vector
using poly(A)+ RNA from log phase amebae. Recombinant
phage were screened for expression of the antigen recognized
by BN5.1 using plaque lifts. Three positive lambda clones were
ultimately identified. Inserts from the phage were subcloned
into the Bluescript II SK− phagemid vector and two cDNAs of
842 bp and 904 bp, designated JG4.1 and JG12.1, were chosen
for further analysis.
When the JG4.1 or JG12.1 cDNAs were individually
expressed in E. coli as fusions with the 4 kDa alpha peptide of
β-galactosidase, they each produced a single polypeptide
recognized by the BN5.1 mAb (Fig. 1A). Expression of the
JG4.1 cDNA in E. coli produced a soluble polypeptide while
the JG12.1 cDNA product was found in large inclusion bodies
(Fig. 1A, lanes 1 and 3). Expression of the cDNAs in yeast
produced polypeptides that co-migrated with the appropriate
BN46/51 subunits (Fig. 1B).
DNA sequencing showed that the JG4.1 cDNA was identical
to the JG12.1 cDNA except that JG4.1 contains three additional
nucleotides between positions 7 and 8 and between positions
289 and 290 and lacks 45 nucleotides beginning at position 346
as numbered in the JG12.1 sequence (Fig. 2). Both clones
contained one continuous open reading frame beginning with
a methionine at nucleotide 10 and terminating 65 nucleotides
upstream of the poly(A) tail. The poly(A) tail is proceeded by
a typical poly(A) addition site (Wickens, 1990). Conceptual
translation produced identical polypeptides except for the
addition in JG4.1 of an aspartic acid between positions 94 and
95, and the absence of 15 amino acids corresponding to
positions 113 through 127 in JG12.1 (Fig. 2).
Fig. 1. Expression of the BN46/51 cDNAs JG4.1 and JG12.1 in E.
coli and S. cerevisiae as detected on western blots. (A) Expression in
E. coli as fusions with the 4 kDa alpha peptide of β-galactosidase.
Cells carrying the JG4.1 or JG12.1 inserts in pBluescript plasmids
were induced with 1 mM IPTG for 3 hours. After lysis with
lysozyme and sonication, extracts were fractionated into soluble
proteins, 8 M urea soluble proteins and 8 M urea insoluble proteins.
Approximately 60% of the JG4.1 peptide was found in the soluble
fraction (lane 1). Lane 2, Naegleria nucleolar protein containing
BN46/51. Lane 3, the JG12.1 peptide was found only in the 8 M urea
insoluble fraction, which contained large inclusion bodies. No BN5.1
antigen was present in cells lacking plasmid and very low levels were
seen in uninduced cells (data not shown). (B) Expression in S.
cerevisiae. Lane 1, Naegleria nucleolar protein containing BN46/51.
Lanes 2 and 3, extracts from yeast cells containing the pGAL-JG4.1
expression plasmid; lanes 4 and 5 extracts from yeast cells
containing the pGAL-JG 12.1 expression plasmid. Cells were grown
in either glucose, lanes 2 and 4, or in galactose, lanes 3 and 5.
1162 G. M. Trimbur and others
1
1
61
18
121
38
181
58
241
78
301
98
361
118
421
138
Fig. 2. The nucleotide and predicted amino acid
sequences of the BN46/51 cDNAs JG4.1 and JG12.1.
The sequence of the larger subunit cDNA, JG12.1, is
presented. The smaller subunit differs in the presence of
3 additional nucleotides between positions 7 and 8 and
between positions 289 and 290; as indicated by the
triangles above the sequence, and in the absence of 45
nucleotides at positions 346 through 390, as indicated by
the boxed region. The JG12.1 cDNA has 4 additional
adenosine residues at the 3′ end that are not shown,
while the JG4.1 cDNA has only 18 adenosine residues at
the 3′ end. The KKE/D and KKX motifs are underlined.
The JG4.1 and JG12.1 sequences are deposited in
GenBank under accession numbers AF091603 and
AF091604, respectively.
481
158
541
178
601
198
661
218
721
238
781
258
841
C AA
.
.
.
.
.
.
GCACGAGCAATGTCCAACATTTTCTCATTCTTCGGTCAAGAAATCAAGACTGGTGCTCCA
M S N I F S F F G Q E I K T G A P
.
.
.
.
.
.
CAAGCCTTCGAAATCCCATTCGGTGAAGTTATTCTCCACTTGTCCACTGTTTCCCTCGCT
Q A F E I P F G E V I L H L S T V S L A
.
.
.
.
.
.
AAGGACACCCCAAAGGGATCTATCACTAGAGTTTTTGTTCACTCTGTTGATGAAGATGAA
K D T P K G S I T R V F V H S V D E D E
.
.
.
.
.
.
AAGGAAACCAAGTATGTCATTTGCACACTTGTTGGAAAGGAAAAGGAATCCGTCTCTATT
K E T K Y V I C T L V G K E K E S V S I
ATG
.
.
.
.
.
.
GATTTGAACTTTAGCGAAGATGTTGCTCTCTCCATTGAAACATCCGCTAATGATACCACA
D L N F S E D V A L S I E T S A N D T T
D
.
.
.
.
.
.
GTCCATGTTACTGGTTACATCAACTTGATTAATGAAGATGGTGAAGAAGGTGAGTATGGA
V H V T G Y I N L I N E D G E E G E Y G
.
.
.
.
.
.
GGTTATTCAGTAATTGACGGTGATGATCTTGAAGATGAAAGTGATGAAGAAGAAAAGGCT
G Y S V I D G D D L E D E S D E E E K A
.
.
.
.
.
.
AAGCTTTTGAGAAAGATGTTGGAAGAAGATGATGACGAAGATGATGAAGATTTCAAGCCA
K L L R K M L E E D D D E D D E D F K P
.
.
.
.
.
.
GACTTGAATGAATCTTCTGAATCTGCTAAGCTCGAAGAATTGAGCGACGAAGATGAAATG
D L N E S S E S A K L E E L S D E D E M
.
.
.
.
.
.
GAAGGCGACGATCTTGATGATGACCAAACTGAAGAAGTTGTTAAGAGAGTTCAAGATCTT
E G D D L D D D Q T E E V V K R V Q D L
.
.
.
.
.
.
GAAAATAGATTGGGCAGAGAAGCTAACGATGAAGAAATCAAGGAAATTGTTACCAGAGTC
E N R L G R E A N D E E I K E I V T R V
.
.
.
.
.
.
CAAGCTGGCCAACCTGAACCAGCTCCAAAGAAGAAGGAACAACCAAAGAAGGAGCAACCA
Q A G Q P E P A P K K K E Q P K K E Q P
.
.
.
.
.
.
AAGAAGCAACCACAACAACAACAACAAAAGCAACAACAACAACCAAAGGAAGATAAGAAG
K K Q P Q Q Q Q Q K Q Q Q Q P K E D K K
.
.
.
.
.
.
AGAAGCAAGAAGAAGCTCTAGGAAACAATAAGAATAAGAAGAACAAGAAGAACAAGAAGA
R S K K K L *
.
.
.
.
.
.
AATAAATTAACTTTTTTTATCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
The predicted amino acid sequences are highly acidic with
26% aspartic acid and glutamic acid residues. The predicted
molecular mass of the polypeptide encoded by the JG4.1
cDNA is 28.8 kDa and that of the JG12.1 cDNA is 30.1 kDa,
both significantly less than the observed molecular mass of the
native subunits, the fusion proteins expressed in E. coli, and
the polypeptides produced in yeast (Fig. 1). Similar
anomalously high molecular mass of acidic nucleolar proteins
on SDS gels have been noted in other systems (Benton et al.,
1994; Fuller et al., 1989).
The predicted JG12.1 amino acid sequence can be divided
into three broad regions. The N-terminal region (residues 1-80)
is relatively neutral while the central region (residues 81-193)
is highly acidic with 47 acidic amino acids and only 6 basic
residues. The C-terminal region (residues 194-266) is quite
basic with 21 basic amino acids and only 12 acidic residues
and may contain the nuclear localization sequence (NLS;
residues 229-266). There is a limited similarity to the SV40
NLS between residues 229-238, but this region lacks both the
arginine and valine found in the SV40 NLS consensus
sequence. Residues 260 through 266 bear some resemblance
to the bipartite NLS, but the ten residue spacing between basic
groups and the terminal arginine are absent (reviewed by
Boulikas, 1993).
The C-terminal region of both BN46/51 sequences contains
60
17
120
37
180
57
240
77
300
97
360
117
420
137
480
157
540
177
600
197
660
217
720
237
780
257
840
263
900
two KKE motifs. Similar KKE/D repeats occur 11 times in
Nop56p/Nop5p and 13 times in Nop58p (Gautier et al., 1997;
Wu et al., 1998). The C-terminal region also contains three
KKX repeats as found in the nucleolar proteins Cbf5p (13
copies; Cadwell et al., 1997) and Dbp3p (10 copies; Weaver et
al., 1997), Fig. 2. We were unable to identify a putative RNA
recognition motif (RRM) (reviewed by Dreyfuss et al., 1988;
Kim and Baker, 1993). The absence of residues 116 through
130 in the JG4.1 sequence eliminates five acidic residues but
otherwise has little obvious effect on the overall organization
of this polypeptide.
The BN46/51 subunits have some identity with a
family of FK506 binding proteins
The predicted amino acid sequence encoded by JG12.1 is 26
to 31% identical to the sequence of a group of FKBPs (FK506
binding proteins). The FKBPs include the Drosophila nuclear
39 kDa FKBP, FKBP39 (31% identity) (Theopold et al.,
1995). The quality index of this alignment, as determined
using the Bestfit program (Wisconsin Package Version 9.1,
Genetics Computer Group (GCG), Madison, Wisc.), was 127,
more than ten standard deviations greater than alignments to
random arrangements of the JG12.1 amino acid composition.
A similar degree of identity, with a quality index of 129, was
found between the large BN46/51 subunit and a 59 kDa
Nucleolar targeting of BN46/51 1163
FK506 binding protein from Sf9 cells, FKBP46 (Alnemri et
al., 1994). In this case the quality index of the match was six
standard deviations greater than the quality index of random
alignments (103±4.3). For both JG4.1 and JG12.1 there was
no similarity with the catalytic (i.e. peptidyl-prolyl cis-trans
isomerase) domain of the FKBPs (Fig. 3). A third FK506
binding protein was identified by a FASTA search. The 46 kDa
nucleolar protein NPI46p/Fpr3p from yeast (Shan et al., 1994;
Benton et al., 1994), is 26% identical to JG12.1 with a quality
index of 117, four standard deviations greater than a random
alignment.
The BN46/51 subunits are coded for by separate
mRNAs
RNase protection assays using antisense transcripts of both
cDNAs were carried out with total RNA from log phase
amebae to identify the mRNAs corresponding to BN46/51.
Antisense probes were synthesized from subclones lacking the
3′-region common to both JG4.1 and JG12.1 in order to
accentuate the expected differences in the sizes of the protected
fragments. When antisense RNA from the 5′-region of the
JG12.1 clone was used as a probe, two fragments of 440 and
360 nucleotides were present (data not shown). These are close
to the 431 and 351 nucleotide fragments expected from
separate mRNAs for each polypeptide. Assays with the JG4.1
5′-region antisense probe also produced two protected
fragments close to the expected lengths of 420 and 392
nucleotides. These results demonstrate the presence of unique
mRNAs encoding each subunit.
BN46/51 binds to other nucleolar proteins in vitro
BN46/51 is targeted to a distinct morphological subregion of
nucleoli and NLPs and this specific targeting requires neither
RNA nor DNA (Trimbur and Walsh, 1993). This suggests that
BN46/51 forms specific complexes with other nucleolar
proteins. This possibility was examined by incubating western
blots prepared from SDS gels of NLP proteins with fractions
containing solubilized BN46/51; solubilized BN46/51 is a
large multimeric complex containing only the 46 and 51 kDa
subunits (Trimbur and Walsh, 1992). When these blots were
probed with the BN5.1 mAb, BN46/51 associated with bands
of 74 kDa and 44 kDa (Fig. 4A, lane 4). Lesser amounts of
BN46/51 were also associated with a band at 31 kDa. When
blots were incubated with BN46/51 containing extracts in 0.4
M NaCl, a condition that dissociates nucleoli and NLPs and
releases the BN46/51 complex (Trimbur and Walsh, 1992;
Trimbur and Walsh, 1993), BN46/51 was not associated with
other nucleolar proteins (Fig. 4A, lane 5).
The 44 kDa and 74 kDa polypeptides which bind BN46/51
on western blots correspond in size to previously identified
Naegleria nucleolar antigens present in NLPs (Fig. 4B):
antigens recognized by the mAbs DE6 and AH6, respectively
(Trimbur and Walsh, 1993). The DE6 mAb recognizes 44 kDa
and 31 kDa polypeptides on western blots of Naegleria
Fig. 3. Comparison of the predicted amino acid
sequence of the Naegleria gruberi (N.g.) JG12.1 cDNA
with the amino acid sequence of the Drosophila
melanogaster (D.m.) FK506 binding protein FKBP38
(Theopold et al., 1995) and the FKBP from Sf9 cells,
FKBP46 (Alnemri et al., 1994). Alignments were
carried out using the Pileup program of the GCG
package. Identities are indicated in reverse type.
1164 G. M. Trimbur and others
Fig. 4. BN46/51 binds to nucleolar proteins. Nucleolar proteins
isolated from nucleolus-like particles (NLPs) were fractionated and
transferred to nitrocellulose. Each lane of the gel received the same
mixture of nucleolar proteins. (A) Incubation with solublized
BN46/51 (lanes 2 and 4) or the same BN46/51 extract made 0.4 M
NaCl (lane 5*). Some strips were incubated in the Triton X-100
containing buffer alone adjusted to 0.15 M NaCl (lanes 1 and 3).
Strips were either probed with the BN5.1 mAb (lanes 3-5) or with
buffer (lanes 1 and 2). All strips received horseradish peroxidase
labeled second antibody followed by 4-chloro-1-naphthol (lanes 1-5).
(B) Western blots directed against nucleolar proteins, AH6 (lane 1),
DE6 (lane 2), and BN5.1 (lane 3) are shown. One strip received no
primary antibody (lane 4).
nucleoli and NLPs (Fig. 4B, lane 2). DE6 binds to the dense
fibrillar component (DFC) of Naegleria nucleoli and to the
DFC-like component of NLPs (Trimbur and Walsh, 1993).
