Download Direct Sequence Analysis of the 14q+ and 18q

From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
Direct Sequence Analysis of the 14q+ and 18q- Chromosome Junctions in
Follicular Lymphoma
By Finbarr Cotter, Christopher Price, Emanuele Zucca, and Bryan D. Young
Although the t(l4;18) chromosome translocation has been
demonstrated to be a highly consistent feature of follicular
lymphomas, the underlying mechanism generating this
fusion has remained uncertain. To examine this question
further, a polymerase chain reaction strategy has been
devised to permit the amplification and direct sequencing
of the resultant 1 4 q i and 18q- reciprocal junctions.
Direct sequence analysis of amplified 14q+ junctions
established that 7 of 11 tumors contained a bcl-2 (mbr)
sequence fused to an immunoglobulinJ, region (five were
J, and two were J6).One of these junctions had an unusual
configuration with the bcl-2 and J, sequences separated by
a recognizable D, region. This finding suggests that at least
some of the junctional sequences, previously thought of as
N insertions, may be fragments of unrecognizedD, regions.
It was also possible to amplify and sequence 18q- junctions using a primer based on the D, recombination signal
sequences. Several 18q- junctions were shown to consist
of D,lbcl-2 (either mbr or mcr) fusions. In two tumors the
14q and 18q - junctions were fully sequenced, and it was
demonstrated that the bcl-2 sequence was conserved
during mbr and mcr translocations. This contrasts with
previousanalysesthat demonstrated either loss or duplication of several bases at the breakpoints in the bcl-2 gene.
0 1990 by The American Society of Hematology.
+
A
MATERIALS AND METHODS
PPROXIMATELY 85% of follicular lymphomas and
Enzymatic amplification. DNA was extracted as previously
30% of diffuse large cell lymphomas have been demondescribedI4from 11 patients with histologically proven centroblastic/
strated to carry the t( 14;18)(q32.3;q21.3) chromosomal
centrocytic follicular lymphoma. Enzymatic amplication was pertranslocation by both cytogenetic and molecular techniques.’,2
formed by the PCR procedure of Saiki et all5 using Thermus
The breakpoints on chromosome 18 occur a t two sites,
aquaticus (Taq) DNA polymerase and an automated Perkin-Elmer
approximately 20 kilobases (kb) apart, within or near to a
DNA Thermal Cycler (Cetus, Emeryville, CA). The final reaction
transcriptional unit called the bcl-2 gene.2-6Approximately
volume included 1 pg of tumor DNA, oligonucleotide primers (1
60% of the breakpoints occur within 150 base pairs (bp)
mmol/L) (Boehringer Mannheim, FRG), 1.5 U of Taq DNA
known as the “major breakpoint region” (mbr) in a 3’
polymerase (Amplitaq-Cetus),and gelatin (0.01% wt/vol) in 100 r L
untranslated region of the bcl-2
A further 25% have
of Taq buffer (50 mmol/L KC1, 10 mmol/L Tris-C1 pH8.3, 1.5
mmol/L MgCl,). Amplification of the mbr-J, junctions on chromobreakpoints at a site 20 kb 3’ to the mbr sequence in a region
some 14q+ was performed with primers BCl and JH1 and the
called the “minor cluster region” (mcr)2,and these translocaD,-mbr junctions on chromosome 18q- with primers DHI and BC2
tions occur within 500 bp of each other, some clustering
(see Table 1). The mcr-J, junctions on chromosome 14q+ were
within 3 bp on chromosome 18.’ On chromosome 14, the
amplified with primers BC5 and JH1 and the D,-mcr junctions on
breakpoints occur in the joining (J,) region of the immunochromosome 18q- with primers DHI and BC6. An initial denaturglobulin (Ig) heavy chain gene.4-6It has been postulated that
ing step of 10 minutes at 94OC was followed by 30 cycles of 15
the translocation occurs as an error during VDJ joining at a
seconds at 55OC (annealling), 1 minute at 7OoC(extension), and 30
time when terminal deoxynucleotidyl transferase is a ~ t i v e . ~ ’ ~seconds at 94OC (denaturing). The final extension period was
At the junction on chromosome 14q+ short segments of
lengthened to 10 minutes. Taq polymerase (Cetus), 1.5 U was added
to the reaction after the initial denaturing step. Aliquots (10 pL)
unidentifiable nucleotides, up to 24 in length have been
from the reaction mixture were analyzed by electrophoresis in a 2%
observed and postulated to represent “N” insertions noragarose gel in Tris borate electrophoresis (TBE) buffer and stained
mally found at the VD and DJ junctions after IgH
with ethidium bromide.
In the few 18q- chromosomal breakpoints
Direct sequence analysis. Direct nucleotide sequence analysis
~tudied,’.’~
it appears that Ig heavy chain diversity regions
by the dideoxy chain termination method16 was performed on PCR
(DH) are joined to the bcl-2 gene with loss of the 5’ J, region,
products. DNA from the reaction mixture was purified using a
suggesting a deletion between D, and J, in t(14;18) transloSephedex G50 column followed by ethanol precipitation, freeze
cation in lymphomas.’ The translocation results in a hybrid
drying, and resuspension in distilled water. Sequencing was perbcl-2/IgH transcript, but a normal bcl-2 protein, as the
coding region appears to be structurally unaltered. However,
the quantity of protein is increased within the cells containFrom the Imperial Cancer Research Fund, Medical Oncology
ing the t( 14;18) translocation.”,’2
Unit, St Bartholomew’s Hospital, London, UK; and Medical OncolThe clustering of the majority of breakpoints on bcl-2
ogy Department, Ospedale San Giovanni. Bellinrona. Switzerland.
facilitates the use of the polymerase chain reaction (PCR)
Submitted November 20,1989; accepted March 6,1990.
Supported by a grant f r o m the Caroline Lawson Trust f o r
for amplification and analysis of the t ( 14;18) breakpoints.
Children’s Cancer Research.
Bcl-2 oligonucleotide primers (either mbrI3 or mcr’) flanking
Address reprint requests to Finbarr E. Cotter. MD. ICRF
the translocation have been used, with a consensus J,
Medical
Oncology Unit, Si.Bartholomew’s Hospital, London ECI
sequence found at the 3’ end of each J, exon, to amplify the
UK.
14q+ junctions. We have extended this approach to the
The publication costs of this article were defrayed in part by page
18q - junctions using a primer based on part of the recombicharge payment. This article must therefore be hereby marked
nation signal sequences known to flank germline D, se“advertisement” in accordance with 18 U.S.C. section 1734 solely to
quences. Thus, it was possible to sequence junctions proindicate thisfact.
duced by translocations in either the mbr or mcr regions in a
0 1990 by The American Society of Hematology.
series of follicular lymphomas.
0006-4971/90/7601-0022$3.00/0
I
Blood, Vol 76, No 1 (July 1). 1990: pp 131-135
131
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
132
COlTER ET AL
Table 1. Position, Sequence. and Use of Synthetic Oligonucleotidesfor Analysis of t(14;18) Junctions
Orientation
Name
Sequence
Use
Position
(strand)
JH 1
DH 1
BC 1
BC2
BC3
BC4
BC5 ( M C 1 2 )
5'ACCTGAGGAGACGGTGACC-3'
5'-GTGAGGTCTGTGTCACTGTG-3'
5'-CCllTAGAGAGAGlTGCTlTACGT-3'
5'-ATAlTCCATAl-fCATCACmGAG-3'
5'-CACAGACCCACCCAGAGCCC-3'
5'-GTCTGATCAlTCTGlTCCCTG-3'
5'-GATGGCmGCTGAGAGGTAT-3'
PCR
PCR
PCR
PCR
Sequencing
Sequencing
PCR
3' J, consensus
5' flanking region in D,
5' of mbr in bcC2 gene
3' of mbr in bcC2 gene
5' of mbr in bcC2 gene
3' of mbr in bcC2 gene
5' of mcr in bcC2 gene
-
BC6
BC7 (MC7)
BC8
5'-lTAlTGAGTGGTCClTCCTlTC-3'
5'-TCAGTCTCTGGGGAGGAGTGG-3'
5'-TCAlTCAGlTGAGTGCTGTG-3'
PCR
Sequencing
Sequencing
3' of mcr in bc/-2 gene
5' of mcr in bcC2 gene
3' of mcr in bcC2 gene
+
+
+
+
+
-
Oligonucleotides BC5 and BC7 correspond to M C 1 2 and M C 7 used by Ngan et aI.* The heptamer recombination signal is underlined in oligonucleotide
DH 1
formed using bcl-2 internal oligonucleotides as sequencing primers
(Table 1) with the modified T 7 D N A polymerase (Sequenase, USB,
Cleveland, OH), a 5-minute labeling reaction at lS°C, and a
5-minute termination reaction at 3 7 T . The mbr-J, junctions were
sequenced with kinase-labeled aliquots of primer BC3 and the
D,-mbr junctions with primer BC4, the mcr-J, junctions with BC7,
and the D,-mcr junctions with BC8.
problematic, because in the few tumors
a diversity region (D,) has been found fused to bcl-2 sequence.
However, a common feature of diversity regions is that they
are flanked by heptamer-nonamer recombination signal sequences. We have sought to use this feature to design an
oligonucleotide (DH1) for amplification from the chromosome 14 side of the 18q- junction. The full set of primers is
shown in Table 1.
Analysis of mbr junctions in bcl-2. DNA was prepared
from a series of 11 follicular lymphoma samples. Enzymatic
amplification using primers BC1 and JH1 was performed on
each DNA sample, and electrophoresis showed specific
products from 7 of 11 samples (data not shown). Under the
conditions of amplification, normal human DNA yielded no
fragments. Direct sequence analysis using primer BC3 showed
the structure of these products, and the results are summarized in Fig 1. In all cases a fusion was demonstrated between
a bcl-2 sequence and members of the Ig heavy chain joining
RESULTS
The majority of breakpoints on chromosome 18 due to the
t( 14;18) translocation have been shown to occur in either of
two regions within the bcl-2 gene (ie, the mbr or mcr). The
corresponding breakpoints on chromosome 14 have been
shown to occur at or close to members of the J, joining region
genes of the Ig heavy chain locus. The high degree of
clustering of both breakpoints renders the 14q+ junctions
suitable for PCR amplification using either mbrI3 or mcr'
oligonucleotides in combination with a J, consensus oligonucleotide. Similar amplification of the 18q- junction is more
Palien1 A
BCL-2
...=
CCTTCAGGGTCTTCCTGAAATGCA
16
t
~ ~ ~. .G~TTdCTdCTdCTdCTdCGGTdTGGdCGTCTGGGGCCddGGCdCCdCGGTCdCcGTcTcCTCdGG
~.
~
=
Patient B
BCL-2
CTTCCTGAAATGCAGTGGTGCTTA . . . a a a g a c q t c c
JS
. . .CTAC~TCCdC€CCTGCCGCCA~GGAACCCTGGTCdCCGTCTCCTCdGG
Patient D
BCL-2
G C A G G A A A C C T G T G G T A T G A A G C C.
J6
. . ~ . .TGGACATTCTGCCATTGTGATTdCTdCTdCTdCTdCGGTdTGGdCGTCTGGGGCCAAGGGdCCdCGGTCdCCGTCTCCTCdGG
.
Patient E
BCL-2
...t
CCCAGAGCCCTCCTGCCCTCCT~C
Pallent
DH
J6
T g a q t a q a i c a a ~ ~ ~ ~ t t~a ttt d~c q tc t ~
a c . ~. . tTdCTdCTdCTdCTdCGGTdTGGAcGTCTGGGGC~GGWLCCdCGGTCdCCGTCTCCTCdGG
~ ~ = t ~ ~
G
BCL-2
TGGTATGAAGCCAGACCTCCCCGG
16
...g g c t t a q c q q q q c c a t a a c cg g c a . . . CdCCTCTGGGCCCAACGWLCCdCGGTCdCCGTCTCCTCdGG
Patient L
BCL-2
CTGTGGTATGAAGCCAGACCTCCC
15
. . .999 . . .AACG1VLCCCT~TCdCCCTCTCCTCdGG
Patient M
BCL-2
J6
GAAATGCAGTGGTGCTTACGCTCC..99caqcaa..ATTdCTdCT~CTdCTdCGGTdTGGdCGTCTGGGGCCddGGGdCCdCGGTCdCCGTCTCCTCdG
Fig 1. Sequences of the chromosome 14q+ junctions in seven follicular lymphomas. Bcl-2 sequence is shown in upper case and joining
region sequence is in upper case italics, with the coding exons in bold type. Differences between the J, sequences and their germline
equivalents are underlined. The intervening sequences between bcl-2 and J, are indicated in lower case. The part of the intervening
sequence that is identical to a previously identified D, region is underlined (patient E).
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
133
SEQUENCE ANALYSIS 1(14;18) IN FOLLICULAR LYMPHOMA
t-CHROMOSOME14
CHROMOSOME18
+
CCCCGGmCGGTATGGGGAG lTATCGTATATGACCCGTGGCATCTGA. CGGGGGCmCTCATGGCTGTCClTCAGGGTCTT
Fig 2 . The sequence of a chromosome 18q- junction in a follicular lymphoma. The mbr region of bcl-2 is fused to a sequence
containing a region of homology (underlined) to a previously cloned D, sequence." The vertical line indicatesthe junction between the two
chromosomes.
region exons (J,), confirming the presence of the t(14;18)
translocation in these tumors. The breakpoint on bcl-2 fell
within the range of previously determined7 breaks in the mbr
region. There was a clear preponderance (5 of 7) for the J,
member of the J, family. Most of the J, sequences had some
single base differences when compared with their germline
equivalents. This could be due to either polymorphic variation or somatic mutation, which is known to occur during D-J
recombination. In contrast, the bcl-2 sequence showed no
evidence of mutation. In every junction there was an intervening sequence between bcl-2 and J,, although in patient D this
consisted of only a single base. In patient E there was a
particularly large intervening sequence which, on further
analysis, was found to contain a recognizable D, region (Fig
1). The D, (diversity) regions recombine with J, in normal
Ig gene rearrangement; thus, this junction (bcl-2-DH-J,)
could result from translocation after D,-J, recombination.
Thus, this junction consisted of bcl-2 fused to D,, which in
turn was fused to J,. None of the other intervening sequences
had significant homology to each other or to any other known
D, or putative N insertion sequences.
The primer D H l , in combination with the bcl-2 primer
BC2, was used for amplification of the reciprocal junctions
on chromosome 18q-. Although, on electrophoresis, bands
were obtained from tumor samples, direct sequencing was
successful from only a proportion of tumors. Thus, these
bands may represent spurious products, unrelated to the
IgHlbcl-2 junction on chromosome 18. The sequence of an
18q- junction is shown in Fig 2, in which a putative D,
region is fused to the mbr region of bcl-2. In the sample from
patient B, direct sequencing also showed the structure of the
18q- junction, and this has been compared with the 14q+
and normal chromosome 18 sequence in the same tumor in
Fig 3. It is clear that during breakage and rejoining, the bcl-2
gene has been conserved without any of the short duplications or deletions noted by others.'.''
Analysis of mcr junctions in bcl-2. A similar analysis
was performed using oligonucleotide primers for the mcr
region of bcl-2. In a particular patient it was possible to
sequence both the 14q+ and 18q- junction, and the results
are shown in Fig 4. The 14q+ junction is similar to those
reported by other?, with mcr sequence fused to a member of
the J, family. Because the junction is well within the J, exon,
it is not possible to identify uniquely which J, gene is
involved. There is very little (at most a single base) sequence
that could be called an N-insertion, and the breakpoint in
mcr is precisely at a position which has been broken in two
previously analyzed tumors.' The sequence of the reciprocal
18q- junction is also shown in Fig 4, and it is clear, as in Fig
3, that there has been no net loss or gain of bcl-2 sequence.
Furthermore, as with mbr translocations, this junction is
composed of a D, sequence fused to bcl-2.
DISCUSSION
The use of the D,-based primer (DH1) offers a means to
amplify and analyze rapidly a proportion of the 18qjunctions. As a means of detecting the presence of the
t(14;18), it appears to be less efficient than the equivalent
strategy for the 14q+ junctions. Because this approach
requires the presence of the 5' recombination signals next to
the junctional D, exon, lack of amplification may be due to
removal of the 5' recombination signal sequence by a
preceding V,-D, recombination. In addition, the D, primer
includes part of the intervening sequence between the heptamer and nonamer, which will tend to be less conserved.
Although these features may tend to reduce the proportion of
tumors in which the 18q- junctions can be successfully
amplified, it is possible that other strategies, such as the use
of a V, consensus primerL7,might be successful.
Previous studies have shown that the 14q+ junctions are
often characterized by short stretches of unrecognizable
sequences, which, because of their position adjacent to a
joining region, have been thought of as N-insertions. However, there are several features of these sequences that
question this interpretation. Firstly, these translocation Nregions tend to be longer than normal N-region sequences,
which rarely exceed 10 bases and are usually shorter."
Secondly, the normal N-regions are G C rich whereas translocation N-regions are less so.'* Finally, Ngan et ala noted that
two different tumors had an identical stretch of 11 bases in
JH
D
H
Fig 3. The sequences of the reciprocal 14q+ and 18q- junctions found in patient B are compared with the germline mbr region of
bcL2. Gaps in sequence have been introduced for clarity and the underlined region represents a previously unidentified D, region. The
vertical line indicates the position of the breakpoint in the mbr region.
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
134
COTTER ET AL
JH
14q+ junction
GERMLINE BCL2 (mcr)
18q- junction
D
H
Fig 4. Comparison of the reciprocal 14q+ and 18q- sequences in a patient with a translocation breakpoint in the mcr region of bcl-2.
The underlined region represents a previously unidentified D, region. The vertical line indicates the position of the breakpoint within the
mcr region in bcl-2.
their putative N-regions, and speculated that such regions
could be derived instead from previously unrecognized D,
sequences. The tumor from patient E (Fig 1) has been shown
to contain a complete D, sequence within its putative
N-region. This finding supports the idea that at least some of
the putative N-regions could contain fragments of D,
regions. Interestingly, this D, sequence is identical to one
previously shown to be located 150 bases 5’ to a D, involved
in a follicular lymphoma transl~cation.~
Comparison with
this sequence indicates that the germline recombination
signals are missing from the 5’ end of the D, sequence (Fig
1 ), suggesting that either the translocation has occurred as a
mistake in V-D joining with a subsequent N insertion, or that
V-D-J recombination had taken place before translocation.
The former explanation has been invoked to explain a
translocation in the Daudi Burkitt lymphoma cell line as a
mistake in V-D joining with the D-J already rearranged.’’
The latter course of events has been proposed” to account for
a t(8;22) translocation in Burkitt’s lymphoma in which the Ig
X light chain complex was thought to be rearranged before
translocation.
The underlying mechanism that generates the t( 14;18)
translocation has been the subject of some debate. It has been
suggested that the translocation occurs as a result of mistakes in VDJ recombination. This is based on the presence of
sequences on chromosome 18 close to some breakpoints,
which bear a similarity to the heptamer-nonamer signal
sequences mediating VDJ recombination.’ However, the
homology is weak and breakpoints are not always associated
with such sequences. Also, if this mechanism were operative
the reciprocal set of recognition signals with a 23-bp spacer
would be expected within mbr, and these have not been
found.’ An alternative explanation for the breakage of bcl-2
that does not depend on the presence of heptamer-nonamer
signal sequences has been proposed. Bakhshi et a17 analyzed
the reciprocal junctions of a follicular lymphoma and noted a
3-bp duplication at the junction. It was proposed that this
could be the result of a staggered double-stranded break of
the type known to result in direct repeats flanking the
insertion of foreign DNA. However, subsequent analysis of
two tumors” has shown small deletions, rather than duplications, of bcl-2 sequence at junctions. Moreover, in our study
both tumors analyzed showed conservation of bcl-2 sequence,
and therefore the duplication of junctional bcl-2 sequence is
not a general feature of the t(14;18) translocation.
Interestingly, the breakpoint in mbr on chromosome 18 for
patient B is at a location identical to that found in a tumor
analyzed by Tsujimoto et a1” in which a deletion of 2bp had
occurred. This effectively rules out the possibility that the
gain or loss of bcl-2 sequence is, in some way, dependent on
the position of the breakpoint. The analysis of the reciprocal
junctions for the translocation in mcr (Fig 4) showed a
similar structure to that found in mbr breakpoints. In
particular, the fusion of a D, to mcr sequence forming the
18q- junction has the same configuration as that found in
mbr translocations. This suggests that similar mechanisms
are involved in mcr translocations. This breakpoint lies at
exactly the position of two previously analyzed breaks in
mcr8 which themselves were part of a tight cluster of five
breaks within 4 bases of each other. An interesting feature of
this cluster is that it is bounded by two direct repeats
(CTGCAAAC) 7 bases apart. Although the underlying
mechanism for the t( 14;18) translocation in follicular lymphoma remains unclear, similar factors appear to operate for
breaks in both the mbr and mcr regions. Our sequence data
suggest that, at least in some cases, it is possible that
translocation has taken place after D-J rearrangement.
ACKNOWLEDGMENT
The authors gratefully acknowledge the advice of G . Phear in
performing direct sequencing; the synthesis of oligonucleotides by I.
Goldsmith; and the clinical support of T.A. Lister.
