Download Conserved BK Channel-Protein Interactions Reveal Signals

Conserved BK Channel-Protein Interactions Reveal
Signals Relevant to Cell Death and Survival
Bernd Sokolowski1*, Sandra Orchard2., Margaret Harvey1., Settu Sridhar3, Yoshihisa Sakai1
1 Otology Laboratory, Department of Otolaryngology – Head and Neck Surgery, University of South Florida, College of Medicine, Tampa, Florida, United States of America,
2 European Molecular Biology Laboratory, European Bioinformatics Institute, Wellcome Trust Genome Campus, Cambridge, United Kingdom, 3 Department of Informatics,
University of Bergen, Bergen, Norway
Abstract
The large-conductance Ca2+-activated K+ (BK) channel and its b-subunit underlie tuning in non-mammalian sensory or hair
cells, whereas in mammals its function is less clear. To gain insights into species differences and to reveal putative BK
functions, we undertook a systems analysis of BK and BK-Associated Proteins (BKAPS) in the chicken cochlea and compared
these results to other species. We identified 110 putative partners from cytoplasmic and membrane/cytoskeletal fractions,
using a combination of coimmunoprecipitation, 2-D gel, and LC-MS/MS. Partners included 14-3-3c, valosin-containing
protein (VCP), stathmin (STMN), cortactin (CTTN), and prohibitin (PHB), of which 16 partners were verified by reciprocal
coimmunoprecipitation. Bioinformatics revealed binary partners, the resultant interactome, subcellular localization, and
cellular processes. The interactome contained 193 proteins involved in 190 binary interactions in subcellular compartments
such as the ER, mitochondria, and nucleus. Comparisons with mice showed shared hub proteins that included N-methyl-Daspartate receptor (NMDAR) and ATP-synthase. Ortholog analyses across six species revealed conserved interactions
involving apoptosis, Ca2+ binding, and trafficking, in chicks, mice, and humans. Functional studies using recombinant BK
and RNAi in a heterologous expression system revealed that proteins important to cell death/survival, such as annexinA5, cactin, lamin, superoxide dismutase, and VCP, caused a decrease in BK expression. This revelation led to an examination of
specific kinases and their effectors relevant to cell viability. Sequence analyses of the BK C-terminus across 10 species
showed putative binding sites for 14-3-3, RAC-a serine/threonine-protein kinase 1 (Akt), glycogen synthase kinase-3b
(GSK3b) and phosphoinositide-dependent kinase-1 (PDK1). Knockdown of 14-3-3 and Akt caused an increase in BK
expression, whereas silencing of GSK3b and PDK1 had the opposite effect. This comparative systems approach suggests
conservation in BK function across different species in addition to novel functions that may include the initiation of signals
relevant to cell death/survival.
Citation: Sokolowski B, Orchard S, Harvey M, Sridhar S, Sakai Y (2011) Conserved BK Channel-Protein Interactions Reveal Signals Relevant to Cell Death and
Survival. PLoS ONE 6(12): e28532. doi:10.1371/journal.pone.0028532
Editor: Stuart E. Dryer, University of Houston, United States of America
Received November 7, 2011; Accepted November 9, 2011; Published December 9, 2011
Copyright: ß 2011 Sokolowski et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by the National Institutes of Health/National Institute on Deafness and Other Communication Disorders Grant R01DC004295
to BS (http://www.nidcd.nih.gov/Pages/default.aspx). SO is supported by the European Commission under PSIMEx, contract number FP7-HEALTH-2007-223411
http://www.psimex.org/. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]
. These authors contributed equally to this work.
