* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download here
Molecular cloning wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Koinophilia wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Human genetic variation wikipedia , lookup
Human genome wikipedia , lookup
Gene therapy wikipedia , lookup
Primary transcript wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genome evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genetic drift wikipedia , lookup
Genome (book) wikipedia , lookup
Genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Population genetics wikipedia , lookup
Medical genetics wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genome editing wikipedia , lookup
Frameshift mutation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Oncogenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Dominance (genetics) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Honors Bio: Study Guide: Human Genetics Quiz Text References: 10 (replication, transcription, translation), 12 (human genetics, chromosomes and inheritance) and 13-2 (human genome) Be able to: o Explain what a mutation is: ______________________________________________ _____________________________________________________________________ o “How” a mutation can occur: _____________________________________________ _____________________________________________________________________ o Transcribe (DNA to mRNA) o Example… original DNA: TACCCCGGTAAACTCTTTAAATAC Transcribe: o Identify gene mutations including point mutations (substitutions) and frame shift mutations (insertions and deletions) o Example… original DNA: TACCCCGGTAAACTCTTTAAATAC Decide whether the following mutations represent substitutions, insertions or deletions: o Mutated DNA: TACCCCGGTAATCTCTTTAAATAC _________________________ o Mutated DNA: TACCCCCGGTAAACTCTTTAAATAC _________________________ o Mutated DNA: TACCCCGGTAAACTCTTTAATAC _________________________ o Differentiate between the three types of mutations: o Lethal: ________________________________________________________ o Germ cell: ______________________________________________________ o Somatic cell: ____________________________________________________ o Differentiate between types of chromosomal mutations: o Deletion: _______________________________________________________ o Inversion: ______________________________________________________ o Translocation: ___________________________________________________ o Nondisjunction: __________________________________________________ o Duplication: _____________________________________________________ o Distinguish between monosomy and trisomy nondisjunction disorders. o Nondisjunction: __________________________________________________ o Monosomy: _____________________________________________________ o Trisomy: _______________________________________________________ Example: Trisomy 21 [also known as ___________________________] and XXY [also known as ____________________________] are TRISOMY disorders while Turner’s Syndrome [also known as _____________] is a MONOSOMY disorder. Know how many chromosomes are in each cell of those affected with trisomy and monosomy. o Distinguish between sex-linked, sex-influenced, polygenic and multiple allele traits. Be able to cite examples: o Sex-linked: _____________________________________________________ o Sex-influenced: _________________________________________________ o Polygenic: ______________________________________________________ o Multiple allele: __________________________________________________ o Be able to distinguish between the genotypes for Type A, B, AB and O blood (be able to create a punnett square, if asked): o IAIA :_________________________ o IBIB :_________________________ o IAIB :_________________________ o IBi :__________________________ o IAi :__________________________ o ii :__________________________ o Distinguish between three types of genetic disorder pathways: Autosomal Dominant, Autosomal Recessive and Sex-linked (X-linked). o Example… Decide if the following genotypes represent “affected”, “normal” or “carrier” o Dominant Allele Disorders: AA- ______________________ Aa- ______________________ aa- ______________________ o Recessive Allele Disorders: AA- ______________________ Aa- ______________________ (phenotypically normal, but can still pass on the allele to offspring) aa- ______________________ o X-linked Disorders Male: X Y- ______________________ X Y- ______________________ Female: X X- _____________________ X X- _____________________ (phenotypically normal, but can still pass on the allele to offspring) X X- ______________________ o Know what a complex character is: ________________________________________________ _______________________________________________________________________Be able to cite examples of complex characters: o Be able to determine red and white eye color in male and female flies, as evidenced by Morgan’s experimentation with sex-linked traits. o Know what linked genes are (linkage groups and gene mapping). o Know the pathways of the various genetic disorders we’ve learned about. Reference your notes. o Pedigrees- know how to draw them and interpret them o Know symbols for male and female (inclusive of those who are normal, affected and carriers). Know how to indicate “unknown gender” and “death”. o Know how to assign genotypes to pedigrees (dominant, recessive and X-linked) o Know what genetic counseling is: __________________________________________________ o Know what amniocentesis and chorionic villi sampling are: _____________________________________________________________________________________________ _____________________________________________________________________________________________ ___________________________ o Distinguish between germ cell gene therapy and somatic cell gene therapy: _____________________________________________________________________________________________ _____________________________________________________________________________________________ _____________________________________________________________________________________________ _____ o Be able to answer critical thinking questions.