In order to determine if the 44 kDa nucleolar protein that
bound BN46/51 was in fact the polypeptide recognized by the
DE6 mAb, we prepared a DE6 affinity column. When extracts
of Naegleria nucleoli were passed over a DE6 column only
five polypeptides were retained (Fig. 5A, lane 2). Two of
these polypeptides were the 44 kDa and 31 kDa antigens
recognized by DE6 (Fig. 5B, lane 2). Two additional bands
in this complex, 74 kDa and 60 kDa, were recognized by the
AH6 mAb (Fig. 5B, lane 1), a mAb that binds to both the
DFC and the GC of Naegleria nucleoli and NLPs (Trimbur
and Walsh, 1993). Thus in extracts of Naegleria nucleoli the
74 kDa and 60 kDa antigens recognized by AH6 are
associated with one or both of the antigens recognized by
DE6.
The five polypeptides retained by the DE6 column were
used to evaluate the binding of BN46/51. When western blots
were incubated with soluble extracts containing BN46/51,
BN46/51 was found associated with the 74 kDa antigen
Fig. 5. The antigens recognized by DE6 and the AH6 are associated
in a complex in solubilized nucleolar extracts. (A) Isolation of the
antigens recognized by DE6 on a DE6 affinity column. A 0.4 M
NaCl extract of nucleoli was fractionated on a DE6 affinity column
and eluted with 0.1 M Na citrate, pH 2.9, 3 M urea. The salt extract,
lane 1, and the bound proteins subsequently eluted, lane 2, were
fractionated by 7.5% SDS-PAGE and visualized by Coomassie blue
staining. (B) Immunoblot analysis of the proteins eluted from a DE6
affinity column. Proteins retained by the column were eluted,
fractionated as in A, transferred to nitrocellulose, and probed with
AH6, lane 1, or with DE6, lane 2.
recognized by AH6 and the 44 kDa and 31 kDa antigens
recognized by DE6 (Fig. 6C, lane 4). The amount of
BN46/51 binding to the 44 kDa polypeptide was
significantly less in this case than the binding to the 31 kDa
polypeptide and the association with all three was greatly
reduced in 0.4 M NaCl (Fig. 6C, lane 5). The absence of any
other polypeptides and the intense immunoreactivity to the
purified antigens (Fig. 5) strongly support the identity of the
DE6 and AH6 antigens as the BN46/51 nucleolar-binding
proteins.
To determine if these interactions were conserved, further
characterization of the nucleolar polypeptides which bind
BN46/51 was undertaken. Both the DE6 and AH6 mAbs
bound to mammalian and yeast nucleoli (Fig. 7). The yeast
antigen recognized by DE6 proved to be a 36 kDa
polypeptide and DE6 recognized a 32 kDa antigen in
mammalian cells (data not shown). The size of the yeast
antigen recognized by DE6 suggested that this component
might be the yeast homologue of fibrillarin, Nop1p.
Fibrillarin (Ochs et al., 1985) is a protein found in the U3 as
well as other snoRNPs of both yeast and mammalian nucleoli
(reviewed by Woolford, 1991; Henriquez et al., 1990;
Schimmang et al., 1989). In fact DE6 cross reacts with
purified Nop1p (data not shown) and in the reciprocal
experiment, a series of mAbs against fibrillarin (Christensen
and Banker, 1992) reacted with the Naegleria 44 kDa antigen
purified on a DE6 affinity column, Fig. 8. Thus, BN46/51
binds to Naegleria nucleolar components that have
homologues in both yeast and mammalian cells.
Nucleolar targeting of BN46/51 1165
bind to yeast and mammalian nucleoli. This experiment was
possible because both yeast and mammalian cells fail to bind four
mAbs that recognize distinct epitopes on both BN46/51 subunits
and thus apparently lack a BN46/51 homologue (Trimbur and
Walsh, 1992). Binding to mammalian nucleoli was examined by
incubating permeabilized and methanol-fixed mouse 3T3 cells
with Naegleria extracts containing solubilized BN46/51. When
the 3T3 cells were subsequently probed with mAb BN5.1 and
labeled second antibody, BN46/51 was found specifically
associated with nucleoli (Fig. 9B).
The ability of the BN46/51 subunits to associate with the
yeast nucleolus was examined by regulated expression of the
JG4.1 and JG12.1 cDNAs in yeast cells. When induced by
galactose each polypeptide specifically accumulated in the
yeast nucleolus (Fig. 10B and D). The nucleolar staining
pattern seen when the BN46/51 subunits were expressed
individually in yeast is characteristic of the yeast nucleolus
(Fig. 7). Overall, both of the BN46/51 subunits contain the
sequences necessary for specific targeting to yeast and
mammalian nucleoli.
DISCUSSION
Fig. 6. BN46/51 binds to the nucleolar proteins DE6 and AH6
isolated on a DE6 affinity column. The proteins co-isolated from a
DE6 affinity column, (see Fig. 5A) were concentrated to about 200
µg/ml and fractionated on a 7.5% SDS-PAGE gel. Each lane received
15 µl of the same mixture of eluted proteins except for the molecular
mass standards. (A) Total protein by Coomassie Blue staining; lane
1, molecular mass standards; lane 2, eluted protein. (B) Western blot
using the AH6, lane 1, and the DE6, lane 2, mAb. (C) BN46/51
binding assay. As in Fig. 4 the asterisk indicates that the extract
contained a final concentration of 0.4 M NaCl.
