Download Location and Characterization of the Bovine Herpesvirus Type 2

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Minimal genome wikipedia, lookup

Copy-number variation wikipedia, lookup

Human genome wikipedia, lookup

Genomic imprinting wikipedia, lookup

Genetic engineering wikipedia, lookup

Adeno-associated virus wikipedia, lookup

DNA virus wikipedia, lookup

Metagenomics wikipedia, lookup

Epigenetics of diabetes Type 2 wikipedia, lookup

Nutriepigenomics wikipedia, lookup

Gene therapy of the human retina wikipedia, lookup

Epigenetics of human development wikipedia, lookup

Gene expression programming wikipedia, lookup

Pathogenomics wikipedia, lookup

Gene nomenclature wikipedia, lookup

Gene therapy wikipedia, lookup

Public health genomics wikipedia, lookup

Genome (book) wikipedia, lookup

Genomics wikipedia, lookup

NEDD9 wikipedia, lookup

Gene desert wikipedia, lookup

History of genetic engineering wikipedia, lookup

Point mutation wikipedia, lookup

RNA-Seq wikipedia, lookup

Gene expression profiling wikipedia, lookup

Genome evolution wikipedia, lookup

Site-specific recombinase technology wikipedia, lookup

Gene wikipedia, lookup

Therapeutic gene modulation wikipedia, lookup

Microevolution wikipedia, lookup

Vectors in gene therapy wikipedia, lookup

Genome editing wikipedia, lookup

Designer baby wikipedia, lookup

Helitron (biology) wikipedia, lookup

Artificial gene synthesis wikipedia, lookup

Transcript
J. gen. Virol. (1989), 70, 3067-3071. Printed in Great Britain
3067
Key words: BHV-2/thymidine kinase/nucleotide sequence
Location and Characterization of the Bovine Herpesvirus Type 2 Thymidine
Kinase Gene
By M I C H A E L S H E P P A R D ~* AND J O H N T. M A Y 2
~CSIRO, Division of Animal Health, Animal Health Research Laboratory, Private Bag No. 1,
P.O. Parkville, Victoria 3052 and 2Department of Microbiology, La Trobe University,
Bundoora, Victoria 3083, Australia
(Accepted 4 August 1989)
SUMMARY
The precise genomic location and the nucleotide sequence of the bovine herpesvirus
type 2 (bovine herpes mammillitis virus) thymidine kinase (TK) gene have been
determined. The genomic location of the TK gene was found to be in a similar position
to that of herpes simplex virus. The coding region consists of 918 bases, which is
slightly smaller in length than other reported herpesvirus TK genes. However with an
Mr of 38108 the individual protein is similar in size to other herpesvirus TK enzymes.
Despite there being only limited overall sequence homology with the T K genes of other
herpesviruses, there are several regions of extensive homology at the amino acid level.
Bovine herpesvirus type 2 (BHV-2) is one of several herpesviruses known to infect cattle.
Although BHV-2 is known to cause swelling, inflammation and ulceration of the teats and udder
in domestic cattle (Ludwig, 1983; Martin et al., 1964, 1966) it is not a major problem in cattle.
BHV-2 can be considered as a potential bovine-specific vector virus as some strains produce no