The molecular mechanisms that regulate BK channel behavior
in the cochlea remain unclear. In the mammalian cochlea, BK
channels are localized basally in synaptic zones of inner (IHC) and
outer hair cells (OHC) and extrasynaptic zones located near the
apical portion of IHCs [6]. In non-mammals, BK channels are
found in close proximity to voltage-gated Ca2+ channels, where
they facilitate frequency tuning [7]. BK channels are involved in
noise-induced hearing loss [8], potentially through activation of
ROS pathways by the BK channel and associated proteins like
SOD, glutathione peroxidase, and GSTm [9]. The past decade has
revealed an unexpected number of protein-protein interactions
that basically modify our view of the localization and functional
association of previously identified intracellular proteins. The
functional interactions of BK channels with their associated
proteins are no exception. The pore-forming and C-terminus
domains of BK contain several protein kinase and phosphatase
binding motifs that associate with a number of partners to regulate
channel gating and signaling pathways. These effectors include
Introduction
BK channels are involved in a diversity of physiological
processes such as metabolism, signaling, phosphorylation, regulation of neurotransmitter release, and modulation of smooth
muscle contractions (reviews in [1]). They are activated by the
cooperative effects of two distinct stimuli, membrane depolarization and the elevation in concentration of free cytoplasmic Ca2+.
The channels assemble as tetramers of pore-forming a-subunits,
with the enclosing transmembrane topology (S1, S2, S3, S4)
responsible for sensing voltage changes and the pore forming loop
structure (S5, S6) conducting K+ ions [2]. In addition to the
transmembrane domains, the BKa subunit has an extensive
cytoplasmic C-terminus (S7, S8, S9, S10), containing many
phosphorylation sites [3,4], two K+ conducting regulator (RCK1
and RCK2) domains, a string of aspartate residues known as the
Ca2+ bowl, and leucine zipper, heme, and caveolin binding motifs
(reviews in [5]).
PLoS ONE | www.plosone.org
1
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
spectra were acquired for each scan and prior precursors were
excluded for 60 s.
DataAnalysis software (v. 3.4 Bruker Daltonic GmBH, Bremen,
Germany) was used to generate peaklists. Sequences were assigned
using the MASCOT search engine (v.2.1.03, Matrix Science,
Boston, MA) against the National Center for Biotechnology
Information non-redundant database (NCBInr 2006.12.05) selected for bony vertebrates (276,256 entries). The details included
accession number, MASCOT score, number of peptides matched,
molecular weight, sequence coverage, e-value, delta, score, rank,
charge, number of missed cleavages, p value, and peptide
sequences. Precursor mass tolerance was 62.5 Da (monoisotopic)
and fragment ion tolerance was 60.8 Da (monoisotopic). No fixed
modifications were selected and variable modifications consisted of
carbamidomethylation (C), carboxymethylation (C) and oxidation
(M). A maximum of two missed tryptic cleavages was allowed.
Peptide assignments were manually verified by inspection of the
tandem mass spectra and consistency with expected gas phase
fragmentation patterns. Scaffold (v. 01 07 00, Proteome Software,
Portland, OR) was used to validate MS/MS peptides and for
protein identification (ID). A 95% confidence level was assigned
for the score values of individual spectra and peptides were
selected as specified by the Peptide Prophet algorithm. In addition,
a false discovery rate was determined for the obtained spectra by
sampling the file against a reversed database of bony vertebrates
using Scaffold for the analysis.
cAMP-dependent protein kinase A (PKA), c-Src, proline-rich
tyrosine kinase 2 [5], cGMP-dependent PKG [10], PKC [11], and
Ca2+-dependent phospholipid-binding protein [12]. Moreover, the
BK leucine zipper region serves as an anchor for the regulation of
BK by a PKA-associated complex [5].
To define and compare BK cellular functions, we performed a
highly sensitive mass spectrometry analysis of BK complexes
isolated from chick cochlea, followed by validation using reciprocal
coimmunoprecipitations (coIPs), bioinformatics, and BK/BKAP
functional associations using partial knockdown by siRNAs.
Conservation of chick BKAPs was phylogenetically compared
with mouse [9] and other vertebrate and non-vertebrate data, by
using interactome and ortholog analyses. Major hubs in the BK
interactome suggested novel insights into BK-partners, pathways,
and cellular processes. Here, we report that there is some overlap
in BKAPs found in mouse and chicken. Moreover, BK is involved
with proteins and pathways of a survival/apoptotic nature. Some
of these proteins are conserved phylogenetically and likely serve a
purpose related to the mediation of cell death and/or survival.
