Download Introduction to Medical Genetics

Patterns of Single-Gene
Inheritance Cont.
Genetic Basis of Disease


Traditional Mechanisms
 Chromosomal disorders
 Single-gene disorders
 Polygenic/multifactorial disorders
Novel mechanisms
 Imprinting
• Uniparental disomy (UPD)
• Parent of origin effects
 Mosaicism
 Maternal (Cytoplasmic) inheritance
 Unstable DNA (trinucleotide repeat disorders)
Atypical Patterns of Inheritance
Exceptions to mendelian inheritance do occur in
single-gene disorders and must be considered in
genetic medicine
 On basis of mendelian principles, a mutant allele of
an autosomal gene is equally likely to be transmitted
from a parent, of either sex, to an offspring of either
sex
 Similarly, a female is equally likely to transmit a
mutated X-linked gene to a child of either sex
 Does the sex of the parent have any effect on the
expression of the genes each parent transmit?

Atypical Patterns of Inheritance
In some genetic disorders, the expression of disease
phenotype depends on whether the mutant allele has
been inherited from the father or from the mother
 Differences in gene expression b/w the allele
inherited from the father and that inherited from the
mother are the result of genomic imprinting
 Imprinting is an alteration in chromatin that affects
gene expression but not its DNA sequence. Thus, it is
a reversible form of gene inactivation but is not a
mutation

Genomic Imprinting

Most genes are expressed equally from both paternal and
maternal alleles
 Genomic imprinting is the epigenetic marking of a gene
based on its parental origin that results in monoallelic
expression
 Genomic imprinting differs from classical genetics in that
the maternal and paternal complement of imprinted genes
are not equivalent
 The mechanism of imprinting appears to involve a parental
specific methylation of CpG-rich domains, that is reset
during gametogenesis??
Imprinted genes
 Approx 100-200 thought
to exist
 Involved in many aspects of development
including




Fetal and placental growth
Cell proliferation
Brain development
Adult behaviour
Genomic imprinting and embryogenesis



Haploid sperm + haploid egg  normal embryo
Haploid sperm + haploid sperm  hydatidiform mole
Haploid egg + haploid egg  ovarian dermoid cyst

Indicate that normal human development only proceeds when
a complement of the paternal and maternal genomes is present

Genomic imprinting in mammals may have evolved because
of a conflict of interest between the maternal and paternal
genome in regulating fetal growth
Imprinting in Genetic Diseases
A number of human diseases are associated with imprinting defects
 Diseases result from either
 Loss of imprinting (resulting in diallelic rather than monoallelic
expression). Control over imprinting appears to be governed by a
DNA element called the “imprinting center”, located within the
imprinted region itself.
 Uniparental disomy (resulting in either x2 or no expression)
 Imprinting changes can be either

congenital, e.g.
• Prader-Willi syndrome, Angelman syndrome
 or acquired, e.g.
• Altered expression of growth control genes in human cancer

IMPRINTED
 IMPRINTED:
Just after fertilization, a global
demethylation event occurs in the zygote, first
in the paternal pronucleus, followed by the
maternal pronucleus. Imprinting established
during gametogenesis must resist this
demethylation process. Remethylation of the
diploid genome occurs post-implantation and
sets secondary imprints that are maintained for
the life of the individual.
Prader-Willi syndrome
PWS is a relatively common dysmorphic syndrome
characterized by obesity, excessive and indiscriminate
eating habits, small hands & feet, short stature,
hypogonadism, & mental retardation
 Genomes have genetic info in 15q12 (15q11-q13) that
derives only from mothers

Prader-Willi syndrome
• 70%
have paternally
derived deletion of 15q12
• 25% have matUPD15
• 1-2% imprinting center
mutation
Angelman syndrome
Characterized by unusual facial appearance, short
stature, severe mental retardation, spasticity, and
seizures
 Have genetic info in 15q12 (12q11-q13) derived only
from father
 Also, E6-AP protein ligase mutation


E6-AP is located in 15q12 and is normally expressed from
maternal allele in the CNS
Angelman syndrome
• 70%
have maternallyderived deletion of 15q12
• 2% have patUPD15
• 2-4% E6-AP ubiquitin
protein ligase mutation
• 7-9% imprinting center
mutation
Imprinting
maternally inherited
allele is not expressed
paternally inherited
allele is not expressed
Uniparental Disomy
 Presence
of disomic cell line containing
two chr’s, or portions thereof, inherited
from only one parent
 Isodisomy: if the identical chr present in
duplicate
 Heterodisomy: if both homologs from one
parent present
Examples




Cases of PWS & AS
Two CF patients with short stature, inherited
two identical copies of most or all of their
maternal chr. 7. In both cases, the mother
happened to be a carrier for CF
Father-to-son transmission of hemophilia,
affected boy inherited both X & Y from father
Expression of X-linked in homozygous form
in a female offspring of a carrier mother and a
normal father
Mosaicism





Mosaicism is the presence of two or more genetically
different cell lines in an individual, all derived from a
single zygote
Mosaicism can be for chromosomal or single gene
disorders
Mosaicism may affect either somatic or germline tissues
Somatic Mosaicism can result in a range of abnormality
depending on the amount and distribution of normal cells
(e.g. mosaic Down syndrome, non-inherited cancers)
Gonadal (germline) mosaicism affects the germline tissues,
explains the increased risk of recurrence in disorders due to
new dominant mutations
Somatic Mosaicism
Depending on stage at which mutation occurred and
lineage of somatic cell in which it originated 
segmented or patchy manifestation
 If before separation of germline from somatic 
mutation present in both and transmitted to offspring
in complete form + expressed somatically in mosaic
form
 NF-1 is sometimes segmental, parents of patient are
normal, but if patient has affected child  the child’s
phenotype is complete NF-1. Here mutation must
have occurred before separation of germline from
somatic cell line that carries the mutation

Mutation
A mutation occurring during cell proliferation, in either
somatic or during gametogenesis, leads to a proportion
of cells carrying the mutation
 Somatic
mosaicism documented in many Xlinked disorders in both males and females.


e.g., a case of dysfunction of hepatic urea cycle
due to deficiency of ornithine transcarbamylase in
a boy with unusually mild form. Molecular
analysis  the boy had somatic mosaicism for a
deletion in OTC gene
Somatic mosaicism has been reported for
hemophilia A & DMD in females who transmitted
the mutation and therefore must have had germline
as well as somatic mosaicism
Germline Mosaicism
The chance that a disorder due to a new AD mutation
could occur more than once in a sibship is very low,
and having two occur independently in the same gene
in the same family is very unlikely
 Given that a child has a defect due to a new AD
mutation, the risk of having another child with the
same defect is negligible (equivalent to population
risk)
 In rare cases, parents who are phenotypically normal
may have more than affected child. Assuming correct
diagnosis (e.g., no reduced penetrance or mild
expression in any of the parents), the explanation is
germline mosaicism

 A somatic
mutation occurs in a germline cell
and persists in all clonal descendants of that
cell  proportion of gametes carries the
mutation.
 Recall that there are ~ 30 mitotic divisions in
germline cells before meiosis in female &
hundreds in male. So there is a chance for
mutation to occur during mitotic stages.
Germline Mosaicism
Embryo
No previous
family history of
this disorder
All or part of a
parent’s germ line is
affected by a
disease mutation,
but the somatic cells
are not
• Germline mosaicism is well documented in ~ 6% of
severe, lethal forms of the AD osteogenesis imperfecta. In
which mutations in type I collagen genes lead to abnormal
collagen, brittle bones, and frequent fractures
Recurrence of the AD OI. Both affected children have the same
point mutation in collagen gene. Their father is unaffected and
has no such a mutation in DNA from examined somatic tissues

Germline mosaicism has been reported for
several other disorders, e.g., hemophilia A & B,
& DMD
 The exact recurrence risk is difficult to assess
because it depends on what proportion of
gametes contains the mutation
 Apparently non-carrier parents of a child with AD
or X-linked disorder in which the occurrence of
mosaicism is unknown, may also have some
recurrence . These couples should be offered
whatever prenatal diagnostic tests appropriate
Germ-line mosaic
Male who is a germ-line mosaic
Non-mosaic male transmitting an autosomal dominant
disease
One may misclassify this pedigree as having a recessive disease when in
fact it’s a de novo inherited disease in the affected daughter
Mitochondrial inheritance
The Mitochondrial Genome

The mt genome consists of a circular chr., 16.5
kb.
 Most cells contain at least 1000 mtDNA
molecules, distributed among hundreds of
individual mt.
 Mature oocyte has more than 100,000 copies of
mtDNA.
 Mitochondrial DNA (mtDNA) contains 37 genes
(13 encode polypeptides, 2 rRNA, and 22
tRNAs).

Different rearrangements and point mutations
identified in mtDNA that can cause human
disease, often involving the central nervous
and musculoskeletal systems (e.g., myoclonic
epilepsy with ragged-red fibers).
 Mitochondrial diseases a distinctive pattern of
inheritance because of three unusual features
of mitochondria: replicative segregation,
homoplasmy and heteroplasmy, and
maternal inheritance.
Replicative Segregation


Absence of the tightly controlled segregation.
At cell division, the multiple copies of mtDNA
in each of the mitochondria in a cell replicate
and sort randomly among newly synthesized
mitochondria.
 The mitochondria, in turn, are distributed
randomly between the two daughter cells.
This process is known as replicative
segregation.
Homoplasmy-Heteroplasmy

When a mutation arises in the mtDNA, it is at
first present in only one of the mtDNA
molecules in a mitochondrion.
 With replicative segregation, however, a
mitochondrion containing a mutant mtDNA
will acquire multiple copies of the mutant
molecule.
 With cell division, a cell containing a mixture
of normal and mutant mtDNAs can distribute
very different proportions of mutant and wildtype mitochondrial DNA to its daughter cells.

