* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download gene expression - cloudfront.net
Peptide synthesis wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Polyadenylation wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Protein adsorption wikipedia , lookup
Bottromycin wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Protein structure prediction wikipedia , lookup
Proteolysis wikipedia , lookup
List of types of proteins wikipedia , lookup
Non-coding RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Biochemistry wikipedia , lookup
Expanded genetic code wikipedia , lookup
GENE EXPRESSION During the 1950’s and 1960’s, it became apparent that Deoxyribonucleic Acid (DNA) is essential in the synthesis of proteins. Proteins are used in enzymes and as structural materials in cells. Many specialized proteins function in cellular activities. For example, in humans, the hormone insulin and the muscle cell filaments are composed of protein. The hair, skin and nails of humans are composed of proteins, as are all the hundreds of thousands of enzymes n the body. The key to a protein molecule is how the amino acids are linked. The sequence of amino acids in a protein is a type of code that specifies the protein and distinguishes one protein from another. A genetic code in the DNA determines the amino acid sequence. The genetic code consists of the sequence of nitrogenous bases in the DNA. The bases in DNA are: ADENINE (A) THYMINE (T) CYTOSINE (C) GUANINE (G) For protein synthesis to occur, several essential elements are necessary, such as a supply of 20 amino acids, enzymes, DNA and Ribonucleic Acid (RNA). RNA carries the instruction form the nuclear DNA into the cytoplasm, where protein is synthesized. RNA is similar to DNA with 3 exceptions: 1. The carbohydrate (5 carbon sugar) in RNA is ribose rather than deoxyribose. 2. RNA contains the nitrogenous base URACIL rather than thymine. 3. RNA is single stranded rather than double stranded as in DNA. In Eukaryotes DNA is found in the nucleus of the cell. In Prokaryotes DNA is found in the cytoplasm of the cell. DNA molecules pass inherited information to RNA, more specifically, messenger RNA (mRNA) which in turn codes for proteins. The flow of information is represented as: DNA mRNA Protein This flow of information is known as the CENTRAL DOGMA of molecular biology. Types of RNA There are four types of RNA involved in protein synthesis. 1. Ribosomal RNA (rRNA) - which is used to manufacture ribosomes. Ribosomes are ultramicroscopic particles of ribosomal RNA and protein. They are the places where amino acids are linked to one another to synthesize proteins. Ribosomes may exist along the membrane of the endoplasmic reticulum in the cytoplasm of the cell, or they can be freefloating. 2. Transfer RNA (tRNA) – exists in the cell cytoplasm and carries amino acids to the ribosome for protein synthesis. tRNA molecules are linked to amino acids in a highly 1 specicific manner. For example, tRNA molecule X will only link with amino acid X; tRNA Y will only link with amino acid Y. 3. Messenger RNA (mRNA) – mRNA is synthesized in the nucleus. During synthesis the genetic information is transferred from the DNA molecule to the mRNA molecule which then carries this code to a ribosome in the cytoplasm where protein synthesis takes place. 4. Small nuclear RNA (snRNA) – These molecules of RNA are involved in splicing and RNA processing in Eukaryotes (we will not be concerned with these molecules). Summary of Protein Synthesis DNA TRANSCRIPTION NUCLEUS mRNA CYTOPLASM rRNA (SMALL UNIT AND LARGE UNIT) RIBOSOMES TRANSLATION PROTEIN 2 tRNA TRANSCRIPTION Transcription is one of the first processes in protein synthesis. In transcription, a complementary strand of mRNA is synthesized according to the nitrogenous base code of DNA. Transcription can be summarized by the following steps: 1. The enzyme, RNA polymerase, binds to an area of one of the DNA molecules in the double helix. During transcription, only one DNA strand serves as a template (a guide or model) for RNA synthesis. The other strand remains dormant. 2. The enzyme moves along the DNA strand and “reads” the nucleotides one by one, similar to the process in DNA replication. The enzyme selects free-floating nucleotides in the nucleus and positions them in an mRNA molecule according to the base pair rules. Guanine will be paired with Cytosine and Uracil will be paired with Adenine. 