Download Author`s personal copy

This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/authorsrights
Author's personal copy
Developmental Biology 384 (2013) 331–342
Contents lists available at ScienceDirect
Developmental Biology
journal homepage: www.elsevier.com/locate/developmentalbiology
Evolution of Developmental Control Mechanisms
Beta-catenin patterns the cell cycle during maternal-to-zygotic
transition in urochordate embryos
Rémi Dumollard a,b,*, Céline Hebras a,b, Lydia Besnardeau a,b, Alex McDougall a,b
a
b
UMR 7009, UPMC University, Paris 06, France
Centre National de la Recherche (CNRS), Observatoire Océanologique, 06230 Villefranche-sur-Mer, France
art ic l e i nf o
a b s t r a c t
Article history:
Received 14 August 2013
Received in revised form
18 September 2013
Accepted 3 October 2013
Available online 16 October 2013
During the transition from maternal to zygotic control of development, cell cycle length varies in
different lineages, and this is important for their fates and functions. The maternal to zygotic transition
(MZT) in metazoan embryos involves a profound remodeling of the cell cycle: S phase length increases
then G2 is introduced. Although β-catenin is the master regulator of endomesoderm patterning at MZT
in all metazoans, the influence of maternal β-catenin on the cell cycle at MZT remains poorly understood.
By studying urochordate embryogenesis we found that cell cycle remodeling during MZT begins with the
formation of 3 mitotic domains at the 16-cell stage arising from differential S phase lengthening, when
endomesoderm is specified. Then, at the 64-cell stage, a G2 phase is introduced in the endoderm lineage
during its specification. Strikingly, these two phases of cell cycle remodeling are patterned by β-catenindependent transcription. Functional analysis revealed that, at the 16-cell stage, β-catenin speeds up
S phase in the endomesoderm. In contrast, two cell cycles later at gastrulation, nuclear β-catenin induces
endoderm fate and delays cell division. Such interphase lengthening in invaginating cells is known to be
a requisite for gastrulation movements. Therefore, in basal chordates β-catenin has a dual role to specify
germ layers and remodel the cell cycle.
& 2013 Elsevier Inc. All rights reserved.
Keywords:
MBT
Gastrulation
Cell cycle
S phase
Urochordate
Ascidian
Introduction
During development the speed of the cell cycle changes. Such
cell cycle remodeling is important for many aspects of embryonic
development including the morphogenetic cell movements of
gastrulation, which can be prevented if cell division is not halted
(Duncan and Su, 2004; Kurth, 2005; Murakami et al., 2004).
Ascidian embryos develop with a fixed number of cells and display
a stereotyped pattern of cell division (Hotta et al., 2007). During
early embryonic development in non-vertebrate chordates such as
the ascidians, the cell cycle is remodeled early, in a predictable
manner, and in specific blastomeres, making ascidians an excellent
organism to study how cell cycle length is controlled during
embryonic development at the single cell level.
Different mechanisms are employed to remodel the cell cycle
during early embryonic development. Early embryos display
successive phases of DNA duplication (S phase) and mitosis (M
phase) without the intervening gap phases (G1 and G2) common
to somatic cells. S phase is generally the first phase of the cell cycle
subject to cell cycle remodeling during embryonic development.
In large frog and fly embryos depletion of maternal factors induces
n
Corresponding author. Fax: þ 33 493 76 3792.
E-mail address: [email protected] (R. Dumollard).
0012-1606/$ - see front matter & 2013 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.ydbio.2013.10.007
cell cycle lengthening. For example, in Xenopus the nucleocytoplasmic (N/C) ratio increases with each round of cell division
causing the titration of an as yet unidentified factor leading to a
lengthening of S phase at the midblastula transition or MBT
(Newport and Kirschner, 1982a; Vastag et al., 2011). In Drosophila
embryos it is thought that cell cycle lengthening during cycles
10–13 (prior to the MBT at cycle 14) is provoked by depletion of
cyclins A and B which causes an initial slowing of DNA replication
that in turn activates chk1/grapes to further slowdown S phase
and prophase (Royou et al., 2008; Sibon et al., 1997; Yu et al.,
2000). Then at cycle 14, S phase lengthening is caused by loss of
the maternal Cdc25 phosphatase Twine (Farrell et al., 2012). Such
loss of maternal Cdc25 is due to a dramatic change in Cdc25
stability induced by an increased N/C ratio triggering zygotic
transcription (Di Talia et al., 2013; Farrell and O'Farrell, 2013).
In Caenorhabditis elegans the cell cycle is also remodeled but much
earlier at the two cell stage. This reflects the fact that zygotic
transcription starts at the 4-cell stage and gastrulation begins at
the 20-cell stage in C. elegans (Baugh et al., 2003). Interestingly, the
mechanism employed in C. elegans may be independent of cell
volume (Schierenberg and Wood, 1985) and is brought about by a
dual mechanism involving Plk1 and the DNA checkpoint system
depending on ATL-1/CHK-1. For example, during cell division in
C. elegans zygotes when anterior AB and posterior P1 cells are
formed, more PLK-1 protein is retained in AB while the activation
Author's personal copy
332
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
of ATL-1/CHK-1 occurs in P1 (reviewed in Budirahardja and
Gönczy, 2009). PLK-1 protein is actively retained in AB cells
(Budirahardja and Gönczy, 2008; Rivers et al., 2008) causing an
increased amount of CDC-25.1 to accumulate in the nucleus
thereby driving AB into mitosis ahead of its sister P1 (Rivers
et al., 2008), while ATL-1/CHK-1 delays mitotic entry in P1
(Brauchle et al., 2003).
A maternal gradient of β-catenin is one of the most ubiquitous
factors responsible for germ layer specification from cnidarians to
protostomes and non-vertebrate deuterostomes (reviewed in
Petersen and Reddien (2009). β-catenin is also the endoderm
determinant in embryos of cnidarians, protostomes and some
invertebrate deuterostomes (urochordates) and is thereby
directly responsible for the onset of gastrulation (Petersen and
Reddien, 2009; Woodland and Zorn, 2008). Despite such a conserved role for β-catenin during MZT and gastrulation at moments
of major cell cycle remodeling, the possibility that β-catenin
controls cell cycle duration before gastrulation has never been
explored.
Ascidian embryos develop with a small fixed cell number and
display cell cycle asynchrony from the 16-cell stage. For example,
at the 16-cell stage, 8 vegetal blastomeres divide before the
8 animal blastomeres creating a brief 24-cell stage embryo.
Remarkably, this pattern of cell division has been conserved in
very distantly-related ascidian species from different orders (e.g.
Halocynthia roretzi and Phallusia mammillata). However, it is not
known what causes the difference in cell cycle timing between
animal and vegetal cells at the 16-cell stage. The earliest known
zygotic transcription starts at the 8-cell stage (Halocynthia: Miya
and Nishida, 2003; Ciona: Rothbächer et al., 2007), and analysis of
transcription factors and signaling molecules in C. intestinalis
indicates that gene expression increases gradually during embryogenesis from the 16-cell stage onwards (Imai et al., 2004).
