* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Central Dogma of Cell Biology
Transcription factor wikipedia , lookup
Biochemistry wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Community fingerprinting wikipedia , lookup
Molecular cloning wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
DNA supercoil wikipedia , lookup
Expanded genetic code wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular evolution wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Messenger RNA wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Non-coding RNA wikipedia , lookup
Genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epitranscriptome wikipedia , lookup
CENTRAL DOGMA OF BIOLOGY Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype Central Dogma of Cell Biology • DNA codes for DNA = REPLICATION • DNA codes for RNA = TRANSCRIPTION • RNA codes for protein = TRANSLATION Replication vs. Transcription • DNA-DNA • Starts at replication origins • Unwinds with Helicase • DNA polymerase • Proofreads • Start with 1 DNA End with 2 DNA: ½ new, ½ old • DNA-RNA • Starts at promoter regions • Does not need Helicase to unwind • RNA polymerase • No proofreading • Start with 1 DNA End with same DNA and 1 RNA Transcription • • • • • Process of converting DNA to mRNA Takes place in the nucleus 3 main steps: INITIATION RNA pol binds to the DNA ELONGATION nucleotide chain is built, complementary to the DNA message • TERMINATION RNA pol stops transcribing How do we know what to transcribe? • Promoter – Characteristic region of DNA that signals the start of a gene. – A sequence of letters that signals “gene ahead!” – “TATA box” and enhancers How do we know what to transcribe? • Start and stop codons – What are codons? Each 3 bases form a codon that codes for a particular amino acid AUG methionine amino acid, but also START UAA, UGA, UAG STOP Transcription - Step One: RNA Polymerase unwinds and unzips the DNA double helix. Transcription: Step Two: RNA polymerase adds on free-floating nucleotides A, G, C, U What does each bind with? Stops at STOP codon Releases RNA polymerase releases mRNA mRNA How do we know what to translate? • Before the mRNA message leaves the nucleus, RNA editing & modifications occur • DNA & RNA contain sequences that do not code for proteins = INTRONS – INTRONS = IN (BETWEEN) RONS • Sequences that code for proteins are expressed = EXONS – EXONS = EX (PRESSED SEQUENCE) ONS RNA Editing While still in the nucleus: • INTRONS are cut out, and • EXONS are spliced together before the RNA sequence is sent to the cytoplasm for translation http://wwwclass.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html • Transcription animation Transcription Translation Translation • The mRNA leaves the nucleus cytoplasm • Message is read at the ribosome • 1 Codon (3 letter message) is translated into 1 amino acid • tRNA molecule has one end (anticodon) that matches the mRNA . Each anticodon specifies an amino acid. • The amino acids are bonded together as peptide chains…which fold into proteins The Genetic Code: 3 letters = 1 codon 1 amino acid http://wwwclass.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html • Animation of translation Practice with this sequence • DNA: TCGATGTTCCGCCGTACGTCGTAACCG AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the complement to the mRNA. What’s that mean? Hint: Look for where it starts. How do you know? Once you’ve found the “reading frame”, write in triplets mRNA Use your genetic code wheel to write the amino acid sequence. How will you know when to stop? Try again without help DNA: CCGTCATGTTCGCGCTACAAATGAAATGA GGCAGTACAAGCGCGATGTTTACTTTACT mRNA: Polypeptide: