* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Presentation
Public health genomics wikipedia , lookup
Genomic imprinting wikipedia , lookup
Copy-number variation wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene nomenclature wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Non-coding DNA wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Human genome wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Medical genetics wikipedia , lookup
Y chromosome wikipedia , lookup
Gene expression programming wikipedia , lookup
Point mutation wikipedia , lookup
SNP genotyping wikipedia , lookup
Pathogenomics wikipedia , lookup
Gene desert wikipedia , lookup
Designer baby wikipedia , lookup
Genome (book) wikipedia , lookup
Genome evolution wikipedia , lookup
Microevolution wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
X-inactivation wikipedia , lookup
Neocentromere wikipedia , lookup
Metagenomics wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microsatellite wikipedia , lookup
Welcome to Phage sequences in bacterial genomes Searching for PCR primers Thursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1 - a mobile pathogenicity island in Staphylococcus aureus. Ruzin A, Lindsay J, Novick RP (2001). Molec Microbiol 41:365-377. • James Kokorelis presents: Diversity and host range of Shiga toxin-encoding phage. Shantini et al (2004). Infect Immun 72:7131-7139. • Available tools to find primers in EDL933 • Strategy Welcome to Phage sequences in bacterial genomes Searching for PCR primers Thursday, 23 June 2005 • Meghan Feltcher presents: Molecular genetics of SaPI1… • James Kokorelis presents: Diversity and host range… • Available tools to find primers in EDL933 • Strategy to find primers • Do it Strategy to find primers L0121 from bacteriophage 933W L0121 deletion derivative Kanamycin-resistance cassette GCCCGTAAAAAAGTGTTTAACGGAGGTGGAGTGTGA GGAGATAAAGGGGACACGGGGCCAGCAGGTCCGGCTA Strategy to find primers BP 933W BP-specific primer CP 933R CP 933R CP 933V CP 933U CP 933O CP 933P CP 933K CP 933M CP-specific CP-specific primer region Common conserved primer region Overview of Solution Find primer candidates in tail fiber genes • Tail fiber gene, L0121 (E. coli O157:H7 EDL933 = EDL933) • Multiple copies of L0121 • Find copies in EDL933 • Align sequences of copies • Find long regions (20 nt) of identity – In copies, but not L0121(left primer) – In L0121, but not copies (right primer) Useful Tools • EDL933.chromosome (sequence of chromosome) (GET-ELEMENT 35259 TO 35998 FROM EDL933.chromosome) • EDL933-genes (all gene names and sequences) (BLASTN L0121 EDL933-genes) • EDL933 (table of information about each gene) (VALUE-OF EDL933("Z0034" DESCRIPTION))