Furthermore at this stage β-catenin accumulates in the nuclei of
the vegetal cells to specify the endomesoderm (reviewed in
Kumano and Nishida, 2007). β-catenin has been shown to promote
cell proliferation in somatic cells (Niehrs and Acebron, 2012) but
not during endomesoderm patterning in early embryos. Although
the majority of zygotic genes are expressed at the MBT in Xenopus,
it was recently found that β-catenin patterns the dorsal mesoderm
by priming early expression of nodal-related genes at the 32-cell
stage, i.e. 5 cell cycles before MBT (Blythe et al., 2010; Skirkanich
et al., 2011; Yang et al., 2002). It is interesting to note that, during
cell cycle 5 to 10, dorsal cells divide first followed by a wave of cell
division over the embryo (Boterenbrood et al., 1983; Satoh, 1977).
These dorsal cells are the blastomeres which accumulate nuclear
β-catenin, but it is still unknown whether β-catenin modulates cell
cycle length in these blastomeres prior to the MBT in Xenopus
embryos.
Here we have investigated the relationship between β-catenin
and cell cycle duration in ascidian embryos and reveal for the first
time that β-catenin causes the presumptive endomesoderm cells
to divide ahead of the ectodermal cells leading to the appearance
of cell cycle asynchrony. We show that β-catenin is both necessary
and sufficient for the asynchrony in cell cycle duration at the
16-cell stage. Knockdown of β-catenin protein or blocking
β-catenin transactivation by Tcf both cause cell cycle slowing of
the vegetal cells indicating that β-catenin is necessary to maintain
a rapid cell cycle. Conversely, β-catenin over expression or inhibition of GSK3b both cause the 8 animal blastomeres to shorten
interphase and divide at the same time as the vegetal cells,
indicating that β-catenin is sufficient to speed up the cell cycle
at the 16-cell stage. In contrast β-catenin was found to slow down
the cell cycle in endoderm cells just before gastrulation at the 112
cell stage. Therefore β-catenin has a dual impact on cell cycle
duration depending on the germ layer and time of development.
Materials and methods
Biological material
Eggs from the ascidians P. mammillata were harvested from
animals obtained in Sète and kept in the laboratory in a tank of
natural sea water at 16 1C. Egg preparation and microinjection
have been described previously (see detailed protocols in Sardet
et al., 2011). All imaging experiments were performed at 19 1C.
Molecular tools
H2B::mRfp and MAP7::GFP were used previously to monitor
DNA and mitotic spindles in Phallusia embryos (Dumollard et al.,
2011; Prodon et al., 2010; McDougall et al., 2012). Ci-shugoshin
(KH.C12.362) was amplified from a Gateway-compatible cDNA
library. Ci-β-catenin (KH.C9.53) and DN-Tcf (Hudson et al., 2013)
were kindly provided by Yasuo Hitoyoshi (UMR7009). The
27 TCF::H2B-Ch reporter codes for H2B::Cherry driven by a
promoter hosting 27 Tcf/Lef binding sites (CCTTTGAT) multimerized upstream of the basal promoter fog. The 27 TCF::H2B-Ch
reporter was kindly provided by Dr Eileen Wagner (University
California Berkeley, USA). The ability of DN-Tcf to inhibit β-catenin/
Tcf-dependant transcription was assessed in live Phallusia embryos
by monitoring 27 TCF::H2B-Ch red fluorescence in embryos
expressing DN-Tcf (Fig. 5B). Pm-Pem-1 (Genbank Id: GQ418163)
that was cloned and characterized previously (Paix et al., 2011).
NT-β-Catenin was generated by targeted mutations of R459 and
H460 into ala. These 2 mutations are homologous to the mutations
R469A and H470A in human β-catenin which were found to
impair binding to Tcf1 (Von Kries et al., 2000).
All constructs were made using pSPE3 and the Gateway cloning
system (Invitrogen, Roure et al., 2007) unless otherwise stated (see
Sardet et al., 2011 for a detailed protocol).
Morpholino oligonucleotides injections
Sequences of P. mammillata genes were taken from EST collections and Phallusia genome project led by Hitoyoshi Yasuo and
Genoscope.
Pm-β-catenin (CTGGTTCATCATCATTTCTGCCATG) morpholino
oligonucleotides (MO) (GeneTools) was prepared at a concentration of 3 mM in dH2O and stored at 80 1C. MOs were then
injected at a pipette concentration of 1 mM ( 0.2% egg volume).
Importantly, in order to obtain the phenotypes published in this
study for β-catenin MO, MO injection was realized not more than
1 h before fertilization. If MO-injected eggs remained unfertilized
for longer time, stronger phenotypes were observed and problems
of cleavage were observed as early as the one cell stage. MO was
injected alone or co-injected with synthetic mRNAs before fertilization or in one blastomere at the 2-cell stage.
Time-lapse and fluorescence microscopy
Time-lapse imaging of Venus, GFP, mRfp1 and Cherry constructs was performed on an Olympus IX70 inverted microscope
set up for epifluorescence imaging. Sequential brightfield and
fluorescence images were captured using a cooled CCD camera
(Micromax, Sony Interline chip, Princeton Instruments, Trenton
NJ) and data collected was analysed using MetaMorph software
(Molecular Devices, Sunnyvale CA). 4D imaging was performed
with 6 to 10 z-planes acquired every minutes (or every 2 min) in
3 colours (BF, GFP/Venus and mRfp1/Cherry channel). Time series
were reconstructed and analysed by MetaMorph software (Molecular Devices) and Image J (NIH, USA). Timing of the cell cycle was
measured by scoring the time from NEB to NEB (visualised either
Author's personal copy
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
on the BF image or on the fluorescence image of H2B::mRfp1 or
cdc25::Ve, wee1::Ve or β-catenin::Ve which all localise to the
nucleus in interphase). Estimation of prophase length was measured by scoring the presence of condensing DNA (with H2B::
mRfp1) or of nuclear specks of Sgo::Ve (Kitajima et al., 2004)
within an intact nucleus.
Use of pharmacological inhibitors and ablation of the contraction pole
The GSK3b inhibitor BIO ((2′Z,3′E)-6-Bromoindirubin-3′-oxime,
Tocris Bioscience) was first dissolved in DMSO and used at a final
concentration of 2.5 mg/ml. BIO was added at the 4 cell stage
and left in the cultured medium during the whole length of
development.
It has been shown that aphidicolin (10 mg/ml) blocks over 85% of
labeled thymidine incorporation during S phase in ascidian embryos
(Satoh and Ikegami, 1981). In addition, aphidicolin (2 mg/ml) retarded
the cell cycle in the epidermis of neurula stage C. intestinalis embryos
(Ogura et al., 2011). Aphidicolin (Sigma) was dissolved in DMSO and
then used at a final concentration of 5 mg/ml. This concentration was
able to increase interphase length from the 2 cell stage indicating
that DNA synthesis was inhibited (Fig. S2A).
