Download Presentation

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Public health genomics wikipedia , lookup

Genomic imprinting wikipedia , lookup

Copy-number variation wikipedia , lookup

Gene expression profiling wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Gene nomenclature wikipedia , lookup

Saethre–Chotzen syndrome wikipedia , lookup

Non-coding DNA wikipedia , lookup

Karyotype wikipedia , lookup

Skewed X-inactivation wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Human genome wikipedia , lookup

RNA-Seq wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Genomic library wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Medical genetics wikipedia , lookup

Gene wikipedia , lookup

Y chromosome wikipedia , lookup

Gene expression programming wikipedia , lookup

Polyploid wikipedia , lookup

Point mutation wikipedia , lookup

SNP genotyping wikipedia , lookup

Pathogenomics wikipedia , lookup

Gene desert wikipedia , lookup

Genomics wikipedia , lookup

Designer baby wikipedia , lookup

Genome (book) wikipedia , lookup

Genome evolution wikipedia , lookup

Microevolution wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

X-inactivation wikipedia , lookup

Neocentromere wikipedia , lookup

Metagenomics wikipedia , lookup

Helitron (biology) wikipedia , lookup

Microsatellite wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcript
Welcome to
Phage sequences in bacterial genomes
Searching for PCR primers
Thursday, 23 June 2005
• Meghan Feltcher presents:
Molecular genetics of SaPI1 - a mobile pathogenicity island in
Staphylococcus aureus. Ruzin A, Lindsay J, Novick RP (2001).
Molec Microbiol 41:365-377.
• James Kokorelis presents:
Diversity and host range of Shiga toxin-encoding phage.
Shantini et al (2004). Infect Immun 72:7131-7139.
• Available tools to find primers in EDL933
• Strategy
Welcome to
Phage sequences in bacterial genomes
Searching for PCR primers
Thursday, 23 June 2005
• Meghan Feltcher presents: Molecular genetics of SaPI1…
• James Kokorelis presents: Diversity and host range…
• Available tools to find primers in EDL933
• Strategy to find primers
• Do it
Strategy to find primers
L0121 from bacteriophage 933W
L0121 deletion derivative
Kanamycin-resistance cassette
GCCCGTAAAAAAGTGTTTAACGGAGGTGGAGTGTGA
GGAGATAAAGGGGACACGGGGCCAGCAGGTCCGGCTA
Strategy to find primers
BP 933W
BP-specific
primer
CP 933R
CP 933R
CP 933V
CP 933U
CP 933O
CP 933P
CP 933K
CP 933M
CP-specific
CP-specific
primer
region
Common
conserved
primer
region
Overview of Solution
Find primer candidates in tail fiber genes
• Tail fiber gene, L0121
(E. coli O157:H7 EDL933 = EDL933)
• Multiple copies of L0121
• Find copies in EDL933
• Align sequences of copies
• Find long regions (20 nt) of identity
– In copies, but not L0121(left primer)
– In L0121, but not copies (right primer)
Useful Tools
• EDL933.chromosome (sequence of chromosome)
(GET-ELEMENT 35259 TO 35998 FROM EDL933.chromosome)
• EDL933-genes (all gene names and sequences)
(BLASTN L0121 EDL933-genes)
• EDL933 (table of information about each gene)
(VALUE-OF EDL933("Z0034" DESCRIPTION))