Materials and Methods
Ethics Statement
Experiments described herein were approved by the University
of South Florida Institutional Animal Care and Use Committee
(Protocols 3931R, 3482R) as set forth under the guidelines of the
National Institutes of Health.
Database Analyses
Coimmunoprecipitation and 2-D gels
The search for additional proteins (i.e., secondary) that interact
with primary BKAPs was performed using the Envision tool (www.
ebi.ac.uk/enfin-srv/envision) to search the molecular interaction
database IntAct (www.ebi.ac.uk) [13], a central repository of
manually curated literature data generated by many different
experimental techniques. Colocalization data (e.g., cosedimentation) were not included in the final results. Interaction networks
were visualized, modeled, and analyzed using Cytoscape (www.
cytoscape.org) [14]. Proteins in the network were labeled
according to UniProtKB nomenclature and color-coded according
to the fraction from which they were obtained (membrane/
cytoskeleton vs. cytoplasmic) as well as the database (i.e., IntAct)
and subcellular localization.
A total of 12 cochleae were excised from 15 day-old chicks
(Gallus gallus) and sonicated in lysis buffer supplemented with
protease/phosphatase inhibitors, as described previously [9].
Isolation of the membrane/cytoskeletal fraction was accomplished
by centrifuging the lysate at 100 k6g for 1 h at 4uC, removing the
cytosolic fraction, and solubilizing the pellet with 1% ASB-14
(Calbiochem), which proved to be the most effective in isolating
membrane proteins [9]. Fractions were pre-cleared briefly with
protein G beads (Invitrogen) and each fraction was set aside for
analyses of the total and BK-immunoprecipitated proteomes.
Controls for the latter included the use of an irrelevant antibody of
the same type (polyclonal antibody to vesicular stomatitis virus,
Bethyl Laboratories, Montgomery, TX) and unbound beads.
Immunoprecipitation using a polyclonal antibody to BKa
(Chemicon, Temecula, CA) was performed using the immunocomplex-capture method, as described previously [9]. Briefly, after
capture, beads were washed several times and complexes eluted
for subsequent isoelectric focusing (IEF) using pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad, Hercules, CA). Proteins
were fractionated in the second dimension by SDS-PAGE with
12% gels, Coomassie-stained, and molecular weights approximated using Precision Plus (Bio-Rad) as the protein standard. Spot sets
were processed, compared and selected for analysis as described
previously [9]. Results from at least two of four replicate
experiments were sent for MS analysis.
Clusters of Orthologous Groups Analyses
Primary and secondary BKAP interactions, for both chicken
and our recently published mouse data [9], were analyzed for their
conservation of interacting Clusters of Orthologous Groups
(iCOGs) across six eukaryotic species including, E. cuniculi, S.
cerevisiae, A. thaliana, C. elegans, D. melanogaster, and H. sapiens. Protein
IDs in UniProt nomenclature were converted to their corresponding euKaryotic Orthologous Group ID (KOG_ID) by searching
the STRING (string-db.org/) database. If either or both proteins
of a pair were not identifiable by a KOG, they were removed from
the list. Each KOG_ID, of an interacting protein pair, was used to
search the NCBI KOG protein database, for a corresponding
KOG cluster [15] using BLASTO [16]. The database was
searched for the presence/absence of each KOG_ID among the
aforementioned six species and a matrix table generated to
determine conservation. Values were assigned as follows: 0 if
neither of the pair was found, 0.5 if one of the pair was found, and
1 if both members were present. Scores for all six species were used
as input to generate three dendrograms (chick, mouse, chick/
mouse interologs) using R language to geneate a heatmap (http:
//www2.warwick.ac.uk/fac/sci/moac/students/peter_cock/r/
heatmap).