Ablation of the contraction pole was performed by sucking the
vegetal cytoplasm representing 15% of egg volume essentially as
described previously (Nishida, 1996).
Results
Emergence of mitotic domains in the ascidian embryo
Ascidians embryos undergo a very stereotyped development
comprising little proliferation such that all cells in a fully motile
tadpole larvae have divided between 8 and 14 times during 13 h of
development (Fujikawa et al., 2011; McDougall et al., 2011).
Furthermore, ascidians from different orders (e.g. Phallusia and
Halocynthia) display a conserved spatio-temporal pattern of cleavage resulting in the characteristic early gastrula consisting of
exactly 112 cells (Lemaire, 2009; McDougall et al., 2011) (see FABA
for Ciona intestinalis anatomy or Aniseed virtual embryo). In the
transparent embryos of the ascidian P. mammillata, simple bright
field (BF) imaging of nuclear envelope breakdown (NEB) and
cytokinesis makes it relatively straightforward to measure cell
cycle length (from NEB to NEB see Movie S1). In addition to BF
imaging, we performed fluorescence imaging of DNA/chromosomes with H2B::mRfp1 and of microtubules with MAP7::GFP
(see Prodon et al., 2010 and Sardet et al., 2011 for full protocols) to
precisely measure interphase and mitosis length in all blastomeres
from fertilization to the 112-cell stage when gastrulation begins
(Movie S2; Fig. 1). From the 2-cell stage to the 8-cell stage (cell
cycles 2–4), the embryo displays synchronous and rapid divisions
with a progressive increase in interphase length (from 8 min at the
2 cell to 14 min at the 8 cell stage). In contrast, the duration of
mitosis remains constant lasting 13 to 15 min from 2 to 112-cell
stage (Fig. 1D) and beyond (data not shown). As the nucleus is
observed during both interphase and prophase we assessed
prophase length at higher resolution by visualising chromosome
condensation within the intact nucleus (Fig. S1A, n 460 blastomeres). We consistently observed at all stages that chromosome
condensation started 3–4 min before NEB (all blastomeres
observed except endoderm blastomeres at 112 cell stage that
could not be resolved due to gastrulation movements). We further
estimated prophase length by visualising recruitment of Shugoshin::Ve to the kinetochores at prophase (Kitajima et al.,
2004) and observed that nuclear specks of Ci-Sgo::Ve always
formed at around 3–4 min before NEB (Fig. S1B, n 412
333
blastomeres). These observations suggest that prophase length is
constant at least until gastrulation and that the increase in cell
cycle length observed during early embryogenesis is due to an
increase in interphase duration.
As was noted in developmental tables for other ascidian
species, cell cycle asynchrony was first observed in the 5th cell
cycle at the 16 cell stage in Phallusia embryos (Fig. 1A). At this
stage, the 6 vegetal most blastomeres specified to become endomesoderm by nuclear β-catenin (A5.1, A5.2, B5.1; Kumano and
Nishida, 2007) undergo NEB almost simultaneously thus forming
the vegetal mitotic domain (MDVeg in red, average cell cycle
length: 31 min). Five minutes later, the B5.2 blastomeres hosting
germ plasm (Kumano et al., 2011; Shirae-Kurabayashi et al., 2011)
undergo NEB simultaneously (forming the germ lineage mitotic
domain: MDGL in yellow, average cc length: 36 min). Around
11 min after MDVeg, the 8 animal blastomeres undergo NEB almost
simultaneously (forming the animal mitotic domain: MDAn in
green, average cc length: 42 min, Fig. 1A and D, Fig. S3B). Such
cell cycle asynchrony is maintained at the 6th cell cycle (32-cell
stage) where the 12 blastomeres of MDVeg simultaneously enter
mitosis followed by the 4 of MDGL (B5.2 descendants) and finally,
the 16 blastomeres of MDAn (Fig. 1B). At the 64 cell stage, a second
phase of cell cycle remodelling is observed as MDVeg is subdivided
into 2 distinct mitotic domains termed Veg1 and Veg2: (Fig. 1C1–
C3). First, 12 peripheral blastomeres (comprising mesoderm and
neural lineages) divide to give rise to a 76-cell stage (Fig. 1C2).
Then MDAn and A7.6 blastomeres divide followed by the 6 blastomeres of MDGL that separate from the germ lineage to give rise
to the 112-cell stage (Fig. 1C3). At this stage all blastomeres are in
their 8th cell cycle except for 5 pairs endoderm precursors (A7.1,
A7.2, B7.1, B7.2, A7.5) and the pair of germ cell precursors (B7.6)
(Fig. 1C3). The 5 pairs of endoderm precursors will then enter
mitosis after undergoing apical constriction and basolateral shortening during an interphase of 80 min (Fig. 1D, Sherrard et al.,
2010).
Differential S phase length creates the onset of cell cycle asynchrony
at the 16-cell stage
In order to determine whether the 8 animal blastomeres that
delay mitotic entry at the 16-cell stage were in S phase or had
entered G2, we used aphidicolin to blocks S phase progression.
Following aphidicolin treatment during S phase, when sister
chromatids separate and move to the poles of the mitotic spindle
at anaphase, unreplicated DNA is stretched between the separated
sister chromatids forming a DNA bridge linking the sister telophase nuclei (Raff and Glover, 1988, Dalle Nogare et al., 2009).
Conversely, aphidicolin treatment of cells post S phase does not
cause the formation of DNA bridges. Aphidicolin delays mitotic
entry from the 2 cell stage (Fig. S2A) but it does not provoke cell
cycle arrest in early Phallusia embryos (not shown). We incubated
16-cell stage ascidian embryos with aphidicolin at different times
after NEB of MDVeg (noted t¼0′ in Fig. S2C). Aphidicolin produced
DNA bridges in MDAn when applied between 0 and 5 min after
NEB in MDVeg but not when applied between 6 and 9 min after
NEB in MDVeg (Fig. 2A, Fig. S2B). As expected, aphidicolin had no
effect on MDVeg (n ¼6 embryos, Fig. 2A). Together these observations indirectly indicate that animal blastomeres are still in
S phase when vegetal blastomeres are in mitosis (Fig. S2C). As
animal blastomeres retain a nucleus for a further 6 min, these
observations suggest that a potential G2 phase of no more than
3 min might occur in animal cells (Fig. S2C).
