* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Presentation
Public health genomics wikipedia , lookup
Genomic imprinting wikipedia , lookup
Copy-number variation wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene nomenclature wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Non-coding DNA wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Human genome wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Medical genetics wikipedia , lookup
Y chromosome wikipedia , lookup
Gene expression programming wikipedia , lookup
Point mutation wikipedia , lookup
SNP genotyping wikipedia , lookup
Pathogenomics wikipedia , lookup
Gene desert wikipedia , lookup
Designer baby wikipedia , lookup
Genome (book) wikipedia , lookup
Genome evolution wikipedia , lookup
Microevolution wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
X-inactivation wikipedia , lookup
Neocentromere wikipedia , lookup
Metagenomics wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microsatellite wikipedia , lookup
Welcome to
Phage sequences in bacterial genomes
Searching for PCR primers
Thursday, 23 June 2005
• Meghan Feltcher presents:
Molecular genetics of SaPI1 - a mobile pathogenicity island in
Staphylococcus aureus. Ruzin A, Lindsay J, Novick RP (2001).
Molec Microbiol 41:365-377.
• James Kokorelis presents:
Diversity and host range of Shiga toxin-encoding phage.
Shantini et al (2004). Infect Immun 72:7131-7139.
• Available tools to find primers in EDL933
• Strategy
Welcome to
Phage sequences in bacterial genomes
Searching for PCR primers
Thursday, 23 June 2005
• Meghan Feltcher presents: Molecular genetics of SaPI1…
• James Kokorelis presents: Diversity and host range…
• Available tools to find primers in EDL933
• Strategy to find primers
• Do it
Strategy to find primers
L0121 from bacteriophage 933W
L0121 deletion derivative
Kanamycin-resistance cassette
GCCCGTAAAAAAGTGTTTAACGGAGGTGGAGTGTGA
GGAGATAAAGGGGACACGGGGCCAGCAGGTCCGGCTA
Strategy to find primers
BP 933W
BP-specific
primer
CP 933R
CP 933R
CP 933V
CP 933U
CP 933O
CP 933P
CP 933K
CP 933M
CP-specific
CP-specific
primer
region
Common
conserved
primer
region
Overview of Solution
Find primer candidates in tail fiber genes
• Tail fiber gene, L0121
(E. coli O157:H7 EDL933 = EDL933)
• Multiple copies of L0121
• Find copies in EDL933
• Align sequences of copies
• Find long regions (20 nt) of identity
– In copies, but not L0121(left primer)
– In L0121, but not copies (right primer)
Useful Tools
• EDL933.chromosome (sequence of chromosome)
(GET-ELEMENT 35259 TO 35998 FROM EDL933.chromosome)
• EDL933-genes (all gene names and sequences)
(BLASTN L0121 EDL933-genes)
• EDL933 (table of information about each gene)
(VALUE-OF EDL933("Z0034" DESCRIPTION))