BN46/51 binds to nucleoli in vitro and in vivo
Given the presence of proteins which bind BN46/51 in yeast and
mammalian cells it was of interest to determine if BN46/51 could
We have cloned and sequenced cDNAs for the 46 kDa and 51
kDa subunits of the basal-body-binding nucleolar protein
BN46/51. Specific nucleolar targeting of both BN46/51
subunits was observed when the cDNAs were expressed in
yeast and when incubated with fixed mammalian cells. We
have also demonstrated the binding of BN46/51 to the
Naegleria homologue of fibrillarin and to an unidentified
nucleolar polypeptide of 74 kDa.
Although sequence analysis indicates that BN46/51
represents a novel nucleolar protein, the BN46/51 subunits are
approximately 30% identical to the nuclear FKBP of Sf9 cells,
FKBP46, and the FKBP of Drosophila, FKBP39, and 26%
identical to the nucleolar FKBP of yeast, NPI46p/Fpr3p. The
Fig. 7. Monoclonal antibodies against Naegleria
nucleolus-like particles bind to yeast and
mammalian nucleoli. S. cerevisiae (A,B,E,F) were
fixed with formaldehyde and incubated with mAb
DE6 (A and B) or with mAb AH6 (E and F)
followed by incubation with a FITC-conjugated
antibody against mouse IgG. The mouse parietal
endoderm-like cell line M15 was fixed in
formaldehyde, incubated with DE6 (C,D) or AH6
(G,H) and FITC second antibody as described
above. Epi-fluorescence (A,C,E,G) phase contrast
(B,D,F,H) images are shown. Bar, 10 µm.
1166 G. M. Trimbur and others
Fig. 8. The 44 kDa antigen recognized by DE6 is fibrillarin. Total
NLP protein (lane 1) or affinity purified antigens recognized by DE6
(lane 2) were fractionated by 10% SDS-PAGE and visualized by
Coomassie blue (CB), or transferred to nitrocellulose and incubated
with DE6, or four anti-fibrillarin mAbs as indicated above each
panel.
identity extends over the entire BN46/51 sequence and is not
simply a reflection of regions rich is repeated acidic or basic
residues. However, there is no similarity between the BN46/51
subunits and the peptidyl-prolyl cis, trans-isomerase domain of
the FKBPs.
Binding to fibrillarin may provide one mechanism for
targeting BN46/51 to the nucleolus. The Naegleria 44 kDa
nucleolar protein bound by BN46/51 is highly homologous to
fibrillarin based on the presence of at least three common
epitopes and the fact that the 44 kDa antigen is restricted to the
DFC of nucleoli (Trimbur and Walsh, 1993), the location of
fibrillarin (reviewed by Shaw and Jordan, 1995). The common
epitopes extend through the highly conserved central region
(P1D10, P2B11), and into the C-terminal quarter of fibrillarin
(P2G3) (Christensen and Banker, 1992) (Fig. 8). The reaction
of P1G12, the mAb directed against the N-terminal peptide of
fibrillarin, with the 44 kDa antigen was weak and P1G12
reacted with an additional Naegleria polypeptide of high
molecular mass that was not recognized by the other mAbs.
However, both limited homology of fibrillarins in the Nterminal region and the presence of P1G12 epitopes common
to other nucleolar proteins has been noted (Christensen et al.,
1986; Christensen and Banker, 1992). The targeting of the
BN46/51 subunits to yeast nucleoli and the fact that BN46/51
binds to the nucleoli of fixed mammalian cells suggest that
fibrillarin binding reflects a mechanism to target BN46/51 to
the nucleolus.
The presence of two KKE/D motifs and three KKX motifs
in the C-terminus of the BN46/51 subunits is of particular
interest. In yeast (S. cerevisiae), tandem repeats of these motifs
are an exclusive property of nucleolar proteins and two of these
nucleolar proteins, Nop56p and Nop58p/Nop5p, are found in
a complex with the yeast homologue of fibrillarin, Nop1p, a
protein that binds BN46/51 (Gautier et al., 1997; Wu et al.,
1998). The KKX repeat is essential for nucleolar targeting of
Dbp3p (Weaver et al., 1997) but it is not required for nucleolar
localization or Nop1p binding of Nop58p/Nop5p (Gautier et
Fig. 9. BN46/51 binds to the nucleoli of fixed mammalian cells.
Coverslips containing 3T3 cells permeablized in lysis buffer and
fixed in methanol were incubated in extracts containing solubilized
BN46/51 at room temperature for 30 minutes. The cells were
stained with the anti-BN46/51 mAb BN5.1 and visualized with a
FITC-conjugated second antibody. (A and C) Phase contrast. (B and
D) Epifluorescence. (A and B) Cells received BN5.1 first antibody.