disease and none are transmitted to people or other animals in field situations (Maragos et al.,
1986; Maragos & May, 1987). If the virus has a thymidine kinase (TK) gene it can be used for
D N A manipulative purposes to produce vaccines with less pathogenicity (Kit, 1985). BHV-2
virus is an alphaherpesvirus with a linear dsDNA genome approximately 135 kb in size and a
genomic structure similar to that of herpes simplex virus (HSV; Buchman & Roizman 1978b;
Roizman et al., 1982). The overall base sequence homology between HSV-1 and BHV-2, as
defined by D N A hybridization studies, is 14~ (Roizman et al., 1982; Sterz et al., 1973/74). In
this report we describe experiments which have determined the precise location of the T K gene
on the physical map of BHV-2 strain BHM-1 (Maragos et al., 1986; Maragos & May, 1987) and
the complete nucleotide sequence of this gene. We have also compared this sequence to those of
known TK genes from other herpesviruses.
Recently it has been demonstrated that several BHV-2 genes map to a collinear position with
equivalent genes in HSV-1 (Maragos & May, 1987; Hammerschmidt et al., 1988a, b). This
knowledge was used to determine the approximate location of a BHV-2 TK gene. Based on the
known location of the HSV- 1 TK gene at map units (m.u.) 30-0 to 31.3 (McGeoch et al., 1988;
Reyes et al., 1982) the equivalent region in the BHV-2 genome was determined and found to be
contained within the 11-5 kb HindlII I fragment of m.u. 27.1 to 35.8 (Buchman & Roizman,
1978 a). Previously we have reported that the HindlII I ti'agment and a smaller 2.69 kb SalI
internal fragment transformed T K - cells to a T K ÷ phenotype (May et al,, 1989). In this case we
have mapped this 2.69 kb SalI fragment extensively, and by the use of the calcium phosphate
transfection method (Kit et al., 1980) we have determined the precise map position of the BHV-2
TK gene to a 1.2 kb SalI/SphI fragment (Fig. 1). The SalI/SphI fragment was found to transform
T K - cells to a T K ÷ phenotype with an efficiency equal to the HSV-1 1.9 kb PvulI fragment
containing the TK gene; the larger fragments were much less efficient. When the SalI/SphI
fragment was cleaved with XbaI (Fig. 1) before transfection no T K + ceils were obtained.This
0000-9069 O 1989 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 11:38:58
3068
Short communication
M a p units
40
1
2O
I
50
I
9O
i
7O
I
60
I
Hindlll
13-8
19.2
3'4
I
I
I
/
/
D"
TK +
TK*
6.2
|
/
/
t
I
10.8
I
?
I
18-5
I
14.15
10"0
I
I
~-~
~"
[ HindlII F r a g m e n t 1
H
J (approx. 30 to 3 2 m . u . )
~
~
spsp
1
S
~c
s
I
Nc
,I
Sp
TK-
3-~
7-4
I
/
TK-
TK +
I
I
I..
I
Sp
TK +
8.2
S
I
..1
TK
TK +
~
I
S
i
B
/
/
i /
s
?
/
J
H
TK +
./
11.7
J
S
|
S
[,
N
|
X
! I-2 kb (30-0 to 3 1 0 m u . )
Sp
~ I-2 kb
Sp
t 113 kb
Sp
~
0.86 kb
Sp
Fig. 1. HindlII restriction enzyme map of BHV-2 (Buchman & Roizman 1978a). The HindlII 11.7 kb
fragment I is expanded and the various subfragments are indicated as TK ÷ or TK-. Restriction sites:
