* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Protein Synthesis – Level 1
Extrachromosomal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Microevolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
History of RNA biology wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Polyadenylation wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transfer RNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
Primary transcript wikipedia , lookup
Expanded genetic code wikipedia , lookup
Point mutation wikipedia , lookup
Messenger RNA wikipedia , lookup
Protein Synthesis – Level 1 Use the following DNA sequence to answer the questions that follow: TACGGTAAATCGTGGATC 1. What will be the mRNA that results from transcription? AUGCCAUUUAGCACCUAG 2. How many codons does this Mrna have? 6 codons 3. What anticodons will the tRNAs have for this mRNA? (Remember, there is no tRNA anticodon for a stop codon) UAC – GGU – AAA – UCG – UGG 4. What amino acids will make up the polypeptide? METHIONINE – PROLINE – PHENYLALANINE – SERINE - THREONINE If a mutation occurred and the DNA became: TAGGTAAATCGTGGATC 5. What type of mutation is this? DELETION (FRAMESHIFT) 6. How will the protein be affected (be specific). There is no start codon, therefore the protein will not be made at all. Protein Synthesis – Level 2 Use the following DNA sequence to answer the questions that follow: TACGCCGTAAATCGTGGTAACGCCATC 1. What will be the mRNA that results from transcription? AUGCGGCAUUUAGCACCAUUGCGGUAG 2. If the underlined portions represent introns, what will the mature mRNA be/read? AUGCAUGCAUUGCGGUAG 3. How many codons does this mature mRNA have? How many tRNA anticodons will there be? 6 Codons 4. What anticodons will the tRNAs have for this mRNA? UAC – GUA – CGU – AAC – GCC 5. What amino acids will make up the polypeptide? METHIONINE – HISTIDINE – ALANINE – LEUCINE - ARGININE If a mutation occurred and the DNA became: TACGCCGTAAATCGAGGTAACGCCATC 6. What type of mutation is this? Substitution (point) 7. How will the protein be affected (be specific). The 3rd codon will change from GCA to GCU. However, both of these codons code for the amino acid alanine, therefore, there will be no change to the protein. Protein Synthesis – Level 3 Use the following DNA sequence to answer the questions that follow: 3’-GCCTATACGCCGTAAATCGTGGTAACGCTATC -5’ 1. What will be the mRNA that results from transcription? 5’-CGGAUAUGCGGCAUUUAGCACCAUUGCGAUAG-3’ 2. If the underlined portions represent introns, what will the mature mRNA be/read? 5’-CGGAUAUGCAUGCAUUGCGAUAG-3’ 3. Prior to leaving the nucleus, what will be added to the mature mRNA? What will the mRNA look like after this occurs? What is the purpose of this processing? The 5’ end will get a “cap” and the 3’ end will get a poly-A tail (AAAAAAA). These will help prevent the mRNA from degrading too quickly in the cytoplasm. 4. Where (what triplet) will the mRNA bind to the ribosome? AUG 5. What amino acids will make up the polypeptide? METHIONINE – HISTIDINE – ALANINE – LEUCINE - ARGININE If a mutation occurred and the DNA became: 3’-GCCTATACGGCCGTAAATCGAGGTAACGCTATC-5’ 6. What type of mutation is this? INSERTION (FRAMESHIFT) 7. How will the protein be affected (be specific). Beginning with the second codon, which changes from CAU to CCA, the amino acids will be different, causing the protein to be non-functional. The second amino acid will change from histidine to proline, the 3rd will change from alanine to cysteine, etc.