We performed the same experiment at EGT by perfusing
aphidicolin at the late 76-cell stage when MDVeg1 cells have
completed their 7th division whereas MDVeg2 are still in interphase of cell cycle 7 and MDAn are entering mitosis ending cell
Author's personal copy
334
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
Fig. 1. Mitotic domains in Phallusia embryos. Fluorescence images of DNA (H2B::mRfp1 in red) and mitotic spindles (MAP7::GFP in green) taken from time-lapse imaging
experiments and corresponding schematic representations of Phallusia embryos. Scale bars¼ 20 mm. (A) 16 cell stage: In the vegetal hemisphere, the blastomeres A5.1, A5.2
and B5.1 are already in mitosis (m) and form the first mitotic domain (MDVeg in red) while the germ lineage (B5.2) is still in interphase (i) and will enter mitosis second
forming MDGL (in yellow). The 4 animal blastomeres are also in interphase and will enter mitosis last, forming the third mitotic domain (MDAn in green). (B) 32 cell stage:
42 min later the 12 descendants of MDVeg are in mitosis whereas the 4 descendants of MDGL and MDAn are still in interphase of cell cycle 6. (1) 64 cell stage: 94 min after (A),
14 descendant of MDVeg (A7.3, A7.4, A7.6, A7.7, A7.8, B7.3, B7.4) are in mitosis together forming MDVeg1 (in red). MDGL and MDAn are still in interphase. (2) 76 cell stage:
108 min after (A), the 32 animal blastomeres are in mitosis of their 7th cell cycle while the blastomeres of MDGL and MDVeg2 are in their 7th interphase and blastomeres of
MDVeg1 are in their 8th interphase. (3) 112 cell stage: 40 min later, the 10 presumptive endoderm blastomeres (A7.1, A7.2, A7.5, B7.1, B7.2) and MDGL blastomeres are still in
their 7th interphase whereas MDAn and MDVeg1 are in their 8th interphase. (D) Graph showing cell cycle length of each pair of blastomere from 2 to 64 cell stage. The blue
part of the column indicates interphase, purple indicates prophase (as measured in Fig. S1) and yellow indicates mitosis. Cell cycle asynchrony arises at the 16 cell stage
(labelled MBT). Red asterisks indicate the germ line precursor pair of blastomeres (B5.2, B6.3, B7.6). At the 64 cell stage (labelled EGT for early gastrula transition). Cell cycle
length is increased sharply in the 5 endoderm pairs (E) compared to other vegetal (Veg) and animal (An) blastomeres. Prophase length could not be determined for the
5 endoderm pairs due to motion of the nuclei during their invagination.
Author's personal copy
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
335
Fig. 2. Cell cycle asynchrony at the 16 cell stage is due to differential S phase lengthening. 16 cell stage: Left column:bright field (BF) images of a 16 cell stage embryo taken
2 min after addition of Aphidicolin (30 mg/ml) and Hoechst, showing that the 8 animal blastomeres are still in interphase (yellow asterisks indicate nuclei, MDAn: Int5) while
the 6 vegetal blastomeres have undergone NEB (MDVeg: Mit). Not shown here is that MDGL is in prophase (MDGL: Pro). Right column: 18 min after Aphidicolin addition, the
animal blastomeres are undergoing cytokinesis and DNA bridges (white arrows) can be observed trapped in the cleavage furrows. Each blastomere has been color-coded for
clarity. In contrast, 11 min after Aphidicolin treatment the 8 vegetal blastomeres have undergone anaphase and cytokinesis without forming DNA bridges (n¼ 6). Scale
bar¼ 20 mm. (B) 76–128 cell stage: Aphidicolin was added at the late 76 cell stage when MDAn entered mitosis of cell cycle 7 ( þ5′ Aphidicolin, top row) and after MDVeg1
blastomeres have completed their 7th mitosis (labelled red, þ 2′ Aphid, lower row). White asterisks indicate that A7.6 pairs are the only blastomeres of MDVeg1 that have not
completed cell cycle 7. Labelled in orange are the 10 endoderm precursors which are still in their 7th interphase 2 min after Aphidicolin addition ( þ2′ Aphid). At the 128 cell
stage (52 min after Aphidicolin addition) the blastomeres of MDVeg2 have completed cell division without forming DNA bridges (labelled orange, lower row). At the gastrula
stage, 76–80 min after Aphidicolin addition, MDAn blastomeres all show DNA bridges (n¼ 4). Scale bar¼ 20 mm.
cycle 7 (Fig. 2B). MDVeg2 blastomeres entered mitosis 34 min after
perfusion of aphidicolin and completed chromosomes segregation
without DNA bridges (n ¼4 embryos, Fig. 2B: Vegetal; 52 and
80 min after aphidicolin perfusion) indicating that MDVeg2 cells
were in G2 phase at the time of aphidicolin addition. As a control
we observed numerous DNA bridges in MDAn as these blastomeres
Author's personal copy
336
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
were exposed to aphidicolin during the whole of their 8th
interphase (Fig. 2B Animal, white arrows). Therefore after about
50 min of interphase (the time of aphidicolin addition), blastomeres of MDVeg2 had completed S phase and were in G2 until they
entered mitosis 34 min later.
Together these observations show that cell cycle asynchrony
and mitotic domains first appear at the 16-cell stage by differential
S-phase lengthening. They also suggest that a long G2 phase
(doubling interphase length) is introduced in the endoderm lineage to delay mitotic entry in MDVeg2.
The cell cycle is patterned by
transcription at MBT
β-catenin-dependant zygotic
The appearance of cell cycle asynchrony at the 16-cell stage
coincides with endomesoderm patterning by nuclear β-catenin in
MDVeg (Imai et al., 2006; Kumano and Nishida, 2007; Hudson
et al., 2013). We sought to assess the role of β-catenin in cell cycle
remodelling at the 16-cell stage in ascidians. β-catenin patterning
was disabled by injection of β-catenin MO (Fig. 3B, Movie S4),
expression of DN-Tcf (Fig. 3C, Movie S3) or by ablating the vegetal
cytoplasm (contraction pole: CP) in zygotes (Fig. 3D, Movie S5) to
animalize the embryo (Nishida, 1996). These three approaches all
caused vegetal blastomeres to divide later while none of these
treatments affected cell cycle duration of animal blastomeres
(Fig. 3E). These observations show that β-catenin-dependent
transcription is necessary for the rapid cell cycle found in MDVeg.
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.ydbio.2013.10.007.
Conversely we found that stabilisation of endogenous β-catenin
with the GSK3β inhibitor BIO (Tocris Bioscience) speeded-up MDAn
(n¼6; Fig. 4B and D, Movie S6). Likewise, expression of β-catenin::
Venus also caused animal blastomeres to divide at the same time as
vegetal blastomeres (Fig. 4C and D, Movie S7). Importantly, neither
BIO nor over-expression of β-catenin affected vegetal cell cycle
speed (Fig. 4D) likely because β-catenin is already stabilized in
MDVeg.
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.ydbio.2013.10.007.
