Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Guanine – Cytosine
Document related concepts
Genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
DNA barcoding wikipedia , lookup
Messenger RNA wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA sequencing wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Community fingerprinting wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA vaccination wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Epitranscriptome wikipedia , lookup
Molecular cloning wikipedia , lookup
Biochemistry wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcript
If you unraveled all your chromosomes from all of your cells and laid out the DNA end to end, the strands would stretch from the Earth to the Moon about 6,000 times. DNA nucleotides Phosphate group Nitrogenous base Pentose sugar Nucleotide Polynucleotide chain Sugar phosphate backbone 4 different bases G C A T two groups of bases: Purines- ADENINE (A) and GUANINE (G) Pyrimidines- THYMINE (T) and CYTOSINE (C) • -- Only 2 combinations of base pairs can form the rungs of the DNA molecule. Adenine - Thymine (A-T) AND Guanine – Cytosine (G-C) • --This specific matching up of the nitrogenous bases is called complementary base pairing. Okay… show the resulting base pairings below! ATGCCTACGTTAGATTACAACCTAAGCAAT TACGGATGCAATCTAATGTTGGATTCGTTA Did you find the hidden word?! • DNA- TACGCATACGATTC • DNA• mRNA• tRNA• AA- • DNA mRNAtRNA Amino Acid Protein In 1996 Wilmut et al used a similar method to clone the first mammal, Dolly. Since then many different species of mammal have been cloned, and their is serious debate about the cloning of humans.