3. mRNA will only begin to be made when RNA polymerase recognizes a “start” message and the mRNA lengthens until a “stop” message is received. 4. The nucleotides of the DNA strand are read in groups of three. Each group is called a CODON. Codon: CCG AGA ACG CGT or any other combination of the four bases, depending on their sequence in the DNA strand. 5. Each codon will later serve as a “code word” for an amino acid. First, however, the codons are transcribed to the mRNA molecule. 6. The resulting mRNA molecule consists of nothing more than a series of codons received from the genetic message in the DNA. 3 7. In prokaryotes (bacteria), mRNA strands are copied from the DNA as a single continuous sequence. In eukaryotes (animals and plants) the initial RNA strand in the nucleus is composed of EXONS, sequences of nucleotides that carry useful information fro protein synthesis, and INTRONS, sequences that do not. 8. Before leaving the nucleus, the initial RNA transcript is processed to remove introns and splice (join) exons together. This processed RNA, now properly called mRNA, is transported from the nucleus to the ribosome for translation. TRANSLATION The genetic code is transferred to an amino acid sequence in a protein through the translation process, which begins with the arrival of the mRNA molecule at the ribosome. While the mRNA was being synthesized, tRNA molecules were uniting with their specific amino acids according to the activity of specific enzymes. The tRNA molecules then began transporting their amino acids to the ribosomes to meet the mRNA molecule. The mRNA, the two ribosomal sub-units (large and small sub-units) and a tRNA carrying the amino acid methionine together form a functional ribosome. There are two regions within the ribosome, the P site and the A site. The mRNA “start” codon AUG, which signals the beginning of a protein chain, is oriented in the region of the ribosome called the P site where the tRNA molecule carrying methionine can bind to the start codon. The codon in the area of the ribosome called the A site is ready to receive the next tRNA. A tRNA with the complementary anticodon arrives and binds to the codon on the strand of mRNA. The tRNA is carrying its specific amino acid. 4 Now both the A site and the P site are holding tRNA molecules, each carrying a specific amino acid. Enzymes then help form a peptide bond between the adjacent amino amino acids. Afterward the tRNA in the P site detaches, leaves behind its amino acid, and moves away from the ribosome. The tRNA (with its protein chain) in the A site moves over to fill the empty P site. A new codon on the mRNA molecule is exposed, and the complementary three-base anticodon of a tRNA molecule positions itself opposite the codon. This brings another amino acid into position, and that amino acid links to the previous amino acids. The ribosome moves further down the mRNA molecule and exposes another codon, which attracts another tRNA molecule with its anticodon and an attached amino acid. This amino acid is then bonded to the growing protein chain. One by one, amino acids are added to the growing c chain until the ribosome has moved down to the end of the mRNA molecule. After the protein has been synthesized completely it is removed from the ribosome for further processing and to perform its function. The protein may be stored in the Golgi body before being released by the cell, or it may be stored in the lysosome as a digestive enzyme. The protein may be used in the cell as a structural component, or it may be released as a hormone, such as insulin. After synthesis, the mRNA will pass through another ribosome and repeat the process until the cell has made enough of the protein to meet the organisms need. The mRNA strand then breaks up and the nucleotides return to the nucleus. The tRNA molecules return to the cytoplasm to unite with fresh molecules of amino acids. 5 The entire process 6 Answer the following based on your reading (use a separate piece of paper): 1. 2. 3. 4. 5. 6. 7. 