In order to confirm the hypothesis that zygotic transcription
can pattern the cell cycle at the 16 cell stage we measured
cell cycle duration in embryos lacking zygotic transcription
(Fig. S3A, S3B, S3C, Movie S8). We first inhibited transcription with
α-amanitin and actinomycin D but found that both drugs strongly
lengthened the cell cycle with enormous variability and induced
DNA bridges at the 64–76-cell stage (data not shown) which
precludes the use of these inhibitors. We thus decided to use an
alternate method to switch off zygotic transcription by expressing
Pem1, the maternal factor silencing transcription in the germ
lineage of ascidians (Kumano et al., 2011; Shirae-Kurabayashi
et al., 2011). Pm-Pem1::Ve expression blocked β-catenin-dependant
zygotic transcription in Phallusia embryos (Fig S3C) and inhibited
gastrulation (Fig. 5B, Movie S8) indicating that Pem1 expression
inhibits zygotic transcription and hence germ layer patterning in
Phallusia embryos as it does in other ascidian species (Kumano et al.,
2011; Shirae-Kurabayashi et al., 2011). All cell cycle asynchrony was
lost in embryos expressing Pm-Pem1::Ve and, when compared with
cell cycle timing in WT embryos, MDVeg was found to be significantly
slower (Fig. S3A). The spatial pattern of cell division is not affected in
Pm-Pem1-expressing embryos (Fig. S3A, Negishi et al., 2007) and
blastomere volumes are maintained at the 16-cell stage. Plotting cell
volume against absolute cell cycle length clearly shows that there is
no correlation between cell cycle length and cell volume at this stage
(Fig. S3B; WT embryo is from Fig. 2B). Therefore the cell cycle
asynchrony observed at MBT in Phallusia embryos requires zygotic
transcription
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.ydbio.2013.10.007.
β-Catenin-dependant endoderm specification results in increased
interphase length at EGT
Nuclear β-catenin was also found to profoundly affect cell cycle
length two cell cycles later during the early gastrula transition
(EGT, Fig 5A). Expression of WT β-catenin in the whole embryo
could increase cell cycle length in MDVeg1 (from 40 to 72 min)
whereas a mutant β-catenin which is not able to bind Tcf/Lef (NTβ-catenin, see Materials and methods section) could not (Fig 5A).
Reciprocally, down-regulation of β-catenin (DN-Tcf and β-catenin
MO) prevented cell cycle lengthening at the 64 cell stage (Fig 5A)
and gastrulation (as no endoderm could be formed, Fig. 5B). These
observations suggest that Tcf-dependent transcription was responsible for interphase lengthening in the endoderm at EGT. A role for
zygotic transcription was confirmed by blocking zygotic transcription using Pm-Pem1::Ve expression (Fig. S3D). As expected,
expression of Pm-Pem1::Ve inhibited interphase lengthening in
MDVeg1 (Fig. S3D) and also inhibited gastrulation movements
(Fig. 5B) demonstrating that zygotic transcription is necessary for
cell cycle remodeling during endoderm specification
Together our study reveals a dual role for β-catenin-dependant
transcription on cell cycle duration: β-catenin speeds up the cell
cycle (in the endomesoderm at MBT) then later slows down the
cell cycle (in the endoderm at EGT). These data suggest that two
different gene regulatory networks that affect cell cycle duration
are controlled by β-catenin dependent transcription at MBT
and EGT.
Discussion
Studies in Xenopus and Zebrafish embryos have shown that cell
cycle remodeling at MBT does not require zygotic transcription.
However, in Drosophila embryos zygotic transcription is necessary
for cell cycle remodeling at MBT but this is independent of germ
layer patterning. Our study shows that cell cycle remodeling
during urochordates embryogenesis relies heavily on β-catenindependent transcription. The first phase of cell cycle remodeling at
the 16-cell stage marks the onset of cell cycle asynchrony achieved
by differential S phase lengthening. A long G2 phase (of 40 min)
introduced in the endoderm precursors at EGT is also driven by
β-catenin-dependent transcription. Therefore β-catenin patterning
can both speed up and slow down the cell cycle in urochordate
embryos.
ΜΒΤ in urochordate embryos
Cell cycle remodeling during MBT has been studied mostly in
animals that have large embryos such as Xenopus, zebrafish and
Drosophila. These studies established that the mid-blastula transition (MBT) marks the start of the maternal to zygotic transition
(MZT) and occurs 2 to 3 cell cycles before the onset of gastrulation
(Edgar and Datar, 1996; Kane and Kimmel, 1993; Newport and
Kirschner, 1982). The MBT in vertebrate embryos is defined by
molecular events such as zygotic genome activation and loss of
maternal mRNAs as well as by cell behavioural changes such as
development of cell motility and the onset of asynchronous cell
cycles (Edgar and Datar, 1996; Kane and Kimmel, 1993; Newport
and Kirschner, 1982). Seminal studies in Xenopus and Drosophila
embryos suggest that the N/C ratio controls MBT independently of
zygotic transcription until it was discovered recently in Drosophila
that the N/C ratio controls the expression of zygotic genes
inducing MBT (Lu et al., 2009; Lasko, 2013).
Author's personal copy
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
337
Fig. 3. Nuclear β-Catenin is necessary to speed up cell cycle at MBT. (A) WT embryo showing the 3 mitotic domains. Scale bar ¼20 mm. (B) embryo injected at the 2 cell stage
with β-catenin MO (indicated in blue). Blastomeres of MDVeg are still in interphase in the injected side whereas they have entered mitosis in the WT side. Blastomeres in the
injected side are thus all synchronous. Yellow asterisks indicate nuclei. Scale bar¼ 20 mm. (C) embryo expressing DN-Tcf and H2B::mRfp1 (in red). Images show that while
blastomeres of MDVeg and MDGL are in mitosis, MDAn blastomeres are still in interphase. (D) contraction pole ablated embryo expressing MAP7::GFP and PH::GFP showing
that all blastomere are in mitosis simultaneously. (E) quantification of cell cycle length in manipulated embryos: graph showing the relative increase in cell cycle time in
MDVeg in β-Catenin MO injected embryos (striped bars, n¼7), in DN-Tcf expressing embryos (white bars, n¼ 7) and in contraction pole ablated embryos (diamond bars, n ¼5)
compared to WT embryos (black bars, n¼ 5). All treatments induced a significant delay in MDVeg (black asterisks, po 0.01) and all treatments erased all cell cycle asynchrony
except DN-Tcf (2 mitotic domains observed: denoted a″ and b″).
The first major burst of zygotic gene expression in ascidian
embryos is seen at the 16-cell stage, 2 cell cycles before gastrulation
(Imai et al., 2004) when the first cell cycle asynchrony
is observed. The 16-cell stage in ascidian embryos may therefore
be equivalent to the MBT described in other metazoans as it
possesses two known properties of MBT. However, ascidian embryos
display differences with larger embryos such as Xenopus, zebrafish
and Drosophila since transcription of many genes occurs gradually in
the ascidian from the 16-cell stage and throughout embryogenesis
(Imai et al., 2004) and there has been no report of a mass phase of
maternal mRNA destruction. Thus, the MBT in ascidians could be
defined as the period where zygotic genome begins to be activated,
cell cycle asynchrony first occurs and cell motility begins (we
observed previously motility in isolated blastomeres at the 16-cell
Author's personal copy
338
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
Fig. 4. Nuclear β-Catenin is sufficient to speed up cell cycle at MBT. (A) WT embryo showing the 3 mitotic domains. Scale bar ¼20 mm. (B) embryo treated with BIO (2.5 mg/
ml) showing that MDVeg and MDAn are in mitosis whereas MDGL is still in interphase. Scale bar ¼ 20 mm. (C) embryo injected at the late 2 cell stage with mRNA coding for Ciβ-catenin::Ve (which is high in a quarter of the embryo, labelled in blue). β-catenin does not affect MDVeg, slightly delays MDGL and significantly speeds up MDAn which is
already in mitosis whereas WT side is still in interphase. (D) quantification of cell cycle length in manipulated embryos: graph showing the relative decrease in cell cycle time
in MDAn in embryos treated with BIO (striped bars, n ¼6)), in embryos expressing Ci-β-catenin::Ve (white bars, n¼ 5) and in embryos expressing Ci-NT-β-catenin::Ve
(diamond bars, n¼ 5) compared to WT embryos (black bars, n ¼5). All treatments induced a significantly faster cell cycle in MDAn (black asterisks, po 0.01) without affecting
MDVeg or MDGL. All treatments erased all cell cycle asynchrony.
stage Prodon et al., 2010) although no major phase of maternal
mRNA destruction has been yet described.