H, HindlII; B, BamHI: S, Sail; N, NaeI; X, XbaI; Sp, SphI; Nc, NcoI.
suggests that the XbaI cleavage site is within the coding sequence or the promoter region of the
BHV-2 TK gene.
The positive results in transforming TK- cells to TK + with the 1-2 kb SalI/SphI fragment led
to the complete sequencing of both D N A strands of this region, using the chain termination
method of Sanger et al. (1977). The results of this sequence analysis are presented in Fig. 2. With
a coding sequence of 918 bp the BHV-2 TK gene is quite clearly smaller than that of other
herpesvirus TK genes reported (Kit et al., 1983; Otsuka & Kit, 1984; Sawyer et al., 1988; Swain
& Galloway, 1983; Wagner et al., 1981). Although the translation initiation sequence is not ideal
as defined by Kozak (1987) there is an A at position - 3 which results in 60 to 90~o of the
translation efficiency obtained by a perfect Kozak sequence (Kozak, 1987).
Apart from the disease caused by BHV-2 this virus is also of interest as it is one of the few nonhuman herpesviruses whose D N A bears nucleotide sequence homology with the HSV-1 genome
(Sterz et al., 1973/74). A direct comparison made between the BHV-2 TK gene nucleotide
sequence and that of the HSV-1 TK gene showed a relatively high level of homology (57"4~o;
data not shown). A comparison of the TK genes at the amino acid level between these viruses
reveals a striking level of homology within two distinct regions. These two conserved regions
have been identified previously in other herpesvirus TK genes (Kit, 1985). The amino acid
sequences of these two conserved regions in the BHV-2 TK gene as well as the corresponding
sequences for other known herpesviruses TK genes are presented in Fig. 3. These two regions in
the BHV-2 TK gene share the same relative spacing and orientation as that found in other
herpesvirus TK genes. Previously, Kit (1985) suggested that these conserved regions are
nucleotide (Fig. 3a) and nucleoside (Fig. 3b) binding sites; this suggestion has been further
supported by work by Darby et al. (1986) and Liu & Summers (1988). It is of interest to note that
these two conserved regions in the BHV-2 TK gene are more closely related to three of the four
human herpesviruses, HSV-1, -2 and varicella-zoster virus (VZV) than it is to BHV-1 (Fig. 3).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 11:38:58
Short communicat~n
3069
GCATGCCAGC~--~'~AGAATGCTCCGGCGGTTGACCGAGCGCATGCGCTGGAGGCCATAG
60
CCGCGCCCACTCACACGGG~'~CGGCACGGGCGAGGGCACGTCGCGCCACCTGGC
120
M
S
R
L
b
~
V
¥
V
D
G
P
H
G
L
G
TCGCGACGAACAATGAGCAGGCTACTGCGGGTGTACGTGGATGGTCCACACGGACTGGGT
17
180
R T T A
A
S R
L A
S
E
R
G
D A
I
¥
L
P
E
AAGACCACGGCGGCGTCCCGGCTGGCGTCCGAGCGTGGCGATGCGATATACCTGCCGGAG
37
240
P M S
Y W
S G A
G
E D
D
L V
A
R
V
¥
T A
CCTATGTCGTACTGGAGTGGTGCGGGCGAAGACGACCTGGTCGCTCGGGTGTATACCGCG
57
300
O
g ~ M
D
R G
K
I D A
R
Z A
A
G
V
V
L
G
CAGCACCGTATGGACCGAGGTGAGATAGACGCACGAGAAGCGGCGGGAGTAG?CCTGGGC
77
360
A
O
L T
M
S
T
P
Y Y A
L
N
G
L
I A
P
H
I
GCTCAATTGACAATGAGCACACCGTATGTGGCGCTGAACGGCCTCATCGCACCTCATATC
97
420
G
E
E
P
S
P
