Download Measurement of flowering time

APPENDIX S1
SUPPORTING TEXT
Analysis of StCO transcript levels
Analysis of StCO expression by RNA blot revealed three StCO-specific bands that
follow the same oscillation pattern (Figure 2). The upper band corresponds to a partially
spliced transcript (A. Martin and P. Suárez-López, unpublished results) and the middle
band corresponds to the expected size for StCO mRNA (1.5 kb). Although we do not
know the exact nature of the lower band, it is undoubtedly a StCO-specific band, since it
is present not only in potato plants, but also in Arabidopsis plants that express StCO
(Figure S4).
Effect of StCO on flowering
Our results indicate that StCO weakly affects flowering (Figure 3 and S2). This effect
might be mediated by StSP3D, a potato FT-like protein that promotes flowering
(Navarro et al., 2011). Therefore, a CO/FT module may act in the control of flowering
in day-neutral plants. Interestingly, the closest homologue to StSP3D in tomato,
SINGLE FLOWER TRUSS (SFT), regulates day-neutral flowering (Lifschitz et al.,
2006). It remains to be shown whether any of the three tomato members of CO family
group Ia plays a role in tomato flowering, since the results reported so far do not
exclude this possibility (Ben-Naim et al., 2006). Whether other CO family genes from
potato have a stronger effect on flowering is still unknown.
Flowering takes place earlier in 35S::StCO than wild-type plants (Figure 3a-b). Thus,
we propose that StCO can act as a weak flowering promoter when it is expressed at high
levels. In Arabidopsis 35S::StCO plants under LDs, StCO would be present at much
1
higher levels than the endogenous CO. Therefore, StCO would compete with CO and it
would weakly promote flowering, leading to later flowering than in wild-type plants. In
a co-2 mutant, that is, in the absence of endogenous CO function, StCO would also
promote flowering weakly, making the plants flower earlier than the co-2 mutant, but
later than the WT. This might also explain the slight early flowering of Arabidopsis
35S::StCO plants under SDs.
Expression of Arabidopsis CO in potato causes late flowering, not early flowering as
would be expected (González-Schain and Suárez-López, 2008), suggesting that the
effect of CO proteins on flowering can be positive or negative depending on the
biological context.
SUPPORTING EXPERIMENTAL PROCEDURES
Analysis of mRNA levels
For RNA blot analysis, 20 µg of RNA were separated on 1.2% denaturing agarose gels
and transferred to Hybond N membranes (Amersham, http://www.amersham.com/).
RNA Markers from Promega were used as RNA ladder. Hybridisation with
radioactively labelled probes and washes were done as described previously (SuárezLópez et al., 2001). The StCO and 18S rRNA probes are described in the main text.
Probes were radioactively labelled using the Random Primed DNA Labelling kit (Roche
Diagnostics, http://www.roche.es). Blot images were visualised using a Molecular
Imager® FX (Bio-Rad, http://www.biorad.com) and band intensities were quantified
using Quantity One® software (version 4.1.1, Bio-Rad). Values were represented
relative to the lowest value after normalisation to the 18S control. Alternatively, the
2
presence of equivalent amounts of RNA on each lane was assessed by staining the
membranes with methylene blue (Wilkinson et al., 1991).
For reverse transcription followed by PCR (RT-PCR), 1 µg of RNA was used for
reverse transcription using oligo-dT and MMLV reverse transcriptase (Invitrogen,
http://www.invitrogen.com) according to the manufacturer’s instructions. The resulting
cDNAs were diluted 50-fold with water and 1 µl was used as template for PCR. A StCO
fragment was amplified using primers 5’-AGGCCAAGAATCAAAGGC and 5’ACTGCTGTAGTACATTTCTC and a control StACTIN (StACT) fragment, using
primers previously described (Martin et al., 2009). Eighteen PCR cycles, in the
exponential phase of amplification, were used. The resulting PCR products were
separated on agarose gels, blotted onto Hybond N membranes (Amersham,
http://www.amersham.com) and hybridised with radioactively labelled probes.
For reverse transcription followed by real-time quantitative PCR (RT-qPCR), 1-3 µg
of RNA were used for reverse transcription as previously described (Martin et al.,
2009). Real-time qPCR was performed on a LightCycler® 480 Real-Time PCR System
(Roche Diagnostics Ltd, http://www.roche.ch/en/standorte/rotkreuz.htm) following a
protocol previously described (Martin et al., 2009), except that 1 µl of cDNA was used
for StFT/StSP6A qPCR. PCR reactions, in triplicate, were incubated at 95°C for 10 min,
followed by 45 cycles of 95°C for 15 sec and 60°C for 30 sec (for StFT/StSP6A) or
95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec (for StCO). Specificity of PCR
was checked with dissociation curve and quantification was standardised to StACT
mRNA levels. Data from RT-qPCR were analysed using the 2-ΔΔCt method (Livak and
Schmittgen, 2001). Primers used are described in the main text.
