* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Ribosome - Mrs. J. Malito
Protein adsorption wikipedia , lookup
Transcription factor wikipedia , lookup
Gene regulatory network wikipedia , lookup
Community fingerprinting wikipedia , lookup
RNA interference wikipedia , lookup
Biochemistry wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA silencing wikipedia , lookup
Molecular evolution wikipedia , lookup
Bottromycin wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Proteolysis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Polyadenylation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Expanded genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene expression wikipedia , lookup
Transfer RNA wikipedia , lookup
From Gene To Protein Transcription & Translation Review The Central Dogma of Molecular Biology Cell DNA Transcription Translation mRNA Ribosome Polypeptide (protein) Transcription (DNA –> RNA) • 3 steps: 1) Initiation 2) Elongation 3)Termination Initiation • • • • • • DNA uncoils and separates the hydrogen bonds between the nitrogen bases. Only one side of DNA (the leading strand) is transcribed. RNA polymerase recognizes a specific base sequence in the DNA called a promoter and binds to it. The promoter identifies the start of a gene, which strand is to be copied, and the direction that it is to be copied. Uses initiation site and recognition sequences. Transcription Initiation Complex (Factors) Initiation • • • • • Elongation RNA polymerase moves along the DNA template. Complementary RNA nucleotides are added to the 3’ end of the growing chain. Base Pairing: Adenine on DNA directs the bonding with the new pyrimidine Uracil Base Pairing: Cytosine bonds with Guanine New mRNA breaks away from the leading DNA strand and the two original DNA strands rejoin and wind back up. Termination Termination • Transcription ends when RNA polymerase reads a DNA sequence called a terminator. • Once the mRNA is made, it is almost ready to carry the genetic information from the nucleus to the ribosomes for protein synthesis. Transcription Three types of RNA: 1) mRNA (messenger) 2) tRNA (transfer) 3) rRNA (ribosomal) Functions of RNA 1) mRNA: directs the amino acid sequence of polypeptides synthesized at ribosomes 2) tRNA: carries amino acids to proper locations within the growing polypeptide chain 3) rRNA: combines with proteins to form ribosomes that serve as the site of protein synthesis RNA Modifications • After transcription, mRNA has to be modified before leaving the nucleus by: 1) covalent modifications of the 3’ and 5’ ends of pre-mRNA. 2) removal of intervening sequences Covalent Modifications • A 5’ cap is added to protect the mRNA from degradation and to help small ribosomal subunits recognize the attachment site on mRNA’s 5’ end. • A poly-A tail is sequence of 30 – 200 A nucleotides added to the 3’ end of mRNA before it exits to: • Prevent degradation • Facilitate attachment • Regulate protein synthesis Removing Unnecessary Sequences • Sequences of nucleotides that code for genes are interrupted by noncoding segments of DNA called introns. • The introns are excised from RNA before it leaves the nucleus and translation begins. • Not all genes have introns. • Exons – coding sequences of a genes that are transcribed and expressed. Removing Unnecessary Sequences RNA Splicing • Process that removes introns and joins exons from pre-mRNA to create mature mRNA that will move into the cytoplasm from the nucleus. • Catalyzed by enzymes Role of the Ribosomes • • • • Ribosomes coordinate the pairing of the codons and the anticodons. Ribosomes are made up of two subunits: one large, one small. Each subunit is made of proteins and rRNA. There are 3 binding sites for mRNA: 1) P site – holds the tRNA that carries the growing chain. 2) A site – holds the tRNA that carries the amino acid to be added. 3) E site – exit site. Ribosomes Translation • • • The synthesis of a polypeptide (protein), under the direction of mRNA. mRNA —> protein 3 Steps: 1) Initiation 2) Elongation 3) Termination ©1998 Timothy G. Standish Translation – Initiation • • • Small ribosomal subunit binds to mRNA and tRNA. Large ribosomal subunit binds to the small one to form a translation complex. Initiation factors (proteins) are required. ©1998 Timothy G. Standish Translation – Initiation fMet Large subunit E • mRNA, a tRNA with the first amino acid (met), and the two ribosomal subunits come together. P A UAC 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ Small mRNA subunit ©1998 Timothy G. Standish Translation – Elongation • • • Amino acids are added one by one to the growing polypeptide chain. Uses proteins called elongation factors. 3 Steps: 1) Codon recognition – mRNA codon hydrogen bonds with the tRNA anticodon. 2) Peptide Bond formation – Amino acids are joined together by peptide bonds to create the polypeptide chain. 3) Translocation – the tRNA moves from the A site to the P site and finally to the exit site, from which it exits the ribosome. ©1998 Timothy G. Standish Translation – Elongation Polypeptide Arg Met Phe Leu Ser Aminoacyl tRNA Gly Ribosome E P A CCA 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA ©1998 Timothy G. Standish Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Aminoacyl tRNA Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA ©1998 Timothy G. Standish Translation - Elongation Polypeptide Met Phe Leu Ser Gly Arg Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA ©1998 Timothy G. Standish Translation - Elongation Polypeptide Met Phe Leu Ala Ser Gly Aminoacyl tRNA Arg Ribosome E P A CCA UCU 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA ©1998 Timothy G. Standish Translation – Elongation Polypeptide Met Phe Leu Ser Gly Arg Ribosome E Ala P A UCU CGA 5’GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA ©1998 Timothy G. Standish Translation - Termination • A stop codon in the mRNA is reached and translation stops. • UAA, UAG, UGA • A protein release factor binds to the stop codon and the polypeptide chain is released from the ribosome. ©1998 Timothy G. Standish Creation of Protein • • Polypeptides will then fold to assume their specific conformation. Remember primary, secondary, tertiary, and quaternary structures! ©1998 Timothy G. Standish Problem 1 Transcribe and translate the following DNA sequence: 3’AATAGTACCGCAAATTTATCGCTT5’ 5’UUAUCAUGGCGUUUAAAUAGCGAA3’ 5’UUAUC,AUG,GCG,UUU,AAA,UAG,CGAA3’ Met--Ala--Phe--Lys--Stop ©1998 Timothy G. Standish