G
N
A
T
P
P
D
L
I
L
I
F
D
R
GGCGAGGAGCCCAGCCCCGGAAACGCCACGCCTCCGGATTTAATCCTTATCTTCGATCGC
117
480
137
H
P
T
A
S
L
L
C
Y
P
L
A
R
Y
L
T
R
C
L
P
CACCCTACTGCCTCGCTCCTCTGTTACCCGCTGGCTAGGTACCTTACTAGGTGCCTACCC
I
E
S
V
L
S
L
I
A
L
I
P
P
T
P
P
G
T
N
L
540
ATCGAATCCGTGCTGTCCCTCATCGCTCTGATACCGCCTACCCCACCCGGAACCAACTTA
157
600
I L G
T A
P A
E
D H
L
S
R
L V
A
R
G
P
P
ATCCTGGGAACGGCCCCGGCAGAAGATCACCTATCACGTCTGGTAGCGCGCGGACCGCCC
177
660
G
E L
P
D A
R
M
L R A
I R
Y
V
¥ A
L
L A
GGGGAACTCCCGGACGCACGAATGTTGCGTGCCATCCGGTACGTATACGCCCTGCTCGCC
197
720
N
T V
R
Y
L 0
S
O
G
S W
R
A
D
L G
S
E
P
AACACCGTGAAGTACCTGCAGTCCGGTGGATCTTGGCGCGCAGACTTGGGGAGCGAGCCG
217
780
P R
L P
L A
P
P
E
I G
D
P
N
N
P G
G
H
N
CCACGGCTTCCGCTGGCACCACCCGAGATCGGAGACCCCAATAACCCCGGAGGGCACAAC
237
840
T
L L A
L
I H
G
A
G
A
T
R
G
C A
A
M
T
S
ACCCTGCTGGCGCTGATCCACGGCGCTGGGGCCACCCGCGGTTGCGCCGCGATGACGTCG
257
900
W
T
L D
L
L A
D
R
L
R
S
M
N
M
F
T W
T
T
TGGACTCTAGACCTGCTGGCGGACCGACTOAGGTCAATGAACATGTTTACGTGGACTACA
277
960
A
R P
R
S
L C
G
S D
E
E
L A
P
L
D
A
V
H
GCGCGCCCCCGAAGCCTGTGTGGCTCAGATGAGGAACTTGCTCCCCTCGATGCAGTGCAC
297
1020
R
D P K T
R
I S
S R
*
CGTGACCCCAAAACCCGAATCTCATCGCGGTAGCAGATGCCGCGCTCGCCTTTATGCGAG
1080
AAATGTCAAATTGCAAATAI~CTCCTCCCGAAACCGCTAACGAGAAGCACATTGTATATT
1140
GCGTTTGTTTATATAAAATAACAAGCGCCGGC
Fig. 2. DNA nucleotidesequenceoftheentireBHV-2TK geneanditstranslatedproduct. Thepoly(A)
sequenceisunderlined andthe putative CAAT and TATA sequences areenclosed.
The latter exhibits a relatively low level of homology to BHV-2 within these two areas of the T K
gene. Recently, the entire sequence of the BHV-1 T K gene has been published (Mittal & Field,
1989). On comparing the BHV-1 and BHV-2 T K coding regions using the L K B D N A S I S 2020
program, 5 0 . 0 ~ homology was obtained, lower than the sequence homology found between
HSV-1 and BHV-2 T K genes.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 11:38:58
3070
Short communication
(a)
BHV-2(4-21)
HSV-I(49-66)
HSV-2(49-66)
VZV ( 1 2 - 2 9 )
PRV (3-20)
Marm. (10-27)
BHV-1(IO-27)
EBV (284-301)
BHV-2(II5-131)
HSV-I(162-178)
HSV-2(162-178)
VZV (129-146)
Marm.(130-146)
PRV (108-124)
BHV-I(132-148)
EBV (392-408)
LLRVYVDGPHGLGKTTAA
LLRVYIDGPHGMGKTTTT
LLRVYIDGPHGVGKTTTS
VLRIYLDGAYGIGKTTAA
ILRIYLDGAYGTGKSTTA
ILRVYLDGPHGVGKSTTA
VVRIYLDGAHGLGKTTTG
ACSLFLEGAPGVGKTTML
DRHPTASLLCYPLARYL
DRHPIAALLCYPAARYL
DRHPIASLLCYPAARYL
DRHPIASTICFPLSRYL
DRHAVASMVCYPLARFM
DRHPVAATVCFPLARFI
DRHPVAACLCYPFARYC
DRHLLSASVVFPLMLLR
Fig. 3. Comparison of the conserved regions
within herpesvirus TK genes (a) suggested nucleotide binding site; (b) suggested nucleoside
binding site (Kit, 1985). Marmoset herpesvirus,
Mama; pseudorabies virus, PRV; Epstein-Barr
virus, EBV; numbers represent position of nucleotides in the genome. Herpesvirus sequence
taken from Kit et al., 1983; Kit, 1985; Mittal &
Field, 1989; Otsuka & Kit, 1984; Sawyer et al.,
1988; Swain & Galloway, 1983; Wagner et al.,
1981.
I n c o n c l u s i o n , w e h a v e l o c a t e d t h e p r e c i s e p o s i t i o n o f a B H V - 2 T K g e n e to 30-0 to 31.0 m . u . ,