8. What specifies the type of protein produced? List the different types of RNA and describe their role in protein synthesis. Briefly describe the entire process of protein synthesis. Include all important molecules and locations. What is a codon? What is the Central Dogma of molecular genetics? What are the three differences between DNA and RNA? What are exons and introns? What is an anticodon? (hint: use the word complementary) Nucleic Acids and Protein Synthesis Do you understand how mRNA codes for amino acids? 1. Use the chart below to decode the following strand of mRNA into amino acids of a protein. AUGAAUUUUGAAGCUGAUAAACAAUAA 2. The triplets that code for the amino acids on the mRNA are codons. The complementary triplet(s) on the tRNA are known as anticodons. Fill in the proper triplets in the table below. Amino Acid Codon Proline Threonine Tryptophan Leucine Arginine Histidine Glycine Serine 7 Amino Acid Alanine Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Start/Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Stop codon mRNA codon GCU CGU AAU GAU UGU GAA CAA GGU CAU AUU UUA AAA AUG UUU CCC UCU ACU UGG UAU GUU UAA 3. Protein synthesis begins with DNA in the nucleus. Below is a DNA sequence that could code for part of a molecule of oxytocin. Write the sequence of mRNA codons that would result from the transcription of this portion of DNA. The arrow marks the starting point. ACAATATAGCTTTTGACGGGGAACCCCATT After transcription, mRNA attaches to a ribosome where translation takes place. Each codon of mRNA bonds with an anticodon of a tRNA molecule which is bonded with a specific amino acid. The table to the right shows the mRNA codons and the amino acid for which they code. 5. Use your mRNA sequence from #3 above to write the sequence of amino acids in this part of the Oxytocin molecule. 6. How many amino acids make up this portion of the oxytocin molecule? 7. What is the purpose of the UAA codon? 8. Below is a section of a DNA molecule. Transcribe the DNA (from the beginning of the molecule) and translate it into its amino acids. ATAGAAGATACGCTTTGATCGAAAAGCAAGAATATAA 8. How many amino acids are there? Protein Synthesis Question 1. Define Transcription and Translation and, in your own words, describe the process of protein 8 synthesis for someone who has not studied biology. 2. What type of monomer is linked together to assemble proteins? 3. How are proteins synthesized within a cell? 4. What are the base pair rules for DNA? 5. What are the base pair rules for RNA? 6. During translation, what is the mRNA codon paired with? 7. In one sentence describe the role of ribosomes in protein synthesis. 8. Where does transcription take place in the cell? 9. Where does translation take place in the cell? 10. Which enzyme opens up the DNA double helix (unzip and unwind) during transcription? Mutations Mutations are permanent changes in the sequence of the bases in DNA. Mutations occur when base pairs are incorrectly matched and can, but usually do not, improve the product coded by the gene. Mutations can occur in somatic (body) cells and are often not detected because they cannot be passed on to offspring. They may, however, give rise to cancer or other undesirable cellular changes. Mutations in the germline (sex cells) can produce functionally different proteins that cause such genetic diseases as Tay-Sachs, sickle cell anemia, and Duchenne muscular dystrophy. There are two types of mutation: 1. POINT MUTATION – a single base changes. 2. FRAMESHIFT MUTATION – one base is deleted or inserted. Point Mutation Example: THE DOG BIT THE CAT THE DOG BIT THE CAR By changing one letter the whole meaning of the Sentence has been changed. FRAMESHIFT MUTATION 9 This type of mutation occurs when a single base is added or deleted from DNA; it causes a shift in the reading of codons by one base. Example: By deleting one base: THE DOG BIT THE CAT THE DOG ITT HEC AT The change itself shifts the codon reading so all codons from the mutation on are changed. Deleting one letter changes the meaning drastically. In sickle cell anemia a point mutation changes the shape of the hemoglobin molecule from round to sickle. CAUSES OF MUTATIONS 10 Mutations can occur randomly for no reason and are known as spontaneous mutations. Many mutations can be caused by environmental factors such as radiation, chemicals and high temperatures. These factors are known as mutagens. Spontaneous mutations are one reason that undesirable traits cannot be eliminated from the general population. 11