* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download video slide
Maurice Wilkins wikipedia , lookup
Gene expression profiling wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Gene regulatory network wikipedia , lookup
Gene expression wikipedia , lookup
Transcriptional regulation wikipedia , lookup
List of types of proteins wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genome evolution wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA supercoil wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular evolution wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Chapter 20 DNA Technology and Genomics Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Understanding and Manipulating Genomes • DNA technology has launched a revolution in the area of Biotechnology which is the manipulation of organisms or their components to make useful products such as insulin, blood clotting factors, and lots of other proteins. • This manipulation can be accomplished by DNA Technology and this would be central to the field of Genetic engineering. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • DNA technology is now applied in areas ranging from agriculture to criminal low with the most important achievements in basic research. • For instance the level of expression of thousands of different genes can now be measured at the same time using what is known as DNA microarray (Figure 20.1). • One of the great achievements of modern science has been completing the sequence of the entire human genome by the year 2003. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA microarray revealing expression of 2400 genes Figure 20.1 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Concept 20.1: DNA cloning permits production of multiple copies of a specific gene or other DNA segment • To work directly with specific genes – Scientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloning. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA Cloning and Its Applications: A Preview • Most methods for cloning pieces of DNA in the laboratory – Share certain general features, such as the use of bacteria (e.g Escherichia coli) and their plasmids. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Overview of Gene Cloning • Isolation of plasmid DNA from bacteria and DNA carrying a gene of interest from another • A piece of DNA containing the gene is inserted into a plasmid (cloning vector) producing a recombinant DNA plasmid • The recombinant plasmid is returned to a bacterial cell • The cell is then grown in culture forming a clone of cells. With the foreign DNA replicating with the rest of the bacterial chromosome. • Identification of the bacterial clone that carries the gene of interest • Once the clone is identified, then a large scale production of the product of the gene is initiated in a bioreactor. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Overview of gene cloning with a bacterial plasmid, showing various uses of cloned genes Bacterium 1 Gene inserted into plasmid Plasmid Bacterial chromosome Recombinant DNA (plasmid) 2 Gene of interest Plasmid put into bacterial cell Recombinate bacterium 3 Gene of interest Copies of gene Basic research on gene Figure 20.2 Gene for pest resistance inserted into plants 4 Basic research and various applications Gene used to alter bacteria for cleaning up toxic waste Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cell containing gene of interest 3 DNA of chromosome Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest Protein expressed by gene of interest Protein harvested Protein dissolves blood clots in heart attack therapy Basic research on protein Human growth hormone treats stunted growth Using Restriction Enzymes to Make Recombinant DNA • Bacterial restriction enzymes – Revolutionize the recombinant DNA Technology – Cut DNA molecules at a limited number of specific DNA sequences, called restriction sites – Naturally these enzymes protect bacteria from intruding DNA, but how can they spare the bacterial own DNA? – It adds a methyl group to adenine or cytosine within the sequences recognized by these enzymes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings How can these enzymes be used for creating a recombinant DNA? • A restriction enzyme will usually make many cuts in a DNA molecule – Yielding a set of restriction fragments • The most useful restriction enzymes cut DNA in a staggered way – Producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragments • DNA ligase is an enzyme – That seals the bonds between restriction fragments Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Restriction enzymes… Cont. • Most restriction sites are symmetrical; the same 5’→ 3’ sequence of four to eight nucleotides is found on both strands. • Restriction enzymes cut covalent phosphodiester bonds of both strands and always in a very reproducible way producing restriction fragments with at least one single stranded end called sticky end. • Sticky ends will form H-bonded bp with complementary single stranded DNA from another DNA of anther organism that was cut using the same enzyme. • An enzyme called the DNA ligase will seal these fragments together by forming phosphdiester bonds. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Using a restriction enzyme and DNA ligase to make recombinant DNA Restriction site DNA 1 5 3 3 5 GAATTC CTTAAG Restriction enzyme cuts the sugar-phosphate backbones at each arrow G G Sticky end 2 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. GA A T TC CT TA A G 3 Figure 20.3 G Fragment from different DNA molecule cut by the same restriction enzyme G AATTC CTTAA G One possible combination DNA ligase seals the strands. Recombinant DNA molecule Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings G Cloning a Eukraryotic Gene in a Bacterial Plasmid • In gene cloning, the original plasmid is called a cloning vector – Defined as a DNA molecule that can carry foreign DNA into a cell and replicate there. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Procedure for cloning a eukaryotic gene in a bacterial plasmid • Isolation of vector and gene-source DNA; we begin by preparing two kinds of DNA; – – Bacterial plasmid to be used as a vector, form E. coli that carry two useful genes; • ampR (conferes resistance to ampicillin) • and lac Z that encodes the enzyme βgalactosidase that hydrolysis the sugar lactose. • In addition this plasmid has a single recognition sequence that falls within the lac Z gene. DNA containing the gene of interest let us say from humans. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Insertion of DNA into the vector – Both DNA and the vector should be digested by the same restriction enzyme. • In this case the enzyme cuts the plasmid at its single cutting site thus disrupting the lacZ gene. • The enzyme also cuts the human DNA generating many thousands of fragments that have sticky ends. • One of these fragments carries the gene of interest – Fragments of human DNA are mixed with clipped plasmid vectors. The sticky ends of both types pair with each other – Use the DNA ligase to join the DNA molecules by covalent bonds Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Introduction of cloning vector into cells • In this step bacterial cells take up the recombinant plasmids by transformation. Now the bacteria that are lacZ- (negative) will be a mutation that are not able to hydrolyse lactose are most probably recombinant and have a foreign DNA. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Most critical step in cloning; identifying clones that accepted foreign DNA • We plate out the transformed bacteria on sold nutrient agar medium containing ampicillin and a sugar called X-gal – Each reproducing bacteria forms a clone that a pears as a colony on the medium. – In this process most of the human genes will be cloned – The antibiotic makes us sure that only those bacteria have the ampR gene will grow while the X-gal makes us identify only the bacteria that contain the foreign DNA, how? • X-gal is hydrolysed by β-galactosidase to produce colonies with blue color • Colonies with blue color means that the lac Z gene was NOT disrupted, therefore, they did not include the foreign DNA, while the colonies appear whitish in color, means the lac Z is not working, i.e it was disrupted by the insert, therefore, this colony contains the human DNA insert. (Figure 20. 4) Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Producing Clones of Cells APPLICATION Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. TECHNIQUE In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. Bacterial cell 1 Isolate plasmid DNA and human DNA. lacZ gene (lactose breakdown) Human cell Restriction site 2 Cut both DNA samples with the same restriction enzyme ampR gene (ampicillin resistance) Bacterial plasmid Gene of interest Sticky ends 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and many nonrecombinant plasmids. Figure 20.4 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Human DNA fragments Recombinant DNA plasmids 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. Recombinant bacteria 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until colonies grow. Colony carrying nonrecombinant plasmid with intact lacZ gene Colony carrying recombinant plasmid with disrupted lacZ gene Bacterial clone RESULTS Only a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings How can we identify the bacteria that contain the gene of interest • We can look either for the gene itself or we can look for the protein product of the gene • All methods of detecting the gene are based on the base pairing between the gene and other a complementary sequence on another nucleic acid molecule in a process called DNA • Hybridization using a nucleic acid probe (Figure 20.5). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Identifying Clones Carrying a Gene of Interest • The probe is traced by labeling it with a radio label or a fluorescence tag following the procedure; – Bacterial colonies on agar are pressed against special filter thus transferring the colonies to the filter – Filter is treated to break open the cells and denature their DNA, with the resulting single stranded DNA molecules stick to the filter – A solution of probe molecules is incubated with the filter. The probe DNA hybridizes with any complementary DNA in the filter – The filter is laid on a photographic film allowing any radioactive areas to expose the film – The developed film an autoradiograph, is compared with the mastered culture plate to determine which colonies carry the gene of interest. – Once the clone carrying the gene of interest is identified, cells can be grown in liquid medium in a large tank to produce large amounts of the gene or its products such as a protein. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Nucleic acid probe hybridization APPLICATION TECHNIQUE Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Colonies containing gene of interest Master plate Master plate Probe DNA Solution containing probe Radioactive single-stranded DNA Gene of interest Single-stranded DNA from cell Filter Film Filter lifted and flipped over Hybridization on filter 1 A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. RESULTS Figure 20.5 2 The filter is treated to break open the cells and denature their DNA; the resulting singlestranded DNA molecules are treated so that they stick to the filter. 3 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 4 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria – Is the collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genome Foreign genome cut up with restriction enzyme or Recombinant plasmids Bacterial clones Figure 20.6 (a) Plasmid library Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Recombinant phage DNA (b) Phage library Phage clones • The gene cloning procedure outlined in Figure 20-4 is called the shotgun approach as no single gene is targeted, instead thousands of different recombinant plasmids are actually produced and a clone of each ends up in a white colony. • The complete set of these clones is called genomic library, Figure 20-6a. Such library can be used later for exploring some other genes or for genome mapping. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings A genomic library made using bacteriophages – In addition to plasmids, certain bacteriophages are used as cloning vectors for using even larger genomic libraries. A genomic library made using phage is stored as collections of phage clones (Figure 20-6b). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings A complementary DNA (cDNA) library – Another type of genomic libraries is called cDNA library. – In this, researchers isolate mRNA from the cell that was transcribed from a number of genes. – Thus the cDNA library is made of a set of genes that were transcribed in the starting cells and the new DNA strand that is produced is called complementary DNA or cDNA. – This cDNA represents only part of the genome – This is advantageous for; • Studying the genes responsible for specialized functions of a particular type of cells such as brain or liver cells. • In addition by making cDNA library from cells of same type at different stages of life of an organism, researchers can trace changes in patterns of gene expression. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Cloning and Expressing Eukaryotic Genes • As an alternative to screening a DNA library for a particular nucleotide sequence – The clones can sometimes be screened for a desired gene based on detection of its encoded protein, How? • Activity of the protein can be measured if for example it is an enzyme • Detection of the protein by antibodies. – Once the protein is identified, it can be produced in large amounts. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Bacterial Expression Systems • Several technical difficulties – Hinder the expression of cloned eukaryotic genes in bacterial host cells • To overcome such problems – Scientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoter that leads to the expression of the eukaryotic protein. – The other problem is the presence of introns in the eukaryotic gene and the un-ability of the prokaryotes to process RNA so a cDNA of the gene which contains only the exons should be used in which the bacterial vector will be able to express. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Eukaryotic Cloning and Expression Systems • The use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectors – Helps avoid gene expression problems and the incompatibility of prokaryotic/eukaryotic system – Scientists has developed the YAC which combines the essentials of a eukaryotic chromosome, origin of replication, a centromere and two telomeres with foreign DNA. – YAC can carry a longer DNA segment than the bacterial plasmid thus the chance to clone the entire gene is much more than that in plasmids – Posttranslational modification is another advantage of using mammalian vector over the plasmid Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings How to introduce DNA into cells? • There are different methods for this purpose – Electroporation; application of a brief electrical pulse applied to a solution contains cells will open membrane holes so that DNA can inter. – DNA can be injected directly into a single eukaryotic cell with the aid of microscope – In plants, the soil microbe, Agrobacterium can be used to infect the plant and introduce DNA Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Amplifying DNA in Vitro: The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR – Can produce many copies of a specific target segment of DNA and proves to be very useful when DNA is present in very few copies. • Items needed for this procedure; – The DNA to be amplified – Two short nucleotide primers that determines the DNA sequence that is amplified – Nucleotides ( dATP, dCTP, dGTP and dTTP) – Heat resistant DNA polymerase – PCR cycler Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Characteristics and uses of PCR • PCR is so specific to the point that starting material need not be purified • It is fast to the point that in about 3-4 hours you can do 40 cycles and of course amplifying your DNA millions of times • It can be used to amplify specific gene prior to cloning • Only minute amounts of DNA are needed to do the amplification It can be used for; – ancient DNA form 40,000 years old frozen woolly mammoth; – DNA from tiny amounts of blood, tissue or semen found at a crime scene. – DNA from single embryonic cells fro rapid prenatal diagnosis of genetic disorders and lots of other applications. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings The PCR procedure 5 3 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. 3 Genomic DNA 5 3 5 1 Denaturation: Heat briefly to separate DNA strands 5 3 TECHNIQUE The starting materials for PCR are doublestranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. During each PCR cycle, the target DNA RESULTS sequence is doubled. By the end of the third cycle, onefourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. Figure 20.7 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 2 Annealing: Cycle 1 yields 2 molecules Cool to allow primers to hydrogen-bond. Primers 3 Extension: DNA polymerase adds nucleotides to the 3 end of each primer Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence New nucleotides Concept 20.2: Restriction fragment analysis • detects DNA differences that affect restriction sites • Can rapidly provide useful comparative information about DNA sequences Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Gel Electrophoresis and Southern Blotting • Gel electrophoresis separates DNA restriction fragments of different lengths APPLICATION Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). 1 2 Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. charged DNA molecules move toward the positive electrode, with shorter Power source Gel Glass plates When the current is turned on, the negatively molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. TECHNIQUE Cathode Mixture of DNA molecules of different sizes Anode Longer molecules Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by Shorter molecules restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. RESULTS After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Figure 20.8 Restriction fragment analysis • Is useful for comparing two different DNA molecules, such Normal -globin allele as two alleles for a gene 201 bp 175 bp DdeI DdeI Large fragment DdeI DdeI Sickle-cell mutant -globin allele Large fragment 376 bp DdeI (a) DdeI DdeI DdeI restriction sites in normal and sickle-cell alleles of -globin gene. Normal Sickle-cell allele allele Large fragment 376 bp 201 bp 175 bp (b) Figure 20.9a, b Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Electrophoresis of restriction fragments from normal and sickle-cell alleles. Southern blotting an overview • Identifies Specific DNA fragments in the genome. • the gel will be overlaid with a nylon or nitrocellulose membrane and several layers of filter papers. • The setting will be submerged with an alkaline solution that will pull the bands out of the gel and transfer them to the membrane meanwhile denaturing the DNA by the action of the alkaline solution • After certain time, the filter papers pulled out and the bands are exposed to a solution containing radioactive probe which is single stranded DNA that is complementary to the gene of interest Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Rinse a way unattached probe and expose membrane to an X-ray film. In this case the radioactive probe that hybridized with the gene of interest will expose the film to form an image corresponding to DNA bands that hybridized to the probe. • From looking at the band pattern, it appears that band patters of sample I and II and III are different from each other as shown in Figure 20.10. • This process is called southern blotting after E. M Southern who developed the method in 1975. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Southern blotting of DNA fragments APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). DNA + restriction enzyme Restriction fragments I II III Nitrocellulose paper (blot) Heavy weight Gel Sponge I Normal -globin allele Alkaline solution II Sickle-cell III Heterozygote allele Preparation of restriction fragments. 1 2 Gel electrophoresis. Figure 20.10 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 3 Blotting. Paper towels Radioactively labeled probe for -globin gene is added to solution in a plastic bag I II III Paper blot 1 Hybridization with radioactive probe. RESULTS Probe hydrogenbonds to fragments containing normal or mutant -globin Fragment from sickle-cell -globin allele Fragment from normal -globin allele I II III Film over paper blot 2 Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Restriction Fragment Length Differences as Genetic Markers • Restriction fragment length polymorphisms (RFLPs) – Are differences in DNA sequences in non-coding sequences on homologous chromosomes that result in restriction fragments of different lengths – They are scattered abundantly through out genome and serve as a genetic markers for particular locations (locus) in the genome. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings RFLPs • Can be detected and analyzed by Southern blotting (Figure 20.10). • The thousands of RFLPs present throughout eukaryotic DNA – Can serve as genetic markers i.e a measure of closeness of two loci in a chromosome. – Because they are inherited in a mendelian fashion, they can serve as genetic markers for making linkage maps Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings GENOME MAPPING • Concept 20.3: Entire genomes can be mapped at the DNA level • The Human Genome Project – Sequenced the human genome from 1990-2003 • Scientists have also sequenced genomes of other organisms – Providing important insights of general biological significance Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Genetic (Linkage) Mapping: Relative Ordering of Markers • The initial stage in mapping a large genome – Is to construct a linkage map of several thousand genetic markers spaced throughout each of the chromosomes – The order of the markers and the relative distances between them on such a map are based on recombination frequencies – These markers can be genes or RFLPs or short repetitive sequences (microsatellites). Based on these, researchers finished the human genetic map with 5000 markers. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Three stage approach to mapping the entire genome Cytogenetic map Chromosome banding pattern and location of specific genes by fluorescence in situ hybridization (FISH) 1 2 3 Figure 20.11 Chromosome bands Genes located by FISH Genetic (linkage) mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome) Genetic markers Physical mapping Ordering of large overlapping fragments cloned in YAC and BAC vectors, followed by ordering of smaller fragments cloned in phage and plasmid vectors DNA sequencing Determination of nucleotide sequence of each small fragment and assembly of the partial sequences into the complete genome sequence Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Overlapping fragments GACTTCATCGGTATCGAACT… … Physical Mapping: Ordering DNA Fragments • A physical map gives the actual distance in base pairs between markers – Is constructed by cutting a DNA molecule into many short fragments and then determine the original order of the fragments in the DNA – The key is to make fragments that overlap and then use probes to identify the overlaps – Researchers carry out several rounds of DNA cutting, cloning and physical mapping – Supplies of DNA fragments used for physical mapping are prepared by cloning. – First cloning vector is often YAC or BAC for long DNA pieces and then smaller plasmids are used for ordering shorter DNA pieces. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA Sequencing • Relatively short DNA fragments can be sequenced by the dideoxy chain-termination method as following; – Incubate DNA template strand (single) with DNA polymerase, 4 dioxynucleotides and the 4 flouresent labelled didioxyribonucleotides – Synthesis of the new strands starts at the 3’ end and continues until a ddN is incorporated instead of the regular dioxyribonucleotide which prevents further elongation. – Eventually a set of labeled strands of various length is produced with the color of the tag representing the last nucleotide in sequence. – Labeled strands are separated by capillary electrophoresis with shorter strands moving faster. – The color of the tag will be detected by a fluorescence detector. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Dideoxy chain-termination method for sequencing DNA DNA Primer (template strand) T 3 APPLICATION The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. TECHNIQUE This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide. In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. RESULTS The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Figure 20.12 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings G T T 5 C T G A C T T C G A C A A 3 5 3 C T G A C T T C G A C A A Dideoxyribonucleotides Deoxyribonucleotides (fluorescently tagged) 5 DNA polymerase dATP ddATP dCTP ddCTP dTTP ddTTP dGTP ddGTP P P P P P P G OH DNA (template strand) ddG C T G T T ddC T G T T ddA G C T G T T ddA A G C T G T T ddG A A G C T G T T ddT G A A G C T G T T Detector G A C T G A A G C H Labeled strands Direction of movement of strands Laser G 3 ddC T G A A G C T G T T ddA C T G A A G C T G T T ddG A C T G A A G C T G T T • Linkage mapping, physical mapping, and DNA sequencing – Represent the overarching (umbrella) strategy of the Human Genome Project • An alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragments (approach of Craig Venter from Celera Genomics) – Powerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence (Figure 20-13). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings 1 Cut the DNA from many copies of an entire chromosome into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or phage vectors 3 Sequence each fragment ACGATACTGGT CGCCATCAGT 4 Order the sequences into one overall sequence with computer software. Figure 20.13 ACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Concept 20.4: Genome sequences provide clues to important biological questions such as; – Genome organization, – control of gene expression, – growth and development; – and evolution. In genomics – Scientists study whole sets of genes and their interactions Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Identifying Protein-Coding Genes in DNA Sequences • How can we determine a gene and recognize its function? • Computer analysis of genome sequences – Helps researchers identify sequences that are likely to encode proteins. – Certain softwares looks for shorts sequences that are similar to known genes – Thousands of such sequences are called Expressed Sequence Tags are catalogued in computer data base. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Current estimates are that the human genome contains about 25,000 genes which is only 1 and ½ the number of genes in the fruit fly. • So What makes humans are more complex than flies or worms? – Gene expression is regulated in more subtle and complicated way than in the flies or worms. The long none coding sequences play a role in this regulation. – Other explanation is that typically one human gene specifies at least 2 or 3 different polypeptides by using different combinations of exons. – In addition it appears that our polypeptides tend to be more complex than those of invertebrates due to posttranslational modification. – Possible interaction between gene products. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Table 20.1 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Comparison of the sequences of “new” genes with those of known genes in other species may help identify new genes Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Determining Gene Function For a gene of unknown function • Experimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its function. – In vitro mutagenesis is one application of this approach. • a mutation is introduced into a cloned gene • The gene is returned to a cell • If the mutation alter or destroy the gene, then the phenotype of the cell may help reveal the function of the missing protein. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Silencing gene expression – A simple method to silence gene expression is by exploiting the phenomenon of RNA interference (RNAi). However, this approach has only limited success in humans while prove to be very efficient in silencing nematode and fruit flies genes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Studying Expression of Interacting Groups of Genes • DNA microarray assays allow researchers to compare patterns of gene expression – • In different tissues, at different times, or under different conditions A basic principal to study the gene expression is done as following; – Isolate mRNA made in particular cells – Use these mRNA as a template for making cDNA library using reverse transcription – Compare this cDNA with other collections of DNA by hybridization Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA microarray method of studying gene expressions (current method) • Tiny amounts of a large number of single stranded DNA fragments representing different genes are fixed to a glass slide in a tightly spaced array (DNA chip). • Ideally these fragments represents all the genes of an organism • The fragments are then tested for hybridization with various samples of cDNA molecules which has been labeled with fluorescent dyes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings DNA microarray assay of gene expression levels With this method, researchers can test thousands of genes APPLICATION simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression. Tissue sample TECHNIQUE mRNA molecules 1 Isolate 2 3 4 mRNA. Make cDNA by reverse transcription, using fluores-cently labeled nucleotides. Apply the cDNA mixture to a microarray, a microscope slide on which copies of single-stranded DNA fragments from the organism‘s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample. The intensity of fluorescence at each spot is a measure RESULT of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions. Figure 20.14 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Labeled cDNA molecules (single strands) DNA microarray Size of an actual DNA microarray with all the genes of yeast (6,400 spots) Comparing Genomes of Different Species – Are providing valuable information in many fields of biology particularly evolution relations – The more closely related the genomes of two species the more closely related in their evolution. – Comparison of genomes of bacteria, archaea and eukarya strongly support that these are the three domains of life. – Similarities between genomes of disparate species led some researchers to consider the fruit fly as “little people with wings”. – There is 80% similarity between human and mouse genes can be used in studying human genetic diseases. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Future Directions in Genomics • The success in genomics have encouraged scientist to proceed to the area of proteomics which the study of full protein sets encoded by genomes. However, proteomics are challenging as the numbers of proteins far exceed number of genes and there are extremely varied in their structure, chemical and physical properties. • Application of bioinformatics which is the application of computer science and mathematics to genetic and other biological information will play a crucial role in dealing with the enormous data obtained. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Single nucleotide polymorphisms (SNPs) – Is a single base pair variation in a genome. In the human genome SNPs occurs at about 1 in 1000 pairs that is if you could compare your personal DNA sequence with that of a person setting beside you and with that of some one in Antarctica you would find them to be 99.9% identical. – Provide useful markers for studying human genetic variation, differences between human populations and the migratory routs of human population throughout histroy. – SNPs and other polymorphisms will be helpful in identifying disease genes that affect human health in more subtle way. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings PARACTICAL APPLICATIONS OF DNA TECHNOLOGY • Concept 20.5: The practical applications of DNA technology affect our lives in many ways • Numerous fields are benefiting from DNA technology and genetic engineering Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Medical Applications • One obvious benefit of DNA technology – Is the identification of human genes whose mutation plays a role in genetic diseases – In addition, DNA technology also plays an important role in studying none genetic diseases such as AIDS and Arthritis. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Diagnosis of Diseases • Medical scientists can now diagnose hundreds of human genetic disorders – PCR, RT-PCR and DNA hybridization has opened a door for the diagnosis of infectious agents such as HIV, and other elusive organisms. – Hundreds of human genetic disorders were diagnosed using DNA technology – It is possible to diagnose such diseases before onset or even before birth. – It is also possible to diagnose symptomless carriers of potentially harmful recessive alleles. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Diagnosis of Diseases… cont. – It is possible to find an abnormal allele of a gene that has not been cloned if a closely linked RFLP marker has been found particularly if they are located close to each other so that no crossing over happens while the gamete formation. i.e they will be inherited together. Figure 20-15. – Genes have been cloned for many human diseases including hemophilia, cystic fibrosis, Duchenne muscular dystrophy, huntingtons, sickle cell disease. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings This diagram depicts homologous segments of DNA from a family in which some members have a genetic disease. In this family different versions of RFLP marker are found in unaffected family members and in those who exhibit the disease. If a family member has inherited the version of the RFLP marker with two restriction sites near the gene ( rather than one) there a high probability that the individual has also inherited the disease causing allele. RFLP marker DNA Restriction sites Disease-causing allele Normal allele Figure 20.15 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Human Gene Therapy – Is the alteration of an afflicted individual’s genes – Holds great potential for treating disorders traceable to a single defective gene – Uses various vectors (reteroviral) for delivery of the normal allele into somatic cells – For gene therapy of somatic cells to be permanent, the cells that receive the normal allele must be one that multiply for life such as the bone marrow cells. – Unfortunately, so far the inserted genes were found to be effective only for short time. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Gene therapy using a retroviral vector Cloned gene (normal allele, absent from patient’s cells) 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 2 Let retrovirus infect bone marrow cells Retrovirus capsid that have been removed from the patient and cultured. 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient Figure 20.16 4 Inject engineered cells into patient. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Several trials were conducted to treat 10 children with SCID with some success. Nine of them showed some success however, two of them developed leukemia as the reterovirus inserted the genes near a gene that is involved in the proliferation and development of blood cells that led to leukemia. • There are some other questions need to be asked too about gene therapy such as what guarantees that the gene will be placed in the right place and produce the exact protein and does not disrupt other genes. • Further, there is some ethical issues regarding tampering with human genome in a way that leads to the practice of eugenics, a deliberate effort to control human gene make up. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Pharmaceutical Products – Large-scale production of human hormones and other proteins with therapeutic uses such as insulin, Tissue plasminogen factor, human growth hormone. – Production of safer vaccines (Recombinant proteins) than the traditional vaccines which are either heat killed pathogens or viable but attenuated pathogens – Production of genetically engineered proteins that either block or mimic receptors on cell membranes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Forensic Evidence • DNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenes – Can provide definitive evidence that a suspect is guilty or not with high degree of certainty as the DNA of every person is unique except for identical twins. – Traditional methods, such as ELISA and blood typing needs fresh blood and cannot give a definitive answer that a person did it, but can exclude some body. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • RFLP of samples obtained at the crime scene will be analyzed by southern blotting that allows researchers to detect similarities and differences in DNA and requires only tinny amounts (1000 blood cells). • Radioactive probes marks the electrophoresis bands that contain certain RFLP markers. 5 markers usually are enough, in other words, only a small portion of DNA should be enough. • Figure 20-17 shows a real example of samples collected from crime scenes. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings A DNA fingerprint from crime scene samples Defendant’s blood (D) Blood from defendant’s clothes 4 g D Jeans Figure 20.17 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Victim’s blood (V) 8 g shirt V DNA fingerprinting for establishing paternity – Another use for the DNA finger printing is comparing DNA from a child, a mother and purported father which can for sure settle a question of paternity. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Satellite DNA or short repetitive sequences • is another new technique that is increasingly used as a DNA fingerprint. The most useful satellite sequences for forensic purposes are the microsatellites ranging from 10-100 bp long, have repeating units of only few bp and highly variable from person to person. • Example; one person might have the unit ACA repeated 65 times at one locus of a gene and 118 times at another locus, and so on. Now it is highly unlikely that another person will have the exact same arrangement. Such polymorphic genetic loci are called simple tandem repeats (STRs). Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • PCR is usually used to amplify certain STRs or other markers before electrophoresis particularly when the amount of DNA recovered is very minute. • What is the probability that two people have identical DNA fingerprints? It is 1in 100,000 to 1in a billion. That depends on the number of markers compared and on the frequency of these markers in the population. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Environmental Cleanup • Genetic engineering can be used to modify the metabolism of microorganisms so that they can be used to extract minerals (cu, S, Ni, lead) from the environment or degrade various types of potentially toxic waste materials such as chlorinated hydrocarbons that are used as pesticides while other bacteria able to degrade oil spills at the sea. • Likewise, sewage treatment plants rely heavily on microbes to degrade many organic compounds into non-toxic form before these compounds are released to the environment. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Agricultural Applications • DNA technology – Is being used to improve agricultural productivity and food quality Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Animal Husbandry and “Pharm” Animals Transgenic animals contain genes from other organisms. Goals of creating transgenic animals (examples) – Producing sheep with better quality wool – Producing pigs with leaner meat – Producing cows that mature faster than the normal ones – Engineering a transgenic animal that produces a pharmaceutical drug that gets secreted in the milk such as a hormone or an anti-clotting factor… etc. and are used to produce vaccines, hormones and pharmaceutical proteins. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings How to make transgenic animals? – Remove egg cells from a female and fertilize them in vitro – At the same time clone the desired gene from another organism – Inject the cloned DNA directly into the nuclei of the eggs so that some of the cells integrate the inserted DNA into their genomes – The engineered eggs are then surgically implanted into surrogate mothers – If the pregnancy happened, the result might be a transgenic animal Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Pharm Animals • These animals contain genes for a human blood protein which they secrete in their milk Figure 20.18 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Genetic Engineering in Plants • Agricultural scientists – Have already endowed a number of crop plants with genes for desirable traits such as delayed ripening and resistance to spoilage and disease. In addition, engineered plants are now produces human proteins for therapeutic purposes or antibodies for diagnosis. – Plants are easily engineered than animals because a single plant cell can give rise to a whole plant, thus genetic manipulation can be done on only one single cell and let grow to a full grown tree. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Ti plasmid from soil bacteria Agrobacterium tumefaciens. – Is the most commonly used vector for introducing new genes into plant cells Genes conferring useful traits, such as pest APPLICATION resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. Example ! TECHNIQUE 1 2 3 RESULTS Agrobacterium tumefaciens The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. Site where restriction enzyme cuts Ti plasmid T DNA DNA with the gene of interest Recombinant Ti plasmid Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings Plant with new trait Figure 20.19 Safety and Ethical Questions Raised by DNA Technology • The potential benefits of genetic engineering must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment. • There should be certain safety measures to control such potential hazard; – Protecting researchers from infection by engineered microbes and to prevent microbes from accidentally leaving the laboratory. – Strains to be used for Recombinant DNA technology should be genetically crippled to insure that they can not survive outside the lab. – Certain obvious dangerous experiments have to be banned. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • Today, most public concern about possible hazards – Centers on genetically modified organisms (GMOs) used as food however, GM food must be included in the food label thus enabling the consumer to decide whether to buy them or not. – In year 2000, 130 countries signed an agreement to label the bulk food shipments if they have GMOs or not. – Why the big fuzz about GM Foods and GMOs? Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings • One argument is what if a wild plant acquired a herbicidal resistance gene form a house plant and spread this resistance to wide areas producing super weeds?! AS of yet nothing like this happen. • For humans some think that some genetically modified proteins might be allergic. • Completing the sequence of the entire human genome poses some ethical issue to who should be allowed to know somebody’s genetic make up or should these information be used as a criteria for job selection….. etc. Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings End of Chapter 20 Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings