* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download mRNA - Decatur ISD
Gene regulatory network wikipedia , lookup
RNA interference wikipedia , lookup
Molecular cloning wikipedia , lookup
List of types of proteins wikipedia , lookup
Biochemistry wikipedia , lookup
RNA silencing wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Polyadenylation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Gene expression wikipedia , lookup
Genetic code wikipedia , lookup
From Gene to Protein Chapter 17 Campbell What do genes code for? How does DNA code for cells & bodies? DNA how are cells and bodies made from the instructions in DNA proteins All the traits of the body The “Central Dogma” • Flow of genetic information in a cell – How do we move information from DNA to proteins? DNA replication RNA protein trait RNA • • • • Monomers = nucleotides Phosphate Ribose sugar Nitrogen Bases – uracil instead of thymine • U bonds with A • C bonds with G • single stranded DNA transcription RNA Compare DNA and RNA DNA RNA Shape Double helix 2 strands Single strand Sugar Deoxyribose Ribose Bases A, T, C, and G A, U, C and G Location Only in the nucleus Allowed to travel from nucleus to cytoplasm Types of RNA • Ribosomal RNA (rRNA) – Major component of ribosomes • Transfer RNA (tRNA) – Folded upon itself – Carries the amino acids to the mRNA • Messenger RNA (mRNA) – Sequence of nucleotides that determines the primary sequence of the polypeptide – Made in the nucleus from the DNA: transcription • snRNA (small-nuclear “snurps”) – Forms the “spliceosomes” which are used to cut out introns from pre-mRNA • siRNA (small-interfering) – targets specific mRNA and prohibits it from being expressed Protein Synthesis: From gene to protein nucleus a a a cytoplasm a a transcription DNA a a translation mRNA a a a protein a a a a a a ribosome trait Which gene is read on the DNA? • Promoter region – binding site before beginning of gene – Generally referred to as a TATA box because it is a repeating sequence of T and A – binding site for RNA polymerase & transcription factors • Enhancer region – binding site far upstream of gene • Speeds up process Transcription: DNA to mRNA • Takes place in the nucleus • A section of DNA is unzipped • RNA polymerase lays down nucleotides 5’ to 3’ direction. • The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm Coding strand = this is the protein needed or “sense strand” Template strand = this is the “anti-sense strand” Eukaryotic genes have untranscribed regions! • mRNA must be modified before it leaves the nucleus – exons = the real gene • expressed / coding DNA introns come out! – introns = non-coded section • in-between sequence • Spliceosomes cut out introns with ribozyme intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence Final mRNA processing… • Need to protect mRNA on its trip from nucleus to cytoplasm (enzymes in cytoplasm attack mRNA) • protect the ends of the molecule • add 5 GTP cap • add poly-A tail –longer tail, mRNA lasts longer 3' mRNA 5' G P P P A The Transcriptional unit enhancer 1000+b 20-30b 3' RNA TATA polymerase translation start TAC translation stop exons transcriptional unit (gene) 5' DNA ACT DNA introns promoter transcription start transcription stop 5' pre-mRNA 5' GTP mature mRNA 3' 3' AAAAAAAA Genetic Code • Genetic code is based on sets of 3 nucleotides …called CODONS! – Read from the mRNA – 64 different possible combinations exist • Only 20 amino acids commonly exist in the human body – Some codons code for the same amino acids (degenerate or redundant) • Sequence of codons determines the sequence of the polypeptide • Code is “almost” universal…same for all organisms (evolutionary heritage) The Code • You don’t need to memorize the codons (except for AUG) Start codon AUG methionine Stop codons UGA, UAA, UAG mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein MetArgValAsnAlaCysAla How is the code “translated?” Process of reading mRNA and creating a protein chain from the code. Ribosomes: Site of Protein Synthesis • Facilitate coupling of tRNA anticodon to mRNA codon • Structure – ribosomal RNA (rRNA) & proteins – 2 subunits • large • small E P A Ribosomes: 3 binding sites • A site (aminoacyl-tRNA site) – holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) – holds tRNA carrying growing polypeptide chain • E site (exit site) Met – Empty tRNA leaves ribosome from exit site 5' U A C A U G Transfer RNA • • • • • Found in cytoplasm Carries amino acids to ribosome Contains an “anticodon” of nitrogen bases Anticodons use complementary bond with codons Less tRNA’s than codons, so one tRNA may bind with more than one codon. • Supports the degenerate code • “Wobble” hypothesis: anticodon with U in third position can bind to A or G Translation: mRNA to Protein • In the cytoplasm ribosomes attach to the mRNA – Ribosome covers 3 codons at a time • Initiation - The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) • Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA – The two amino acids joined with peptide bond • Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations Building a polypeptide • Initiation – mRNA, ribosome subunits, initiator tRNA come together • Elongation – adding amino acids based on codons Good Overview animation • Termination 3 2 1 – STOP codon = Release factor Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C UGAA U mRNA A U G 3' E P A 5' UAC GAC A U G C U GAA U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C U G 3' A CC U GG U A A 3' RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit polypeptide 5' small ribosomal subunit tRNA E P A ribosome 3' Prokaryote vs. Eukaryote Differences • Prokaryotes – DNA in cytoplasm – circular chromosome – naked DNA – no introns – No splicing – Promoter & terminator sequence – Smaller ribosomes • Eukaryotes – DNA in nucleus – linear chromosomes – DNA wound on histone proteins – introns and exons – TATA box promoter – Transcription factors present Protein Synthesis in Prokaryotes • Transcription & translation are simultaneous in bacteria – Both occur in cytoplasm – no mRNA editing – ribosomes read mRNA as it is being transcribed