The MBT in different metazoan embryos and its relationship to germ
layer specification
The MBT occurs before germ layer specification in Drosophila
embryos (Lasko, 2013). The number of pre-MBT cell cycles in
Drosophila was initially thought to be caused by increasing N/C
ratio which triggered Chk1-dependent S phase checkpoint and
involved an unknown contribution from zygotic transcription
(Edgar and Datar, 1996; Sibon et al., 1997). More recent data from
Drosophila instead indicates that zygotic transcription of Vielfaltig
occurs first (Sung et al., 2013), and this probably induces tribbles
expression resulting in the destabilization of maternal Cdc25
protein (Twine) (Farrell and O'Farrell, 2013).
In large vertebrate embryos the MBT occurs independently
from germ layer specification. In Xenopus and zebrafish embryos,
cell cycle asynchrony at MBT is thought to involve S phase
lengthening and G2 introduction caused by depletion of maternal
DNA replication factors which, in blastomeres with different
volumes, creates the largest N/C ratio in the smallest blastomeres.
Thus, the smaller blastomeres possessing the higher N/C ratio have
a slower DNA synthesis rate because cytoplasmic replication
factors are more limiting in these small blastomeres (Kane and
Kimmel, 1993; Newport and Kirschner, 1982).
Author's personal copy
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
339
Fig. 5. β-catenin-dependant endoderm specification induces cell cycle asynchrony at EGT. (A) Graph showing cell cycle timing at the 64–112 cell stage (cell cycle 7) in WT
embryos (black bars, n ¼3), β-catenin MO injected embryos (red bars, n ¼3–6), DN-Tcf expressing embryos (yellow bars, n ¼3–5), Ci-β-catenin::Ve expressing embryos (light
green bars, n¼ 4) and in Ci-NT-β-catenin::Ve expressing embryos (dark green bars, n¼ 4–7). The schematic representations depict the presence of mitotic domains and the
average cell cycle length in MDVeg1 and MDVeg2 for each treatment. (B) Images showing gastrulation defects in the manipulated embryos. Gastrulation was inhibited by
β-catenin MO (n¼ 6), DN-Tcf (n¼ 7) and Ci-β catenin::Ve (n ¼7) and Pm-Pem1::Ve (n¼ 6 embryos) whereas it was not altered by NT-Ci-β-catenin (n¼ 6). Bottom left inset
shows inhibition of TCf-dependant transcription by DN-Tcf in Phallusia embryos (n ¼12 embryos showing 27 TCF::H2B fluorescence except in the part of the embryo
expressing Pm-Pem1::Ve).
Author's personal copy
340
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
Fig. 6. Model for cell cycle asynchrony at MBT and EGT in urochordates. (A) Schematic representation of an ascidian embryo at MBT depicting the 3 mitotic domains.
β-catenin patterning in the vegetal cells (in red) results in a more processive S phase. In the germ lineage transcriptional outputs of β-catenin are repressed by the germ line
transcriptional repressor Pem1 (in pink). B) Schematic representation of an ascidian embryo at EGT depicting the 2 vegetal mitotic domains. β-catenin/Tcf dependant
transcription is introducing a G2 phase in the endoderm (Veg2) either via lhx3b or via an alternate route.
The onset of cell cycle asynchrony at MBT in ascidian embryos
relies critically on patterned zygotic transcription (Fig. 6A). Indeed,
we consistently observed that manipulations of the β-catenin
pathway led instantly to changes in interphase length. Such quick
response of the cell cycle to nuclear β-catenin suggests that
β-catenin could pattern the cell cycle directly and in parallel with
fate specification. Mitogenic Wnt signals are known to increase
c-myc levels (Dang et al., 2006). Among known c-myc targets,
those that affect S or G2 phase (eg. cycA, cycB, cdc25 and PCNA)
rather than those that promote cell cycle resumption from a
quiescent state (eg. cycD, cdk4) would be interesting to investigate
further. Alternatively, β-catenin might impact S phase length
downstream of fate specification. At the 16-cell stage, nuclear
β-catenin induces the expression of FGF9, FoxD and FoxA (Kumano
and Nishida, 2007; Imai et al., 2006). Our aim is to address this
question by specifically inhibiting these pathways to determine
whether β-catenin patterns the cell cycle in parallel or via cell fate
specification.
Author's personal copy
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
Although it is generally accepted that zygotic genome activation does not affect the speed of the cell cycle in large frog
embryos, it has become apparent that many zygotic genes are in
fact activated before the MBT (Blythe et al., 2010; Skirkanich et al.,
2011; Yang et al., 2002). Interestingly, it has been known for many
years that cleavage waves occur in Xenopus before the blastula
stage (Boterenbrood et al., 1983; Satoh, 1977). At cell cycle 5, such
mitotic waves initiate in the dorsal mesoderm in blastomeres that
have the highest nuclear β-catenin levels (Larabell et al., 1997).
Moreover, β-catenin induced transcription starts as early as the
32-cell stage in Xenopus (i.e. cell cycle 5: (Blythe et al., 2010),
exactly when mitotic waves are observed (Boterenbrood et al.,
1983; Satoh, 1977)). It is therefore a possibility that the establishment of the pre-MBT mitotic waves in frog embryos is induced by
β-catenin. We therefore suggest that it would be worthwhile to reinvestigate whether cell cycle speed in Xenopus embryos is
influenced before the MBT by β-catenin-dependent transcription.
In conclusion our observations show that the GRN activated by
nuclear β-catenin at the 16-cell stage results in shortening of
interphase in the endomesoderm (MDVeg, Fig 6A) whereas, two
cell cycles later, the GRN activated by nuclear β-catenin increases
interphase length in the 10 endoderm precursors (MDVeg2, Fig. 6B)
allowing gastrulation to begin (Sherrard et al., 2010). Such a dual
impact of nuclear β-catenin on cell cycle length suggests that cell
cycle duration is set downstream of fate by fate determinants
(FoxD or FoxA or FGF in endomesoderm at MBT and lhx3b in
endoderm at EGT). However the quick response of the cell cycle to
changes in β-catenin activity at MBT also suggests that parallel
pathways may exist. We would predict that the GRN activated by
β-catenin at MBT results in the stabilization of nuclear cdc25 in
endomesoderm precursors thereby increasing the speed of S
phase. In contrast, a different GRN activated by β-catenin at EGT
in endoderm precursors might result in either loss of cdc25
protein and/or induction of wee1 expression to introduce a G2
phase (Murakami et al., 2004). We are currently investigating
these different possibilities.
Acknowledgments
We would like to thank the ANR (08-BLAN-0136-02) and ARC
(SFI20111203776) for financial support. We would also like to
thank Hitoshi Yasuo for helpful discussions and for providing WT
β-catenin and DN-Tcf constructs. The authors also express their
warm thanks to Eileen Wagner (UC Berkeley) for the gift of the
27 TCF::H2B-Cherry reporter. Finally, we thank the members of
UMR7009 for their help and support and especially Christian
Rouvière for managing all imaging systems and Mohammed
Khamla for making movie files.
Appendix A. Supplementary information
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.ydbio.2013.10.007.
References
Baugh, L.R., Hill, A.A., Slonim, D.K., Brown, E.L., Hunter, C.P., 2003. Composition and
dynamics of the Caenorhabditis elegans early embryonic transcriptome. Development 130, 889–900.
Blythe, S.A., Cha, S.-W., Tadjuidje, E., Heasman, J., Klein, P.S., 2010. beta-Catenin
primes organizer gene expression by recruiting a histone H3 arginine 8 methyltransferase, Prmt2. Dev. Cell 19, 220–231.
Brauchle, M., Baumer, K., Gönczy, P., 2003. Differential activation of the DNA
replication checkpoint contributes to asynchrony of cell division in C. elegans
embryos. Curr. Biol. 13, 819–827.
341
Budirahardja, Y., Gönczy, P., 2008. PLK-1 asymmetry contributes to asynchronous
cell division of C. elegans embryos. Development 135, 1303–1313.
Budirahardja, Y., Gönczy, P., 2009. Coupling the cell cycle to development. Development 136, 2861–2872.
Boterenbrood, EC., Narraway, JM, Hara, K., 1983. Duration of cleavage cycles and
asymmetry in the direction of cleavage waves prior to gastrulation in xenopus
laevis. Roux Arch. Dev. Biol. 192, 216–221.
Dalle Nogare, D.E., Pauerstein, P.T., Lane, M.E., 2009. G2 acquisition by transcriptionindependent mechanism at the zebrafish midblastula transition. Dev. Biol. 326,
131–142.
Dang, CV, O'Donnell, KA, Zeller, KI, Nguyen, T, Osthus, RC, Li, F., 2006. The c-Myc
target gene network. Semin. Cancer Biol. 16 (4), 253. (64).
Di Talia, S., She, R., Blythe, S.A., Lu, X., Zhang, Q.F., Wieschaus, E.F., 2013.
Posttranslational control of Cdc25 degradation terminates Drosophila's early
cell-cycle program. Curr. Biol. 23, 127–132.
Dumollard, R., Levasseur, M., Hebras, C., Huitorel, P., Carroll, M., Chambon, J.-P.,
McDougall, A., 2011. Mos limits the number of meiotic divisions in urochordate
eggs. Development 138, 885–895.
Duncan, T., Su, T.T., 2004. Embryogenesis: coordinating cell division with gastrulation. Curr. Biol. 14, R305–307.
Edgar, B.A., Datar, S.A., 1996. Zygotic degradation of two maternal Cdc25
mRNAs terminates Drosophila's early cell cycle program. Genes Dev. 10,
1966–1977.
Farrell, J.A., O'Farrell, P.H., 2013. Mechanism and regulation of Cdc25/Twine protein
destruction in embryonic cell-cycle remodeling. Curr. Biol. 23, 118–126.
Farrell, J.A., Shermoen, A.W., Yuan, K., O'Farrell, P.H., 2012. Embryonic onset of late
replication requires Cdc25 down-regulation. Genes Dev. 26, 714–725.
Fujikawa, T., Takatori, N., Kuwajima, M., Kim, G.J., Nishida, H., 2011. Tissue-specific
regulation of the number of cell division rounds by inductive cell interaction
and transcription factors during ascidian embryogenesis. Dev. Biol. 355,
313–323.
Hotta, K., Mitsuhara, K., Takahashi, H., Inaba, K., Oka, K., Gojobori, T., Ikeo, K., 2007.
A web-based interactive developmental table for the ascidian Ciona intestinalis,
including 3D real-image embryo reconstructions: I. From fertilized egg to
hatching larva. Dev. Dyn. 236, 1790–1805.
Hudson, C., Kawai, N., Negishi, T., Yasuo, H., 2013. β-Catenin-driven binary fate
specification segregates germ layers in ascidian embryos. Curr. Biol..
Imai, K.S., Hino, K., Yagi, K., Satoh, N., Satou, Y., 2004. Gene expression profiles
of transcription factors and signaling molecules in the ascidian embryo:
towards a comprehensive understanding of gene networks. Development 131,
4047–4058.
Imai, K.S., Levine, M., Satoh, N., Satou, Y., 2006. Regulatory blueprint for a chordate
embryo. Science 312, 1183–1187.
Kane, D.A., Kimmel, C.B., 1993. The zebrafish midblastula transition. Development
119, 447–456.
Kitajima, T.S., Kawashima, S.A., Watanabe, Y., 2004. The conserved kinetochore protein
shugoshin protects centromeric cohesion during meiosis. Nature 427, 510–517.
Kumano, G., Nishida, H., 2007. Ascidian embryonic development: an emerging
model system for the study of cell fate specification in chordates. Dev. Dyn. 236,
1732–1747.
Kumano, G., Takatori, N., Negishi, T., Takada, T., Nishida, H., 2011. A maternal factor
unique to ascidians silences the germline via binding to P-TEFb and RNAP II
regulation. Curr. Biol. 21, 1308–1313.
Kurth, T., 2005. A cell cycle arrest is necessary for bottle cell formation in the early
Xenopus gastrula: integrating cell shape change, local mitotic control and
mesodermal patterning. Mech. Dev. 122, 1251–1265.
Larabell, C.A., Torres, M., Rowning, B.A., Yost, C., Miller, J.R., Wu, M., Kimelman, D.,
Moon, R.T., 1997. Establishment of the dorso-ventral axis in Xenopus embryos
is presaged by early asymmetries in beta-catenin that are modulated by the
Wnt signaling pathway. J. Cell Biol. 136, 1123–1136.
Lasko, P., 2013. Development: new wrinkles on genetic control of the MBT. Curr.
Biol. 23, R65–67.
Lemaire, P., 2009. Unfolding a chordate developmental program, one cell at a time:
invariant cell lineages, short-range inductions and evolutionary plasticity in
ascidians. Dev. Biol. 332, 48–60.
Lu, X., Li, J.M., Elemento, O., Tavazoie, S., Wieschaus, E.F., 2009. Coupling of zygotic
transcription to mitotic control at the Drosophila mid-blastula transition.
Development 136, 2101–2110.
