* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Amino Acids - Biology Learning Center
Promoter (genetics) wikipedia , lookup
Protein (nutrient) wikipedia , lookup
List of types of proteins wikipedia , lookup
Peptide synthesis wikipedia , lookup
Molecular evolution wikipedia , lookup
RNA interference wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Bottromycin wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding RNA wikipedia , lookup
Genetic code wikipedia , lookup
Transfer RNA wikipedia , lookup
Last day to drop without a th ‘W’ is September 16 (this upcoming Sunday) Review about bases • They need to be very specific because they contain ALL the information for telling the cell how to function, so if they were flexible and changeable there would be problems • Nucleotides (bases) are RIGID/INFLEXIBLE because of the double bonds that make up the rings • Means that the H-bond donors and acceptors are always in the same place = specificity How? 4 Why? Transcription: Writing again Translation: Changing languages 5 Cytosine cries out for Guanine GUANINE http://en.wikipedia.org/wiki/Guanine 6 Today we’ll go from here... We can do anything Text To here Off to see the wizard... Sending ‘messages’ out from DNA • • DNA replication • both strands => new DNA • => new cell Transcription • 1 strand => new RNA • => new protein 7 Transcription: seeing it http://www.hhmi.org/biointeractive/media/DNAi_transcription_vo1-lg.mov 8 9 Amino acids From 4 letters of storage/information to 20 letters of action!! 20 toys • EVERY one has a blue part. Chem name? • EVERY one has a red part. Chem name? • Thus these are all...? 10 Amino Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • How many are there? • Possible? Amino Acids • You & partner have an amino acid; which is it? (StructViewer or homepage => left column ‘big twenty’ amino acids) Nucleic Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • Which is more diverse in terms of shape and ‘feel’? • Which would allow for more diverse shapes and surfaces when ‘connected’? Different tools; different jobs • In what ways are all bases identical? Different? • In what ways are all amino acids identical? Different? • Which set is more diverse in terms of ‘feel’? • Which more diverse in terms of shape? • Which would allow you to build more diverse shapes & surfaces? 14 How does a codon ‘mean’ an amino acid? 15 16 Walking the walk How bio machines translate the language of nucleotides into an amino acid string Biology: because it has to work like that way • 17 Von Neumann argued that... [self-reproducing] machines would need to store separately the information needed to make the machine and would need to have a mechanism to interpret that information—a tape and a tape reader. In effect, he abstractly described the gene, the ribosome, and the messenger. --Matt Ridley in Francis Crick, discoverer of the genetic code Types of bonds 18 • VELCRO: a bond that can be cheerfully broken/re-made during lab • Duct tape: same at the molecular level, but at the 181L student level, breaking such a bond gets you a zero on this week’s quiz Blinding you with Science (jargon) RNA Polymerase: joins RNA links into a chain mRNA: messenger RNA; RNA string copied (‘transcribed’) from DNA tRNA: transfer RNA; one of many RNA molecules that carry specific amino acids ribosome: giant machine (>200 proteins, 4 RNAs (2 > 1000 nucleotides) that oversees the reading of the mRNA and the creation of polypeptide aminoacyl tRNA synthetase: protein machine adds amino acid to tRNAs Termination factor: ‘reads’ UAA etc., => ribosome looses the peptide & falls apart DNA template strand 5’ CTTAAATCCGAATGCCCATG 3’ 20 DNA template strand (alternate version) 5’ CTTAAATCCGAATGCCCATG 3’ 5’ end is pointy/spiky 3’ end is soft/furry 21 Wielding the Power • ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’! Walk-through with 1 tRNA • Everybody watches visits to synthetase, ribosome • In the real world, everything is happening all the time; all is happenstance Roles--for single mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA (1-2 people) • 4 pairs to be synthetases • 1 small ribosomal subunit x 2 • 1 large ribosomal subunit x 2 • 2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor (1-2 people) 24 Roles--for TWO mRNA 5’ end is pointy/spiky 3’ end is soft/furry • 4 tRNA • 4 synthetases • 1 ribosome • 1-2 to be (RNA polymerase & the RNA it makes ) • 1 termination factor 25 Learning your ‘lines’ • Handout: Each group find questions related to their role; answer them • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry 26 27 Choreographing translation A play of many parts, many players, no brains PLAYERS tRNA 28 Amino Acid is the yellow bit synthetase Ready…. Go! • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain Includes ‘didn’t work’ • Go until a protein happens Who knows the code? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon 30 Review movie • (in TA desktop folder) 31 Exit Condition 1.) Pair up (two in a group) 2.) Write your names and SECTION at the top of the paper 3.) EXPLAIN the process of TRANSLATION Include the following in your answer: tRNA mRNA ribosome UAG codon RNA Polymerase aminoacyl tRNA synthetase termination factor diffusion/Brownian motion **Worth 10 pts on next week’s quiz 33 Meet your semester-long interest 34 Homework StructViewer*--amino acid look & feel** Begin thinking about your project Assessor: mutation & translation *As will always be the case in this course, no tricks; focus on the primary idea(s) **‘SurfaceViewer’ link from Software page may help ...Ch. 3 reading about the immune system is just for fun