One daughter cell may, by chance, receive
mitochondria that contain only a pure
population of normal mtDNA or a pure
population of mutant mtDNA (a situation
known as homoplasmy).
 Alternatively, the daughter cell may receive a
mixture of mitochondria, some with and some
without mutation (heteroplasmy).
 Because the phenotypic expression of a
mutation in mtDNA depends on the relative
proportions of normal and mutant mtDNA in
the cells making up different tissues, reduced
penetrance, variable expression, and
pleiotropy are all typical features of
mitochondrial disorders.
Homoplasmy and Heteroplasmy

Figure 7-33 Replicative segregation of a heteroplasmic mitochondrial mutation.
Random partitioning of mutant and wild-type mitochondria through multiple
rounds of mitosis produces a collection of daughter cells with wide variation in
the proportion of mutant and wild-type mitochondria carried by each cell. Cell
and tissue dysfunction results when the fraction of mitochondria that are
carrying a mutation exceeds a threshold level. N, nucleus.
Maternal Inheritance of mtDNA

The final mtDNA is its maternal inheritance.
Sperm mitochondria are generally eliminated from
the embryo, so that mtDNA is inherited from the
mother.
 Maternal inheritance in the presence of
heteroplasmy in the mother is associated with
additional features of mtDNA genetics that are of
medical significance.

First, the number of mtDNA molecules within
developing oocytes is reduced before being
subsequently amplified to the huge total seen in mature
oocytes. This restriction and subsequent amplification
of mtDNA during oogenesis is termed the
mitochondrial genetic bottleneck.

As might be expected, mothers with a high
proportion of mutant mtDNA molecules are
more likely to produce eggs with a higher
proportion of mutant mtDNA and therefore are
more likely to have clinically affected offspring
than are mothers with a lower proportion.

One exception to maternal inheritance occurs
when the mother is heteroplasmic for deletion
mutation in her mtDNA; for unknown reasons,
deleted mtDNA molecules are generally not
transmitted from clinically affected mothers to
their children.

Figure 7-34 Pedigree of Leber hereditary optic neuropathy, a form of
spontaneous blindness caused by a defect in mitochondrial DNA.
Inheritance is only through the maternal lineage, in agreement with
the known maternal inheritance of mitochondrial DNA. No affected
male transmits the disease.
Mitochondrial inheritance
Complications
• Incomplete penetrance
• Variable expression
Examples of mitochondrial diseases




MELAS (Mitochondrial Encephalomyopathy with Lactic
Acidosis and Stroke-like episodes
MERRF (Myoclonic Epilepsy with Ragged Red Fibres)
Leber Hereditary Optic Neuropathy (LHON)
External Ophthalmoplegia
• Kearns-Sayre syndrome
• Chronic progressive external ophthalmoplegia

NARP (Neurogenic weakness Ataxia with Retinitis
Pigmentosa)
Unstable DNA
(Trinucleotide repeat disorders)
Dynamic Mutations

A Mutation Which Changes Upon Transmission
 Trinucleotide Repeat Disorders Are the Best Example


Three Nucleotides Which Are Present in Increased Number
e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG
Trinucleotide Repeats

Normal
 Disease Causing When Expanded Beyond a Certain
Threshold
 Below That Threshold They Are Stable Both in Mitosis and
Meiosis
 Beyond a Certain Number the Repeat Can Be Unstable in
Meiosis ± Mitosis
Location of trinucleotide expansions in humans
“Repeat disorders” can be classified into two distinct types:
The repeats are translated (type I) or not translated (type II)
ATG
5’
TAA
CGGCGGCGG
GAAGAAGAA
CAGCAGCAG
CTGCTGCTG
Fragile X syndrome
Friedreich Ataxia
Huntington disease
DRPLA
SBMA
SCA1
SCA2
SCA3
SCA6
SCA7
Myotonic dystrophy
3’
Dynamic Mutations

Intergenerational instability




Anticipation



More severe phenotype with successive generations/ earlier onset age
Best example is myotonic dystrophy
Premutations



Repeat changes in size from parent to offspring
Sex of transmitting parent important
Some more unstable from father, others from mother
Repeat size which is unstable but does not result in A phenotype
Best example is fragile X syndrome
Genotype-phenotype correlation


For all trinucleotide repeat disorders, the larger the repeat, the earlier the
onset
Cannot use the repeat size to predict phenotype with accuracy