Download Supplementary Methods

Supplementary Methods
Cell culture, SILAC and RNAi
LS174T is a colorectal carcinoma cell line with an oncogenic β-catenin allele. In order to
knock down β-catenin expression we used LS174T cells carrying a stably integrated,
inducible small-hairpin RNA vector against β-catenin1, a generous gift from Hans
Clevers, Utrecht. For SILAC experiments, the cells were grown in RPMI 1640 medium
lacking arginine, lysine and methionine (a custom preparation from Gibco) supplemented
with L-methionine (15 mg/l) and 5% dialyzed fetal bovine serum (Gibco). ‘Heavy’ and
‘light’ media were prepared by adding 84 mg/l 13C615N4 L-arginine and 40 mg/l 13C615N2
L-lysine (Sigma Isotec) or the corresponding non-labeled amino acids, respectively. The
cells were cultivated in SILAC media for one week and split every second day. In order
to induce shRNA expression 1 µg/ml doxycycline (Sigma-Aldrich) was added to 2 x 107
‘light cells’ directly after transfer to fresh tissue culture dishes while the corresponding
‘heavy cells’ were transferred without further treatment. In parallel, a crossover
experiment was performed by adding doxycycline to the “heavy” cells instead. Cells
were grown for two days at 37 °C and 5 % CO2 before they were harvested.
For the Cbl experiments we used SILAC labeled 293T cells transiently transfected with a
pool of three siRNAs (stealthTM siRNAs, Invitrogen). The sequences of the oligos were
as follows:
siRNA1: AUACGUACAGCUAUCAAUCUGCUGG,
siRNA2: AAAGCUUUCUGGAUGUCCUGGUAGG,
siRNA3: UUUCCGUUCAGAGUUGAUUCUCCGC
Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the
manufacturer’s protocol. We transfected four 14-cm tissue culture dishes per condition at
about 25% confluence. Cells were harvested three days after transfection at about 90%
confluence.
1
Immunoprecipitation and in-solution digestion
We used antibodies against β-catenin (clone E-5, Santa Cruz) and Cbl (clone 17, BD
Transduction). In order to prevent interference of excess of antibodies with mass
spectrometric detection we coupled the antibodies to protein G agarose (Sigma-Aldrich)
or protein G dynabeads (Dynal) with dimethyl pimelimidate as described previously2.
The 293T cells were treated with 1 mM sodium ortho-vanadate for 30 min before
harvesting in order to boost cellular tyrosine phosphorylation. Cells were washed with
PBS, harvested in ice-cold lysis buffer [50 mM Tris pH 7.4, 140 mM NaCl, 1 % TX-100,
complete© (Roche) protease inhibitors, 1 mM sodium ortho-vanadate (only for Cbl
pulldown)], lysed on ice for 30 min and pre-cleared by 5 min centrifugation at 10,000 g.
Supernatants were incubated with 10 µg conjugated antibody for 3 h at 4 °C with
overhead rotation. In order to investigate possible global changes in protein abundance
induced by RNAi we collected a sample of the supernatant for quantitation. The
precipitates of the corresponding pulldowns were combined and washed 3 times with 2
ml lysis buffer in chromatography columns (BioRad) or, in case of the dynabeads, with
the help of a magnet (Dynal). The fourth wash was performed with lysis buffer lacking
TX-100. Bound proteins were eluted with 3 x 100 µl 100 mM glycine pH 2.5. Eluted
proteins were precipitated by adding 1 µl GlycoBlue (Ambion), 80 µl 2.5 M Na acetate
pH 5.0 and 1500 µl ethanol. The precipitated proteins were pelleted (16,000 g, 30 min),
solubilized in 2 M urea / 6 M thiourea, reduced, alkylated and digested with LysC
endoproteinase (Wako) and sequence grade modified trypsin (Promega). The Cbl
pulldown was separated on an SDS-PAGE gel (Novex 4-12% gradient gel, Invitrogen)
and cut into eight slices prior to MS analysis. The whole cell lysate was loaded on a very
short gel and analyzed as a single gel slice. Gel slices were reduced, alkylated and trypsin
digested using standard in-gel digestion protocols.
Mass spectrometry
Peptides were concentrated and desalted on reversed phase C18 disks3 and analyzed by
nanoflow liquid chromatography an Agilent 1100 LC system (Agilent Technologies Inc.)
coupled to a Finnigan LTQ-FT or LTQ-Orbitrap (Thermo Electron). Peptides were
separated on a C18-reversed phase column packed with Reprosil (ReproSil-Pur C18-AQ 3μm resin (Dr. Maisch GmbH)) and directly mounted on the electrospray ion source of an
LTQ-FT or LTQ-Orbitrap. We used a 140 min gradient from 2% to 60% acetonitrile in
2
0.5% acetic acid at a flow of 250 nl/min. The LTQ-FT instrument was operated in the
data dependent mode switching automatically between MS survey scans and high mass
accuracy SIM (Single Ion Monitoring) scans (both acquired in the FT-ICR cell) and
MS/MS spectra acquisition in the linear ion trap as described previously4. The LTQOrbitrap was operated in the data dependent mode with a full scan in the Orbitrap
followed by five MS/MS scans in the LTQ.
Data analysis
The raw data files were converted to the Mascot generic format and searched with the
Mascot search engine (http://www.matrixscience.com) against the IPI human protein
database (http://www.ebi.ac.uk). Carbamidomethylation was selected as a fixed
modification. Oxidation of methionine, N-acetylation of the protein, 13C615N4 arginine
and 13C615N2 lysine were used as variable modifications. We required full tryptic
specificity with up to two missed cleavages and a mass-accuracy of 5 ppm for the parent
ion spectra and 0.5 Da for MS/MS spectra. We only considered proteins that were
identified with at least two peptides (score > 20). Mass spectrometric data was quantified
and validated with MSQuant (http://msquant.sourceforge.net) and exported to Excel
(Microsoft) for further analysis. Ratios obtained from different peptides identifying the
same protein were averaged and the standard deviation was determined. The averaged
protein ratios were normalized by dividing them by the median of all measured ratios. In
the case of Cbl we used the median determined from the abundance ratios in the whole
cell lysate to normalize both the ratios of the proteins in the IP and the whole cell lysate.
As potential interaction partners of β-catenin are expected to have a reciprocal ratio in the
crossover experiment, we excluded proteins with ratios smaller than 0.8 or greater than
1.2 that had similar ratios in both experiments (e.g. both ratios > 1.2). In addition, we
excluded all proteins from the dataset that were not identified in the crossover
experiment. All given protein ratios are the means of at least two peptide ratios. For βcatenin, Cbl and their detected interaction partners the ratios for the quantified peptides
and the standard deviation is given in Supplementary Table 1 and 2, respectively.
Proteins with significantly increased ratios in the Cbl pull-down that were not outliers
according to the statistical test are listed in Supplementary Table 3. The list of proteins
identified in the whole cell lysates after siRNA-mediated knock-down of Cbl is given in
Supplementary Table 4.
3
Statistical analysis
In order to test whether some of the determined ratios were significantly different from
the 1:1 ratios characteristic of background proteins (i.e. statistical outliers) we applied the
iterative Grubbs test5. Briefly, the quotient of the highest absolute deviation from the
mean and the standard deviation is calculated. If this number exceeds the critical value
for the confidence level the data point is considered to be an outlier. The outlier is
removed and the test is repeated to detect possible further outliers. β-catenin and the three
interaction partners were identified as outliers (p < 0.01) while the ratio deviations of all
other proteins were not significant (p > 0.05). The Cbl pulldown contained several
proteins with increased ratio, possibly caused by indirect binders. Therefore, we
performed the Grubbs test at two levels: The detection of Cbl interaction partners was
performed using the log10 values of the ratios (p < 0.05). The Grubbs test on the linear
values identified additional outliers in this dataset that are listed in Table 3 (p < 0.01).
References to Supplementary Methods
1.
2.
3.
4.
5.
van de Wetering, M. et al. Specific inhibition of gene expression using a stably
integrated, inducible small-interfering-RNA vector. EMBO Rep 4, 609-615
(2003).
Schneider, C., Newman, R.A., Sutherland, D.R., Asser, U. & Greaves, M.F. A
one-step purification of membrane proteins using a high efficiency
immunomatrix. J Biol Chem 257, 10766-10769 (1982).
Rappsilber, J., Ishihama, Y. & Mann, M. Stop and go extraction tips for matrixassisted laser desorption/ionization, nanoelectrospray, and LC/MS sample
pretreatment in proteomics. Anal Chem 75, 663-670 (2003).
Olsen, J.V., Ong, S.E. & Mann, M. Trypsin cleaves exclusively C-terminal to
arginine and lysine residues. Mol Cell Proteomics 3, 608-614 (2004).
Grubbs, F.E. Procedures for detecting outlying observations in samples.
Technometrics 11, 1-21 (1969).
4