Mass Spectrometry
Tandem mass spectrometry sequencing was achieved using an
Agilent Technologies (Santa Clara, CA) 1100 liquid chromatograph coupled to an HCT Ultra mass spectrometer (Moffitt
Proteomics Facility, Moffitt Cancer and Research Center, Tampa,
FL), as described previously [9]. Briefly, peptides were captured
and analyzed using 5 mm SB-Zorbax C-18-packed columns on an
Agilent Protein ID Chip (G4240-62002). Samples were loaded at
the rate of 4 ml/min followed by LC-MS/MS at 300 gl/min. Five
PLoS ONE | www.plosone.org
2
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
Reciprocal Coimmunoprecipitation
BKAP siRNA Studies
This procedure was accomplished using chick cochleae as
described previously [17], with the appropriate antibody (Table
S1) to 14-3-3c, annexin A5 (Anxa5), CTTN1, glucose-related
protein 78 (GRP78), hippocalcin1 (Hpcal1), heat shock protein
(HSP) 60, 70, and 90, lamin A (LMNA), lin-7 homolog C (Lin7c),
PHB, ras-proximate 1 (RAP1), synaptosomal-associated protein 25
(SNAP25), superoxide dismutase 1 (SOD1), VCP, and STMN.
Briefly, 2.5–6 mg of antibody was used in the immunocomplexcapture technique. Immunocomplexes were eluted from protein G
beads by heating at 70uC for 10 min in sample buffer (SigmaAldrich, St. Louis, MO). Following fractionation on 10% SDSPAGE gels and transfer to nitrocellulose membrane (Protran BA;
Schleicher & Schuell, Keene, NH), blots were probed with an antiBKa polyclonal antibody (Chemicon) at 1:275, followed by
donkey anti-rabbit HRP-conjugated secondary antibody at
1:5000 (Amersham, Piscataway, NJ). The positive control
consisted of immunoprecipitating BK using 6 mg of anti-BK
antibody, whereas negative controls included preadsorption of
antibody with antigen and uncomplexed beads. Immunoreactive
bands were developed using enhanced chemiluminescence (ECL;
Amersham) and Magic Mark XP (Invitrogen, Carlsbad, CA) was
used as the protein standard to estimate relative mobilities.
Six mg of a polyclonal anti-BK antibody (Chemicon) was used to
coIP Akt1, GSK3b, or PDK1. To probe for Akt1, a western blot
was performed with a rabbit monoclonal anti-Akt1 antibody at
1:1000 followed by a mouse anti-rabbit secondary antibody (Cell
Signaling Technology, Beverly, MA) at 1:2000. GSK3b immunoblotting was performed with an anti-GSK3b antibody at 1:1000
followed by a monoclonal anti-rabbit light-chain-specific secondary antibody (Jackson ImmunoResearch, West Grove, PA) at
1:5000. PDK1 immunoblotting was performed with an anti-PDK1
antibody at 1:750 followed by the same secondary used for
GSK3b at 1:5000. Additionally, each of these three proteins was
immunoprecipitated for comparison to the coIP using BK. To
immunoprecipitate each protein Akt1, GSK3b, and PDK1 were
used in amounts of 0.52, 12, and 5 mg, respectively, followed by a
western blot as described above. The same amounts were used for
a reciprocal coIP of BK followed by immunoblotting with an antiBK antibody at 1:150 followed by a donkey anti-rabbit HRPconjugated secondary antibody at 1:5000 (Amersham).
Prior to initiating these experiments, a manual review of the
literature showed that partial knockdown of these RNAs was not
lethal to the cell. RNAi experiments used custom-designed siRNAs
to target endogenous 14-3-3c, Anxa5, c-actin, LMNA, VCP,
SOD, Akt1, PDK1, and GSK3b (Stealth Select RNAi, Invitrogen). Negative controls consisted of scrambled RNAs (scRNA) for
low-, medium-, and high-GC content RNAi. Transfections were
performed using 8 ml/plate of Lipofectamine2000 (Invitrogen),
1 mg of HA-tagged cSlo/pcDNA 3.1 and pooled siRNAs of
300 nM 14-3-3c, Akt1, Anxa5, c-actin, and GSK3b, or 450 nM
LMNA, SOD1, VCP, and PDK1. SiRNAs were mixed in a 1:1:1
ratio targeted to the sense strands (59-39, Table S1). scRNAs were
transfected in a similar manner using equal concentrations. Cells
were harvested and processed for electrophoresis and immunoblotting as described previously [9].