b a s e d o n t h e r e s t r i c t i o n m a p s o f B u c h m a n & R o i z m a n (I 978 a) o f t h e B H V - 2 g e n o m e . W e h a v e
also d e t e r m i n e d t h e e n t i r e s e q u e n c e o f t h i s g e n e a n d h a v e l o c a t e d a r e a s o f c o n s e r v e d s e q u e n c e
w i t h i n t h i s gene. T h e l o c a t i o n a n d c h a r a c t e r i z a t i o n o f t h i s T K g e n e r e p r e s e n t s a f u r t h e r step
t o w a r d s t h e full c h a r a c t e r i z a t i o n o f t h e B H V - 2 g e n o m e a n d f a c i l i t a t e s t h e i n v e s t i g a t i o n o f B H V 2 as a p o t e n t i a l b o v i n e v e c t o r virus.
This research was supported in part by the Australian Research Committee
REFERENCES
BUCHMAN,T. G. & ROIZMAN,B. (1978a). Anatomy of bovine mammillitis DNA. I. Restriction endonuclease maps of
four populations of molecules that differ in the relative orientation of their long and short components.
Journal of Virology 25, 395-407.
BUeHMAN, T. G. & ROIZMAN,B. (1978b). Anatomy of bovine mammillitis DNA. II. Size and arrangements of the
deoxynucleotide sequences. Journal of Virology 27, 239-254.
DARBY, G., LARDER, B. A. & INGLIS, M. M. (1986). Evidence that the 'active centre' of the herpes simplex virus
thymidine kinase involves an interaction between three distinct regions of the polypeptide. Journal of General
Virology 67, 753-758.
HAMMERSCHMIDT,W., cONrRATHS,F., MANKERTZ,J., BUHK,H.-J., PAULI,G. & LUDWIG,H. (1988a). Common epitopes
of glycoproteins B map within the major DNA-binding proteins of bovine herpesvirus type 2 (BHV-2) and
herpes simplex virus type [ (HSV-[). Virology 165, 406-418.
HAMMERSCHMIDT,W., CONRATHS,F., MANKERTZ,J., PAULI,G., LUDWIG,H. & BUHK,H.-J. (1988b). Conservation of a
gene cluster including glycoprotein B in bovine herpesvirus type 2 (BHV-2) and herpes simplex virus type 1
(HSV-I). Virology 165, 388-405.
KIT, S. (1985). Thymidine kinase. Microbiological Sciences 2, 369-375.
KIT, S., OTSUKA,H., QAVI,H., DUBBS,O. R. & TRKULA, D. 0980). Biochemical transformation of mouse cells by a
purified fragment of marmoset herpesevirus DNA. Intervirology 13, l l0-121.
KIT, S., KIT, M., QAVI, H., TRKULA, D. & OTSUKA, H. (1983). Nucleotide sequence of the herpes simplex virus type 2
(HSV-2) thymidine kinase gene and predicted amino acid sequence of thymidine kinase polypeptide and its
comparison with HSV-1 thymidine kinase gene. Biochimica et biophysica acta 741, 158-170.
KOZAK, M. (1987). At least six nucleotides preceding the A U G initiator codon enhance translation in mammalian
cells. Journal of Molecular Biology 196, 947-950.
LIU, Q. & SUMMERS,W. C. (1988). Site-directed mutagenesis of a nucleotide binding domain in HSV-I thymidine
kinase; effects of catalytic activity. Virology 163, 638-642.
LUDWIG, H. (1983). Bovine herpesviruses. In The Herpesviruses, vol. 2, pp. 135-215. Edited by B. Roizman. New
York: Plenum Press.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 11:38:58