REFERENCES
1. Yunis JJ, Oken MM, Kaplan ME, Ensrud KM, Howe RR,
Theologides A: Distinctive chromosomal abnormalities in histologic
subtypes of non-Hodgkin’s lymphomas. N Engl J Med 307:1231,
1982
2. Weiss LM, Warnke RA, Sklar J, Cleary ML: Molecular
analysis of the t( 14;18) chromosomal translocation in malignant
lymphomas. N Engl J Med 317:1185, 1987
3. Cleary ML, Sklar J: Nucleotide sequence of a t(14;18)
chromosomal translocation breakpoint in follicular lymphoma and
demonstration of a breakpoint cluster region near a transcriptionally
active locus on chromosome 18. Proc Natl Acad Sci USA 82:7439,
1985
4. Cleary ML, Galili N, Sklar J: Detection of a second t(14;18)
breakpoint cluster region in follicular lymphomas. J Exp Med
164:315, 1986
5. Bakhshi A, Jensen JP, Goldman P, Wright JJ, McBride OW,
Epstein AL, Korsmeyer SJ: Cloning the chromosome breakpoint of
t( 14;18) human lymphomas: Clustering around J, on chromosome
14 and near a transcriptional unit on 18. Cell 41:899, 1985
6. Tsujimoto Y, Cossman J, Jaffe E, Croce CM: Involvement of
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
SEQUENCE ANALYSIS
T( 14: 18)
IN FOLLICULAR LYMPHOMA
the bcl-2 gene in human follicular lymphomas. Science 228: 1440,
1985
7. Bakhshi A, Wright JJ, Graninger W, Seto M, Owens J,
Cossman J, Jensen JP, Goldman P, Korsmeyer SJ: Mechanism of
the t( 1438) chromosomal translocation: Structural analysis of both
derivative 14 and 18 reciprocal partners. Proc Natl Acad Sci USA
84:2396, 1987
8. Ngan B-Y, Nourse J, Cleary ML: Detection of chromosomal
translocation t(14;18) within the minor cluster region of bcl-2 by
polymerase chain reaction and direct genomic sequencing of the
enzymatically amplified DNA in follicular lymphomas. Blood 73:
1759,1989
9. Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM: The
t( 14;18) chromosome translocations involved in B-cell neoplasms
result from mistakes in VDJ joining. Science 229:1390, 1985
10. Tsujimoto Y, Louie E, Bashir MM, Croce CM: The reciprocal partners of both the t(14;18) and t(l1;14) translocations involved
in B-cell neoplasms are rearranged by the same mechanism. Oncogene 2:347,1988
11. Cleary ML, Smith SD, Sklar J: Cloning and structural
analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin
transcript resulting from the t(l4;18)translocation. Cell 47:19, 1986
12. Ngan BY, Chen-Levy Z, Weiss LM, Warnke RA, Cleary
ML: Expression in non-Hodgkin’s lymphomas of the bcl-2 protein
associated with the t( 14;18) chromosomal translocation. N Engl J
Med 318:1638, 1988
13. Lee M-A, Chang K-K, Cabanillas F, Freireich EJ, Trujillo
135
JM, Stass SA: Detection of minimal residual cells carrying the
t(14;18) by DNA sequence amplification. Science 237:175, 1987
14. Cotter FE, Hall PA, Young BD: Extraction of DNA from
small sections of frozen tissue with simultaneous histological examination. J Clin Pathol41:1125, 1988
15. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R,
Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science
239:487, 1988
16. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 745463,
1977
17. Ward ES, Gussow D, Griffiths AD, Jones PT, Winter G:
Binding activities of a repertoire of single immunoglobulin variable
domains secreted from E coli. Nature 341544, 1989
18. Roth DB, Chang X-B, Wilson JH: Comparison of filler DNA
at immune, nonimmune and oncogenic rearrangements suggests
multiple mechanisms of formation. Mol Cell Biol9:3049, 1989
19. Haluska FG, Tsujimoto Y , Croce CM: The t(14;18)
chromosome translocation of the Burkitt lymphoma cell line Daudi
occurred during immunoglobulin gene rearrangement and involved
the heavy chain diversity region. Proc Natl Acad Sci USA 84:6835,
1987
20. Showe LC, Moore RCA, Erikson J, Croce CM: MYC
oncogene involved in a t(8;22) chromosome translocation is not
altered in its putative regulatory regions. Proc Natl Acad Sci USA
84:2824, 1987
From www.bloodjournal.org by guest on August 3, 2017. For personal use only.
1990 76: 131-135
Direct sequence analysis of the 14q+ and 18q- chromosome junctions
in follicular lymphoma
F Cotter, C Price, E Zucca and BD Young
Updated information and services can be found at:
http://www.bloodjournal.org/content/76/1/131.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.