Results
Proteomic analysis of BKAPs and reciprocal coIP
verification
BKAPs were identified from chick membrane/cytoskeletal and
cytoplasmic fractions using BK co-IP, 2-D gel electrophoresis, and
LC-MS/MS analysis. This procedure involved the removal of
non-specific binding proteins, and isolation of BKAPs with
controls using non-immunoprecipitated matrix assays and irrelevant antibody of the same type [9]. Different fractionated protein
extracts of chick cochleae were resolved across a broad range of
pH and weights by 2D gel electrophoresis for both immunoprecipitated and non-immunoprecipitated gels. BK-immunoprecipitated 2D gels had a high gel-to-gel reproducibility with a total of
73 discrete spots from membrane/cytoskeleton fractions and 52
from cytoplasmic fractions (Figure 1A, 1B). Non-immunoprecipitated gels, which reflected the total cochlear proteome, showed a
total of 253 and 196 features from membrane/cytoskeletal and
cytoplasmic fractions, respectively, including minor variants
(Figure S1A, S1B). Comparisons of total proteome with BKimmunoprecipitated gels revealed that nearly 32.4% and 29% of
the protein spots were contributed from membrane/cytoskeletal
and cytoplasmic fractions, respectively. In contrast, 2-D gel
electrophoresis of matrix and antibody specificity controls showed
no protein spots (Figure S1C–F), inferring that our immunoprecipitation assay had few if any false positive proteins.
Our approach to identifying proteins with high confidence from
their peptide matches was defined in two steps: 1) proteins identified
by MS had a molecular weight variance of 65 kDa between
observed (gel) and theoretical (MS) and 2) protein ID was dependent
on a minimum of four peptide sequences with MASCOT score
values greater than 150 [18]. Consequently, from the original 663
unique proteins assessed by Scaffold, there remained a total of 60
and 50 distinct proteins from membrane/cytoskeletal and cytoplasmic fractions, respectively. These final numbers excluded protein
duplication, of which ,10 proteins were common to both fractions
and included actin cytoplasmic-2, c-enolase, and HSP70, among
others. From these 110 proteins, 91 (82.7%) had $7 peptides and 99
(94.3%) had a MASCOT score $200 with $7% sequence coverage
(Table S2A, S2B). A comparison of the chick 2D-gel profile with
that of the previously published mouse profile [9] revealed an
overlapping, but not identical pattern. Thirty-seven percent of the
BKAPs are common to both chick and mouse, while the remaining
63% are novel to chick. These results further confirm that our
fractionated 2D-gel proteome profile did not identify any protein G
Sepharose sticky proteins. The Scaffold reverse database approach
was used to determine the false-positive discovery rate, which was
HA-tagging of a BKa Splice Variant from Chick Cochlea
A tandem hemagglutinin- (HA) tagged cSlo1 (a-subunit, DEC
type, Acc. No. U23821) vector was constructed using pcDNA3.1cSlo1 as a PCR template. The forward primer, 59-CGCGGATCCACCATGGGAT ACCCTTACGACGTTCCTGATTACGCTTACCCTTACGACGTTCCTGATTACGCTATGAGTAACAATATCAACGCCAA-39, included a BamHI (59) site and a
tandem HA-tagged sequence for linkage to the N-terminus of BKDEC. The reverse primer, 59- CGCGGATCCCCTGAGTTC
TCCACCAAATGT-39, was set for the cSlo1 BamHI site. PCR
(MJ Thermocycler, Bio-Rad) was accomplished using Taq DNA
polymerase (Invitrogen) under the following conditions: 94uC for
2 min, 35 cycles at 94uC for 30 sec, 55uC for 30 sec, 68uC for
2 min, and a final cycle at 72uC for 10 min. The PCR product
was purified (PCR Purification Kit, QIAGEN, Valencia, CA) and
cut with BamHI (New England Biolabs, Ipswich, MA) at 37uC
overnight. This fragment was gel-purified (StrataPrep DNA gel
extraction kit, Stratagene, Santa Clara, CA) and ligated to the
BamHI site of pcDNA3.1-cSlo1 using T4 ligase (Roche, Indianapolis, IN). All primers were acquired from Integrated DNA
Technologies (San Diego, CA).