3
Generation of 35S::StCO and StCO-RNAi constructs
To create a fusion of the StCO coding sequence to the CaMV 35S promoter
(35S::StCO), a PCR product was amplified from the StCO clone 10.1.1 using primers
5’-CGGTCGACATGTTGAAAAAAGAG-3’
and
5’-
GACTGCAGTCAGAATGAAGGGAC-3’. A 1243-bp SalI/PstI fragment from this
PCR product was inserted into the SalI and PstI sites of the pCHF3 vector (Borevitz et
al., 2000). The resulting pCHF3-StCO construct was cut with PstI, made blunt using T4
DNA polymerase, digested with BamHI and a 1255-bp fragment was inserted into the
SalI (made blunt-ended) and BamHI sites of the pBINAR vector (Höfgen and
Willmitzer, 1990), generating plasmid pBINAR-StCO.
To silence StCO, a fragment of the middle region of the gene was used to generate a
StCO-RNAi construct. Primers 5’-CGGAATTCAAGCTTTGAAGCAGCTTCATGG3’ and 5’-ATGGATCCCTCGAGCTCTTCTGAGGAACAG-3’ were used to amplify a
PCR product using StCO clone 10.1.1 as template. This PCR product was digested with
XhoI/EcoRI and the resulting 234 bp fragment was cloned into XhoI/EcoRI-digested
pENTRTM3C (Invitrogen, http://www.invitrogen.com). The resulting plasmid was used
to transfer the StCO fragment into pHELLSGATE12 (Helliwell and Waterhouse, 2003)
by Gateway® recombination, generating plasmid pHELL12-StCOi, which contains two
copies of the StCO fragment in opposite orientations separated by an intron, under the
control of the 35S promoter.
CAPS marker for the co-2 mutation
The Arabidopsis co-2 mutation creates a SspBI restriction site that allowed us to
develop a CAPS marker. DNA was isolated from F2 plants from a cross between At-
4
35S::StCO plants (line 27) and the co-2 mutant. A CO fragment was amplified by PCR
using
primers
5’-TAGGCACTCAGGATTCGATCTC-3’
and
5’-
GTGTTGACTGTATTCACCTGTG-3’. The resulting 710 bp PCR product was
digested with SspBI, which cleaves co-2 DNA yielding two fragments of 297 and 413
bp, whereas wild-type DNA remains intact. The digestion products were separated on
1.3% agarose gels stained with ethidium bromide.
Measurement of flowering time
Potato wild-type, 35S::StCO and StCO-RNAi plants were grown in the LD greenhouse
and transferred to a SD controlled environment chamber at the 10-15 leaf stage,
approximately 4 weeks after potting. Wild-type plants were also grown under SDs and
LDs from the moment they were planted in soil. The shoot apex was carefully checked
for visible signs of flowering every two days. Flowering time was measured as the
number of days from planting in soil to the appearance of the floral bud. Leaf number
was also recorded at the time the floral bud was visible.
SUPPORTING REFERENCES
Ben-Naim, O., Eshed, R., Parnis, A., Teper-Bamnolker, P., Shalit, A., Coupland,
G., Samach, A. and Lifschitz, E. (2006) The CCAAT binding factor can mediate
interactions between CONSTANS-like proteins and DNA. Plant J., 46, 462-476.
Böhlenius, H., Huang, T., Charbonnel-Campaa, L., Brunner, A.M., Jansson, S.,
Strauss, S.H. and Nilsson, O. (2006) CO/FT regulatory module controls timing of
flowering and seasonal growth cessation in trees. Science, 312, 1040-1043.
5
Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A. and Lamb, C. (2000) Activation
tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant
Cell, 12, 2383-2394.
Drobyazina, P.E. and Khavkin, E.E. (2006) A structural homolog of CONSTANS in
potato. Russ. J. Plant Physiol., 53, 698-701.
Drobyazina, P.E. and Khavkin, E.E. (2011) The structure of two CONSTANS-LIKE1
genes in potato and its wild relatives. Gene, 471, 37-44.
González-Schain, N.D. and Suárez-López, P. (2008) CONSTANS delays flowering
and affects tuber yield in potato. Biol. Plantarum, 52, 251-258.
