* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Name
History of genetic engineering wikipedia , lookup
Molecular cloning wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epigenomics wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Human genome wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Polyadenylation wikipedia , lookup
History of RNA biology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
Frameshift mutation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Transfer RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Protein Synthesis Review 1-3. Summarize the codes for the following: Replication DNA to A G 4-5. Name: Transcription DNA to A T G Translation mRNA to U G What would be the complementary DNA base pair sequences of the DNA sequence listed below? ACGTTTACGAAGCTAGCCGAT TATACGCATCCGACGTACGAT 6-8. There are some differences between DNA and RNA. List 3 of them below 9. What is the process of “rewriting” DNA into mRNA code called? 10. Transcribe the following DNA sequence into mRNA code DNA: T A C A T G A C G A T A C A G T G T T A C G T T C C T A A T G G A A T C mRNA:__________________________________________________________ 11. Now draw lines between each group of 3 nucleotides (these groups are called codons) you just transcribed above. Ex: UAG/UGC/… 12-17. Look at the amino acid translation chart (in your notes). Find which amino acid each codon from above is coding for. a. e. i. b. f. j. c. g. k. d. h. l. 18. A large amount of amino acid monomers combine to form what polymer (macromolecule)? 1 19. Transcribe the following DNA sequence into mRNA: TACAGTCGGTCGAAGTCGATGGTTTCGGCTCGAATC 20. Now draw lines between each group of 3 nucleotides (these groups are called codons) you just transcribed above. Ex: UAG/UGC/… 21-26. Look at the amino acid translation chart (in your notes). Find which amino acid each codon from above is coding for. e. i. a. b. c. d. f. j. g. k. h. l. 27-32. Now, for each codon (in the mRNA sequence) write down the anticodon (tRNA). For example, if the mRNA codon is AUU, then the anticodon is UAA q. u. m. r. v. o. s. w. p. t. x. n. 33-37. Label where you would find each of the following. If it’s both inside and outside the nucleus, show an arrow coming out of the nucleus. □ DNA □ ribosomes □ mRNA □ tRNA □ amino acids 2 Translation WS Bio I 1. A codon is 2. Summarize the codes for changing mRNA into tRNA: List the bases found in mRNA, then write the base pair for that letter in the tRNA box. mRNA base tRNA base 3. What is the process of translating mRNA into proteins called? 4. How many different amino acids are there? 5. Translation ends when a codon is reached 6-10. Follow the steps below to change mRNA sequence into amino acids A mRNA: A U G /A U C G A U C C C G G G C G G G G C U U U C C U U A A Draw lines between each group of 3 letters (these groups are called codons). Ex: UAG/UGC/… Now put a letter above or below each codon, starting with A, B, C etc… Look at the amino acid translation chart (in your notes). Find which amino acid each codon from above is coding for and write them below. A. E. I. B. F. J. C. G. D. H. 11-15. Follow the steps below to change mRNA sequence into amino acids mRNA: A U G A U U U U C C U A U G U U G G C G A G A C C A C U A A K. L. Draw lines between each group of 3 letters (these groups are called codons). Ex: UAG/UGC/… Now put a letter above or below each codon, starting with K, L, M etc… Look at the amino acid translation chart (in your notes). Find which amino acid each codon from above is coding for and write them below. M. N. O. P. 3 Q. R. S. T. 16-20. Follow the steps below to change mRNA sequence into amino acids mRNA: A U G G A A G U G U A C G G U A G C U U U U C C U C G U A A U. V. W. X. Draw lines between each group of 3 letters (these groups are called codons). Ex: UAG/UGC/… Now put a letter above or below each codon, starting with U, V, W etc… Look at the amino acid translation chart (in your notes). Find which amino acid each codon from above is coding for and write them below. Y. Z. AA. BB. CC. DD. _____ 21. What are the building blocks of proteins? 22-24. What would be the complementary tRNA base pair sequences of the mRNA sequence listed below? A C G UUU A C G A A G C U A G C C G A U UAUACGCAUCCGACGUACGAU UAGGCUAUGUAUUUGCGGGAA 25. Transcription occurs in the ___________________, while translation occurs in the __________________________. 4