(C and D) Cells received no first antibody. As demonstrated
previously, BN5.1 does not bind to mammalian cells (Trimbur and
Walsh, 1992).
al., 1997; Wu et al., 1998). Thus while the parallels are
intriguing, determining the possible significance of the KKX
motif in targeting BN46/51 to the nucleolus or in binding
BN46/51 to fibrillarin will require additional investigation.
The binding of BN46/51 to multiple nucleolar components
suggests that a network of interactions contributes to nucleolar
localization. This concept is supported by the fact that the same
proteins bound by BN46/51 on western blots co-purify on
affinity columns directed to the antigens recognized by DE6.
That BN46/51 purified by affinity chromatography on BN5.1
antibody columns does not retain its ability to bind to nucleoli
or western blots (data not shown) may reflect denaturation by
extremes of pH during elution, or it may mean that there are
additional components in the cell extract that are needed for
BN46/51 binding to nucleolar components.
BN46/51 was originally identified by its appearance in the
basal body region after the cytoskeletal microtubules of
Naegleria flagellates assemble. The explanation for the
association of BN46/51 with the basal body region may lie in
the unusual properties of Naegleria gruberi biology. Naegleria
amebae lack centrioles as well as basal bodies (Fulton and
Dingle, 1971) and cytoplasmic microtubules (Walsh, 1984).
The only microtubules observed in amebae are those found in
the mitotic spindle which is enclosed within the nuclear
membrane (Walsh, 1984; Schuster, 1975). As in a number of
protists and in yeast, the nuclear membrane does not break
down during mitosis in Naegleria (Schuster, 1975; Fulton,
1970).
Naegleria nuclei contain a large central nucleolus which also
does not break down during mitosis (Schuster, 1975; Fulton,
1970). This may reflect the fact that there are no chromosomal
copies of the ribosomal RNA genes. Instead, the nucleolus
Nucleolar targeting of BN46/51 1167
Fig. 10. BN46/51 subunits expressed in yeast are targeted to the
nucleolus. The JG4.1 cDNA (A and B) and the JG12.1 cDNA
(C,D,F) were subcloned into the yeast expression vector pYES2
under control of the GAL1 promoter. Cells were grown in either
glucose (A and C) or galactose (B,D,E,F). (E) Cells containing
vector lacking insert were grown in galactose. (F) Cells grown as in
D processed without first antibody. After fixation and staining with
the BN46/51 specific mAb BN5.1 and a cy3 labeled second antibody,
cells were stained with DAPI to visualize the nuclei. All images were
collected under identical conditions. (G) A montage of cells
expressing the JG12.1 polypeptide. Shown are cells from a sample of
68 cells which showed visible expression of JG12.1.
microtubules do not associate with any identifiable MTOC
(Schuster, 1975; Fulton, 1970; Walsh, 1984 and unpublished
observations). The ends of the polar microtubules appear to be
embedded in the nucleolus (unpublished observations). The
nucleolus becomes elongated during anaphase and gives the
appearance of being pulled apart as the chromosomes move to
the poles of the elongating spindle (Schuster, 1975; Fulton,
1970 and unpublished observations). If, as seems likely, the
nucleolar division is driven by the mitotic spindle, then there
must be a physical association between the spindle and the
nucleolus. Because BN46/51 is associated with the MTOC
activity of the basal body region, we believe it may also be
associated with the MTOC activity responsible for forming the
mitotic spindle. Given the binding of BN46/51 to multiple
nucleolar components, its association with the MTOC activity
needed for mitotic spindle formation would provide a
mechanism for attaching the nucleolus to the spindle and thus
assuring the division of the nucleolus during mitosis. The
presence of KKX motifs in the BN46/51 subunits, motifs
known to bind microtubules (Jiang et al., 1993; Langkopf et
al., 1992; Noble et al., 1989), is consistent with this hypothesis.
Gautier et al. (1997) have suggested that a similar mechanism
may aid division of the yeast nucleolus. Testing this hypothesis
will require characterizing the MTOC activity for both the
mitotic spindle and the cytoplasmic microtubules that form in
Naegleria flagellates.
Early portions of this work were supported by a grant from the
National Science Foundation to C.J.W. Most of the work was
supported by the University of Pittsburgh through the Department of
Biological Sciences. We thank Dr Mark Christensen for the gift of
anti-fibrillarin antibodies and Dr John Woolford for the gift of purified
Nop1p; Tanima Sinha, Hongyan Xu, Yun Yao and Jacky Franke for
technical help; Marcia Lewis for cell lines; and Dr Karl Fath and Dr
William Saunders for reading the manuscript. The work of J.L.B. was
supported by grant MCB9506002 from the National Science
Foundation.
REFERENCES
contains about 3,000 copies of a circular plasmid, each one
containing a single ribosomal RNA gene (Clark and Cross,
1987). Thus the nucleolus must be distributed between the
daughter cells at mitosis.