Griffiths, S., Dunford, R.P., Coupland, G. and Laurie, D.A. (2003) The evolution of
CONSTANS-like gene families in barley, rice, and Arabidopsis. Plant Physiol., 131,
1855-1867.
Guo, J.L., Yang, Q., Liang, F., Xing, Y.J. and Wang, Z. (2007) Molecular cloning
and expression analysis of a novel CONSTANS-like gene from potato. Biochemistry
(Mosc), 72, 1241-1246.
Hättasch, C., Flachowsky, H., Kapturska, D. and Hanke, M.-V. (2008) Isolation of
flowering genes and seasonal changes in their transcript levels related to flower
induction and initiation in apple (Malus domestica). Tree Physiol., 28, 1459-1466.
Hecht, V., Foucher, F., Ferrándiz, C., Macknight, R., Navarro, C., Morin, J.,
Vardy, M.E., Ellis, N., Beltrán, J.P., Rameau, C. and Weller, J.L. (2005)
Conservation of Arabidopsis flowering genes in model legumes. Plant Physiol., 137,
1420-1434.
Helliwell, C. and Waterhouse, P. (2003) Constructs and methods for high-throughput
gene silencing in plants. Methods, 30, 289-295.
6
Heuertz, M., De Paoli, E., Kallman, T., Larsson, H., Jurman, I., Morgante, M.,
Lascoux, M. and Gyllenstrand, N. (2006) Multilocus patterns of nucleotide diversity,
linkage disequilibrium and demographic history of Norway spruce [Picea abies (L.)
Karst]. Genetics, 174, 2095-2105.
Höfgen, R. and Willmitzer, L. (1990) Biochemical and genetic analysis of different
patatin isoforms expressed in various organs of potato (Solanum tuberosum). Plant Sci.,
66, 221-230.
Lagercrantz, U. and Axelsson, T. (2000) Rapid evolution of the family of CONSTANS
LIKE genes in plants. Mol. Biol. Evol., 17, 1499-1507.
Ledger, S.E., Dare, A.P. and Putterill, J.J. (1996) COL2 (Accession No. L81119 and
L81120) is a homologue of the Arabidopsis flowering-time gene CONSTANS (PGR96081). Plant Physiol., 112, 862.
Lifschitz, E., Eviatar, T., Rozman, A., Shalit, A., Goldshmidt, A., Amsellem, Z.,
Alvarez, J.P. and Eshed, Y. (2006) The tomato FT ortholog triggers systemic signals
that regulate growth and flowering and substitute for diverse environmental stimuli.
Proc. Natl. Acad. Sci. USA, 103, 6398-6403.
Liu, J., Yu, J., McIntosh, L., Kende, H. and Zeevaart, J.A. (2001) Isolation of a
CONSTANS ortholog from Pharbitis nil and its role in flowering. Plant Physiol., 125,
1821-1830.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2-CT Method. Methods, 25, 402-408.
Martin, J., Storgaard, M., Andersen, C.H. and Nielsen, K.K. (2004) Photoperiodic
regulation of flowering in perennial ryegrass involving a CONSTANS-like homolog.
Plant Mol. Biol., 56, 159-169.
7
Martin, A., Adam, H., Díaz-Mendoza, M., Żurczak, M., González-Schain, N.D. and
Suárez-López, P. (2009) Graft-transmissible induction of potato tuberization by the
microRNA miR172. Development, 136, 2873-2881.
Martínez-García, J.F., Virgós-Soler, A. and Prat, S. (2002) Control of photoperiodregulated tuberization in potato by the Arabidopsis flowering-time gene CONSTANS.
Proc. Natl. Acad. Sci. USA, 99, 15211-15216.
Moon, Y.H., Chae, S.J., Jung, J.Y. and An, G.H. (1998) Expressed sequence tags of
radish flower buds and characterization of a CONSTANS LIKE 1 gene. Mol. Cells, 8,
452-458.
Navarro, C., Abelenda, J.A., Cruz-Oro, E., Cuellar, C.A., Tamaki, S., Silva, J.,
Shimamoto, K. and Prat, S. (2011) Control of flowering and storage organ formation
in potato by FLOWERING LOCUS T. Nature, 478, 119-122.
Nemoto, Y., Kisaka, M., Fuse, T., Yano, M. and Ogihara, Y. (2003) Characterization
and functional analysis of three wheat genes with homology to the CONSTANS
flowering time gene in transgenic rice. Plant J., 36, 82-93.
Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995) The
CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing
similarities to zinc finger transcription factors. Cell, 80, 847-857.
Putterill, J.J., Ledger, S.E., Lee, K., Robson, F., Murphy, G. and Coupland, G.
(1997) The flowering-time gene CONSTANS and homologue CONSTANS LIKE 1
(accession nos. Y10555 and Y10556) exist as a tandem repeat on chromosome 5 of
Arabidopsis (PRG97-077). Plant Physiol., 114, 396.
8
Robert, L.S., Robson, F., Sharpe, A., Lydiate, D. and Coupland, G. (1998)
Conserved structure and function of the Arabidopsis flowering time gene CONSTANS in
Brassica napus. Plant Mol. Biol., 37, 763-772.
Robson, F., Costa, M.M.R., Hepworth, S.R., Vizir, I., Piñeiro, M., Reeves, P.H.,
Putterill, J. and Coupland, G. (2001) Functional importance of conserved domains in
the flowering-time gene CONSTANS demonstrated by analysis of mutant alleles and
transgenic plants. Plant J., 28, 619-631.
Serrano, G., Herrera-Palau, R., Romero, J.M., Serrano, A., Coupland, G. and
Valverde, F. (2009) Chlamydomonas CONSTANS and the Evolution of Plant
Photoperiodic Signaling. Curr. Biol., 19, 359-368.
Shimizu, M., Ichikawa, K. and Aoki, S. (2004) Photoperiod-regulated expression of
the PpCOL1 gene encoding a homolog of CO/COL proteins in the moss Physcomitrella
patens. Biochem. Biophys. Res. Commun., 324, 1296-1301.
Song, J., Yamamoto, K., Shomura, A., Itadani, H., Zhong, H.S., Yano, M. and
Sasaki, T. (1998) Isolation and mapping of a family of putative zinc-finger protein
cDNAs from rice. DNA Res., 5, 95-101.
Suárez-López, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F. and
Coupland, G. (2001) CONSTANS mediates between the circadian clock and the control
of flowering in Arabidopsis. Nature, 410, 1116-1120.
Wilkinson, M., Doskow, J. and Lindsey, S. (1991) RNA blots: staining procedures
and optimization of conditions. Nucleic Acids Res., 19, 679.
Xu, X., Pan, S., Cheng, S., Zhang, B., Mu, D., Ni, P., Zhang, G., Yang, S., Li, R.,
Wang, J., Orjeda, G., Guzman, F., Torres, M., Lozano, R., Ponce, O., Martinez, D.,
De La Cruz, G., Chakrabarti, S.K., Patil, V.U., Skryabin, K.G., Kuznetsov, B.B.,
9
Ravin, N.V., Kolganova, T.V., Beletsky, A.V., Mardanov, A.V., Di Genova, A.,
Bolser, D.M., Martin, D.M.A., Li, G., Yang, Y., Kuang, H., Hu, Q., Xiong, X.,
Bishop, G.J., Sagredo, B., Mejía, N., Zagorski, W., Gromadka, R., Gawor, J.,
Szczesny, P., Huang, S., Zhang, Z., Liang, C., He, J., Li, Y., He, Y., Xu, J., Zhang,
Y., Xie, B., Du, Y., Qu, D., Bonierbale, M., Ghislain, M., Herrera, M.d.R.,
Giuliano, G., Pietrella, M., Perrotta, G., Facella, P., O'Brien, K., Feingold, S.E.,
Barreiro, L.E., Massa, G.A., Diambra, L., Whitty, B.R., Vaillancourt, B., Lin, H.,
Massa, A.N., Geoffroy, M., Lundback, S., DellaPenna, D., Buell, C.R., Sharma,
S.K., Marshall, D.F., Waugh, R., Bryan, G.J., Destefanis, M., Nagy, I., Milbourne,
D., Thomson, S.J., Fiers, M., Jacobs, J.M.E., Nielsen, K.L., Sønderkær, M., Iovene,
M., Torres, G.A., Jiang, J., Veilleux, R.E., Bachem, C.W.B., de Boer, J., Borm, T.,
Kloosterman, B., van Eck, H., Datema, E., Hekkert, B.L., Goverse, A., van Ham,
R.C.H.J. and Visser, R.G.F. (2011) Genome sequence and analysis of the tuber crop
potato. Nature, 475, 189-195.
Yano, M., Katayose, Y., Ashikari, M., Yamanouchi, U., Monna, L., Fuse, T., Baba,
T., Yamamoto, K., Umehara, Y., Nagamura, Y. and Sasaki, T. (2000) Hd1, a major
photoperiod sensitivity quantitative trait locus in rice, is closely related to the
Arabidopsis flowering time gene CONSTANS. Plant Cell, 12, 2473-2483.
10