McDougall, A., Chenevert, J., Dumollard, R., 2012. Cell-cycle control in oocytes and
during early embryonic cleavage cycles in ascidians. Int. Rev. Cell Mol. Biol. 297,
235–264.
McDougall, A., Chenevert, J., Lee, K.W., Hebras, C., Dumollard, R., 2011. Cell cycle in
ascidian eggs and embryos. Results Prob. Cell Differ. 53, 153–169.
Miya, T., Nishida, H., 2003. Expression pattern and transcriptional control of SoxB1
in embryos of the ascidian Halocynthia roretzi. Zool. Sci. 20, 59–67.
Murakami, M.S., Moody, S.A., Daar, I.O., Morrison, D.K., 2004. Morphogenesis
during Xenopus gastrulation requires Wee1-mediated inhibition of cell proliferation. Development 131, 571–580.
Negishi, T., Takada, T., Kawai, N., Nishida, H., 2007. Localized PEM mRNA and
protein are involved in cleavage-plane orientation and unequal cell divisions in
ascidians. Curr. Biol. 17, 1014–1025.
Newport, J., Kirschner, M., 1982. A major developmental transition in early Xenopus
embryos: I. characterization and timing of cellular changes at the midblastula
stage. Cell 30, 675–686.
Niehrs, C., Acebron, S.P., 2012. Mitotic and mitogenic Wnt signalling. EMBO J. 31,
2705–2713.
Author's personal copy
342
R. Dumollard et al. / Developmental Biology 384 (2013) 331–342
Nishida, H., 1996. Vegetal egg cytoplasm promotes gastrulation and is responsible
for specification of vegetal blastomeres in embryos of the ascidian Halocynthia
roretzi. Development 122, 1271–1279.
Ogura, Y., Sakaue-Sawano, A., Nakagawa, M., Satoh, N., Miyawaki, A., Sasakura, Y.,
2011. Coordination of mitosis and morphogenesis: role of a prolonged G2 phase
during chordate neurulation. Development 138, 577–587.
Paix, A., Le Nguyen, P.N., Sardet, C., 2011. Bi-polarized translation of ascidian
maternal mRNA determinant pem-1 associated with regulators of the translation machinery on cortical Endoplasmic Reticulum (cER). Dev. Biol. 357,
211–226.
Petersen, C.P., Reddien, P.W., 2009. Wnt signaling and the polarity of the primary
body axis. Cell 139, 1056–1068.
Prodon, F., Chenevert, J., Hébras, C., Dumollard, R., Faure, E., Gonzalez-Garcia, J.,
Nishida, H., Sardet, C., McDougall, A., 2010. Dual mechanism controls asymmetric
spindle position in ascidian germ cell precursors. Development 137, 2011–2021.
Raff, J.W., Glover, D.M., 1988. Nuclear and cytoplasmic mitotic cycles continue in
Drosophila embryos in which DNA synthesis is inhibited with aphidicolin.
J. Cell Biol. 107, 2009–2019.
Rivers, D.M., Moreno, S., Abraham, M., Ahringer, J., 2008. PAR proteins direct
asymmetry of the cell cycle regulators Polo-like kinase and Cdc25. J. Cell Biol.
180, 877–885.
Rothbächer, U., Bertrand, V., Lamy, C., Lemaire, P., 2007. A combinatorial code of
maternal GATA, Ets and beta-catenin-TCF transcription factors specifies and
patterns the early ascidian ectoderm. Development 134, 4023–4032.
Roure, A., Rothbächer, U., Robin, F., Kalmar, E., Ferone, G., Lamy, C., Missero, C.,
Mueller, F., Lemaire, P., 2007. A multicassette Gateway vector set for high
throughput and comparative analyses in ciona and vertebrate embryos. PLoS
One 2, e916.
Royou, A., McCusker, D., Kellogg, D.R., Sullivan, W., 2008. Grapes(Chk1) prevents
nuclear CDK1 activation by delaying cyclin B nuclear accumulation. J. Cell Biol.
183, 63–75.
Sardet, C., McDougall, A., Yasuo, H., Chenevert, J., Pruliere, G., Dumollard, R.,
Hudson, C., Hebras, C., Le Nguyen, N., Paix, A., 2011. Embryological methods
in ascidians: the Villefranche-sur-Mer protocols. Methods Mol. Biol. 770,
365–400.
Satoh, N., 1977. Metachronous cleavage and initiation of gastrulation in amphibian
embryos. Dev. Growth Differ. 19 (2), 111–117.
Satoh, N., Ikegami, S., 1981. A definite number of aphidicolin-sensitive cell-cyclic
events are required for acetylcholinesterase development in the presumptive
muscle cells of the ascidian embryos. J. Embryol. Exp. Morphol. 61, 1–13.
Schierenberg, E., Wood, W.B., 1985. Control of cell-cycle timing in early embryos of
Caenorhabditis elegans. Dev. Biol. 107, 337–354.
Sherrard, K., Robin, F., Lemaire, P., Munro, E., 2010. Sequential activation of apical
and basolateral contractility drives ascidian endoderm invagination. Curr. Biol.
20, 1499–1510.
Shirae-Kurabayashi, M., Matsuda, K., Nakamura, A., 2011. Ci-Pem-1 localizes to the
nucleus and represses somatic gene transcription in the germline of Ciona
intestinalis embryos. Development 138, 2871–2881.
Sibon, O.C., Stevenson, V.A., Theurkauf, W.E., 1997. DNA-replication checkpoint
control at the Drosophila midblastula transition. Nature 388, 93–97.
Skirkanich, J., Luxardi, G., Yang, J., Kodjabachian, L., Klein, P.S., 2011. An essential
role for transcription before the MBT in Xenopus laevis. Dev. Biol. 357, 478–491.
Sung, H., Spangenberg, S., Vogt, N., Großhans, J., 2013. Number of nuclear divisions
in the Drosophila blastoderm controlled by onset of zygotic transcription. Curr.
Biol. 23, 133–138.
Vastag, L, Jorgensen, P, Peshkin, L, Wei, R, Rabinowitz, JD, et al., 2011. Remodeling of
the metabolome during early frog development. PLoS One 6, e16881. (Accessed
3 July 2012).
Von Kries, J.P., Winbeck, G., Asbrand, C., Schwarz-Romond, T., Sochnikova, N.,
Dell'Oro, A., Behrens, J., Birchmeier, W., 2000. Hot spots in beta-catenin for
interactions with LEF-1, conductin and APC. Nat. Struct. Biol. 7, 800–807.
Woodland, H.R., Zorn, A.M., 2008. The core endodermal gene network of vertebrates: combining developmental precision with evolutionary flexibility. BioEssays 30, 757–765.
Yang, J., Tan, C., Darken, R.S., Wilson, P.A., Klein, P.S., 2002. Beta-catenin/Tcfregulated transcription prior to the midblastula transition. Development 129,
5743–5752.
Yu, K.R., Saint, R.B., Sullivan, W., 2000. The Grapes checkpoint coordinates nuclear
envelope breakdown and chromosome condensation. Nat. Cell Biol. 2, 609–615.