When the mitotic spindle forms inside the nucleus the
Alnemri, E. S., Fernandes-Alnemri, T., Pomerenke, K., Robertson, N. M.,
Dudley, K., DuBois, G. C. and Litwack, G. (1994). FKBP46, a novel Sf9
insect cell nuclear immunophilin that forms a protein-kinase complex. J.
Biol. Chem. 269, 30828-30834.
Baluska, F., Volkmann, D. and Barlow, P. W. (1997). Nuclear components
with microtubule-organizing properties in multicellular eukaryotes:
functional and evolutionary considerations. Int. Rev. Cytol. 175, 91-135.
Benton, B. M., Zang, J.-H. and Thorner, J. (1994). A novel FK506- and
rapamycin-binding protein (FPR3 gene product) in the yeast Saccharomyces
cerevisiae is a proline rotamase localized to the nucleolus. J. Cell Biol. 127,
623-639.
1168 G. M. Trimbur and others
Boulikas, T. (1993). Nuclear localization signals (NLS). Crit. Rev. Eukaryot.
Gene Expr. 3, 193-227.
Brodsky, J. L., Lawrence, J. G. and Caplan, A. J. (1998). Mutations in the
cytosolic DnaJ-homologue, YDJ1, delay and compromise the efficient
translation of heterologous proteins in yeast. Biochemistry 37, 18045-18055.
Cadwell, C., Yoon, H.-J., Zebarjadian, Y. and Carbon, J. (1997). The yeast
nucleolar protein Cbf5p is involved in rRNA biosynthesis and interacts
genetically with the RNA polymerase I transcription factor RRN3. Mol.
Cell. Biol. 17, 6175-6183.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162, 156-159.
Christensen, M. E. and Banker, N. (1992). Mapping of monoclonal antibody
epitopes in the nucleolar protein fibrillarin (B-36) of Physarum
polycephalum. Cell Biol. Int. Rep. 16, 1119-1131.
Christensen, M. E., Moloo, J., Swischuk, J. L. and Schelling, M. E. (1986).
Characterization of the nucleolar protein, B-36, using monoclonal
antibodies. Exp. Cell Res. 166, 77-93.
Chung, A. E., Estes, L. E., Shinozuka, H., Braginski, J., Lorz, C. and
Chung, C. A. (1977). Morphological and biochemical observations on cells
derived from the in vitro differentiation of the embryonal carcinoma cell line
PCC4-4. Cancer Res. 37, 2072-2081.
Clark, C. G. and Cross, G. A. M. (1987). rRNA genes of Naegleria gruberi
are carried exclusively on a 14-kilobase-pair plasmid. Mol. Cell. Biol. 7,
3027-3031.
Dingle, A. D. and Fulton, C. (1966). Development of the flagellar apparatus
of Naegleria. J. Cell Biol. 31, 43-54.
Dreyfuss, G., Swanson, M. S. and Pinol-Roma, S. (1988). Heterogeneous
nuclear ribronucleoprotein particles and the pathway of mRNA formation.
Trends Biochem. Sci. 13, 86-91.
Fuller, R. S., Brake, A. and Thorner, J. (1989). Yeast prohormone processing
enzyme (KEX2 gene product) is a Ca2+-dependent serine protease. Proc.
Nat. Acad. Sci. USA 86, 1434-1438.
Fulton, C. and Dingle, A. D. (1967). Appearance of the flagellate phenotype
in populations of Naegleria amebae. Dev. Biol. 15, 165-191.
Fulton, C. (1970). Amebo-flagellates as research partners: The laboratory
biology of Naegleria and Tetramitus. Meth. Cell Physiol. 4, 341-476.
Fulton, C. and Dingle, A. D. (1971). Basal bodies, but not centrioles, in
Naegleria. J. Cell Biol. 51, 826-836.
Fulton, C. (1971). Centrioles. In Origin and Continuity of Cell Organelles (ed.
J. Reinert and H. Ursprung), pp. 170-221. Springer-Verlag, Berlin.
Fulton, C. (1977). Cell differentiation in Naegleria gruberi. Annu. Rev.
Microbiol. 31, 597-629.
Gautier, T., Berges, T., Tollervery, D. and Hurt, E. (1997). Nucleolar
KKE/D repeat proteins Nop56p and Nop58p interact with Nop1p and are
required for ribosome biogenesis. Mol. Cell. Biol. 17, 7088-7098.
Hadjiolov, A. A. (1985). The Nucleolus and Ribosome Biogenesis, pp. 1-268.
Springer-Verlag, New York.
Henriquez, R., Blobel, G. and Aris, J. P. (1990). Isolation and sequencing
of NOP1. A yeast gene encoding a nucleolar protein homologous to a human
autoimmune antigen. J. Biol. Chem. 265, 2209-2215.
Jiang, W., Middleton, K., Yoon, H.-J., Fouquet, C. and Carbon, J. (1993).
An essential yeast protein, CBF5p, binds in vitro to centromeres and
microtubules. Mol. Cell. Biol. 13, 4884-4893.