Short communication
3071
McGEOCH, D. J., DALRYMPLE,M. A., DAVISON,A. J., DOLAN, A., FRAME, M. C., McNAB, D., PERRY, L. J., SCOT'f, J. E. &
TAYLOR, P. (1988). The complete D N A sequence of the long unique region in the genome of herpes simplex
virus type 1. Journal of General Virology 69, 1531 1574.
MARAGOS,C. & MAY, J. T. (1987). Studies on the major D N A binding proteins of two bovine herpes mammillitis
virus isolates. Acta virologica 31, 168-171.
MARAGOS,C., SHAW, R. & MAY, J. T. (1986). Restriction endonuclease cleavage analysis of D N A from two bovine
herpes mammillitis viruses, isolated in different parts of Australia. Australian VeterinaryJournal 63, 372-373.
MARTIN,W. B., MARTIN,B. & LAUNDER,I. M. (1964). Ulceration of cows' teats caused by a virus. VeterinaryRecord76,
15-16.
MARTIN, W. B., HAY, D., CRAWFORD, L. V., LE BOUVIER, G. L. & CRAWFORD, E. M. (1966). Characteristics of bovine
mammillitis virus. Journal of General Microbiology 45, 325-332.
MAY,J. T., AWAD,M., REUM, A. & SHEPPARD, M. (1989). Bovine herpes mammillitis virus thymidine kinase gene. Acta
virologica (in press).
MITTAL,S. I¢. & FIELD, H. J. (1989). Analysis of the bovine herpesvirus type I thymidine kinase (TK) gene from wildtype virus and TK-deficient mutants. Journal of General Virology 70, 901-918.
OTSUKA,rl. & KIT, S. (1984). Nucleotide sequence of the marmoset herpesvirus thymidine kinase gene and predicted
amino acid sequence of the thymidine kinase polypeptide. Virology 135, 316-330.
REYES, G. R., JEANG, K.-T. & HAYWARD,G. S. (1982). Transfection with the isolated herpes simplex virus thymidine
kinase genes. I. Minimal size of the active fragments from HSV-I and HSV-2. Journal of General Virology62,
191-206.
ROIZMAN,B., CARMICHAEL,L. E., DEINHARDT,F., DE THE, G , NAHMIAS,A. J., PLOWRIGHT,W., RAPP, F., SHELDRICK,P.,
TAKAHASHI, M. & WOLF, K. (1982). Herpesviridae: definition, provisional nomenclature and taxonomy.
Intervirology 16, 201-217.
SANGER, F., NICKLEN, S. & COULSON,A. R. (1977). D N A sequencing with chain-terminating inhibitors. Proceedings
of the National Academy of Sciences, U.S.A. 74, 5463-5467.
SAWYER, M. H., INCHAUSPE,G., BIRON, K. K., WATERS, D. I., STRAUS,S. E. & OSTROVE,J. M. (1988). Molecular analysis
of the pyrimidine deoxyribonucleoside kinase gene of wild-type and acyclovir-resistant strains of varicellazoster virus. Journal of General Virology 69, 2585-2593.
STERZ, H., LUDWIG, H. & ROTT, R. (1973/74). Immunologic and genetic relationship between herpes simplex virus
and bovine mammillitis virus. Intervirology 2, 1 13.
SWAIN, M. A. & GALLOWAY,D. A. (1983). Nucleotide sequence of the herpes simplex virus type 2 thymidine kinase
gene. Journal of Virology 46, 1045-1050.
WAGNER, i . J., SHARP, J. A. & SUMMERS,W. C. (1981). Nucleotide sequence of the thymidine kinase gene of herpes
simplex virus type 1. Proceedings of the National Academy of Sciences, U.S.A. 78, 1441-1445.
(Received 16 M a y 1989)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sun, 30 Apr 2017 11:38:58