Joshi, H. C. (1994). Microtubule organizing centers and gamma-tubulin. Curr.
Opin. Cell Biol. 6, 54-62.
Kilmartin, J. V. and Adams, A. E. M. (1984). Structural rearrangements of
tubulin and actin during the cell cycle of the yeast Saccharomyces. J. Cell
Biol. 98, 922-933.
Kim, Y.-J. and Baker, B. S. (1993). Isolation of RRM-type RNA-binding
protein genes and the analysis of their relatedness by using a numerical
approach. Mol. Cell. Biol. 13, 174-183.
Langanger, G., DeMay, J. and Adam, H. (1983). 1, 4-Diazobizyklo-[2.2.2]okatn
(DABCO)
verzogert
das
Ausbleichen
von
Immunofluoreszenpraparaten. Mikroskopie 40, 237-241.
Langkopf, A., Hammarback, J. A., Muller, R., Vallee, R. B. and Garner,
C. C. (1992). Microtubule-associated proteins 1A and LC2. J. Biol. Chem.
267, 16561-16566.
Lieuvin, A., Labbé, J.-C., Dorée, M. and Job, D. (1994). Intrinsic
microtubule stability in interphase cells. J. Cell Biol. 124, 985-996.
Muramatsu, M. and Onishi, T. (1977). Rapid isolation of nucleoli from
detergent purified nuclei of tumor and tissue culture cells. Meth. Cell Biol.
15, 221-234.
Noble, M., Lewis, S. A. and Cowan, N. J. (1989). The microtubule binding
domain of microtubule-associated protein MAP1B contains a repeated
sequence motif unrelated to that of MAP2 and tau. J. Cell Biol. 109, 33673376.
Ochs, R. L., Lischwe, M. A., Spohn, W. H. and Busch, H. (1985). Fibrillarin:
a new protein of the nucleolus identified by autoimmune sera. Biol. Cell.
54, 123-134.
Olson, M. O. J. (1990). The role of proteins in nucleolar structure and
function. In The Eukaryotic Nucleus (ed. P. R. Strauss and S. H. Wilson),
pp. 519-559. Telford Press, Caldwell, New Jersey.
Pringle, J. R., Adams, A. E., Drubin, D. G. and Haarer, B. K. (1991).
Immunofluorescence methods for yeast. Meth. Enzymol. 194, 565-602.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning,
edn 2, pp. 9.16. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
Schimmang, T., Tollervey, D., Kern, H., Frank, R. and Hurt, E. C. (1989).
A yeast nucleolar protein related to mammalian fibrillarin is associated
with small nucleolar RNA and is essential for viability. EMBO J. 8, 40154024.
Schuster, F. L. (1975). Ultrastructure of mitosis in the ameboflagellate
Naegleria gruberi. Tissue & Cell 7, 1-12.
Shan, X., Xue, Z. and Mélèse, T. (1994). Yeast NPI46 encodes a novel prolyl
cis-trans isomerase that is located in the nucleolus. J. Cell Biol. 126, 853862.
Shaw, P. J. and Jordan, E. G. (1995). The nucleolus. Annu. Rev. Cell Dev.
Biol. 11, 93-121.
Shea, D. K. and Walsh, C. J. (1987). mRNAs for α- and β-tubulin and
flagellar calmodulin are among those coordinately regulated when
Naegleria gruberi amebae differentiate into flagellates. J. Cell Biol. 105,
1303-1309.
Theopold, U., Zotto, L. D. and Hulmark, D. (1995). FKBP39, a Drosophila
member of a family of proteins that bind the immunosuppressive drug
FK506. Gene 156, 247-251.
Trimbur, G. M. and Walsh, C. J. (1992). BN46/51, a new nucleolar protein,
binds to the basal body region in Naegleria gruberi flagellates. J. Cell Sci.
103, 167-181.
Trimbur, G. M. and Walsh, C. J. (1993). Nucleolus-like morphology
produced during the in vitro reassociation of nucleolar components. J. Cell
Biol. 122, 753-766.
Walsh, C. (1984). Synthesis and assembly of the cytoskeleton of Naegleria
gruberi flagellates. J. Cell Biol. 98, 449-456.
Weaver, P. L., Chao, S. and Chang, T.-H. (1997). Dbp3p, a putative RNA
helicase in Saccharomyces cerevisiae, is required for efficient pre-rRNA
processing predominantly at site A3. Mol. Cell. Biol. 17, 1354-1365.
Wickens, M. (1990). How the messenger got its tail: Addition of poly(A) in
the nucleus. Trends Biochem. Sci. 15, 277-281.
Woolford, J. L., Jr (1991). The structure and biogenesis of yeast ribosomes.
Adv. Genet. 29, 63-118.
Wu, P., Brockenbrough, J. S., Metcalfe, A. C., Chen, S. and Aris, J. P.
(1998). Nop5p is a small nucleolar ribonucleoprotein component required
for pre-18 S rRNA processing in yeast. J. Biol. Chem. 273, 16453-16463.