PLoS ONE | www.plosone.org
3
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
Figure 1. BK interactions resolved by two-D gel electrophoresis and reciprocal coIP. (A,B) Chick membrane/cytoskeletal and cytoplasmic
fractions show 60 and 50 distinct numbered spots from the immunoprecipitated gels that were subjected to LC-MS/MS analysis. Regions delimited by
ovals represent proteins common to both fractions. (C), Sixteen representative examples of BKAP reciprocal coIPs (lane 2; +, 2) and BK IPs (lane 3;
+,2) reveal immunoreactive peptide species of ,90 or 120 kDa for BK in chick cochlea. The negative control in which anti-BK antibody was
preadsorbed with peptide, did not produce immunoreactive bands for either the BKAP reciprocal coIPs (lane 5; +,+) or the BK IPs (lane 6; +,+). The
55 kDa bands correspond to heavy immunoglobulin (IgG), resulting from cross-reactivity or the use of antibodies of the same clonality. Bead controls
consisted of lysate mixed with protein G beads without antibody (lanes 4 and 7; 2,2). Lane ‘‘M’’ is the molecular weight marker.
doi:10.1371/journal.pone.0028532.g001
,0.5% for all sequence collections. The assigned sequences had
both b and y ions present in the tandem mass spectra and there
were#three modifications on the peptide. Moreover, none of the
proteins identified in the reverse database achieved the MASCOT
cutoff score set as a positive ID.
To corroborate the results obtained by the LC-MS/MS
approach, we selected 16 representative examples of BKAPs and
confirmed their BK association by reciprocal coIP (Figure 1C),
using commercially available antibodies. Some of these proteins
associate with BK in other systems, whereas others are new
associations. All BKAPs were able to coIP a protein that was
comparable to an IP of BK at ,90 or 120 kDa, depending on the
splice variant [19], while pre-adsorption controls were clean.
PLoS ONE | www.plosone.org
Biological properties and functional composition of BK
interaction networks
Protein-protein interaction networks complemented our original
proteomic data. Secondary interactors with primary BKAPs were
identified using the IntAct [13] database, since evidence of
multiple interactions, as found in IntAct, support high confidence
interaction [20]. To accomplish these analyses, murine (Mus
musculus) interologs in the database were used, due to a lack of
available chick interaction data. Interolog mapping, that is, the
transfer of interaction annotation from one organism to another
using comparative genomics, is an accepted technique in cases
where there is limited or no data on the organism of interest,
enabling the expansion of an interaction network. While it is
4
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
(13.3%, 14%) trafficking/scaffolding (20%, 6%), phosphorylation
(6.7%, 16%), transport (3.3%, 8%), and transcription/translation
(1.7%, 0%).
accepted that these secondary interactors can only be regarded as
predictions, there is good evidence that protein–protein interactions can be transferred when a pair of proteins has a joint
sequence identity .80% [21]. Therefore, it is reasonable to expect
that the majority of these interactions will be conserved between
mouse and chicken.
This search resulted in a total of 193 proteins involved in 190
binary interactions, including complementary A-B and B-A
interactions, when limiting the search to only those interactions
classified as physical, thus, excluding cosedimentation (i.e.,
colocalization) data (Table S3). Visualization with Cytoscape
[14] shows that the majority of proteins (61.5%) is linked and
forms one large interaction network (Figure 2A). The remaining
38.5% are dispersed among 18 smaller networks with fewer than
19 nodes (Figure 2B). The larger global network has 8 major hubs,
containing a central protein connected to six or more partners,
some of which are linked to the larger global network. Four of
these tightly linked hubs can have a role in apoptosis, including
transitional ER (TER) ATPase (aka VCP), ATP synthase b protein
SET, and protein kinase Ce [22–25]. Three major hubs contribute
to neuronal function and include serine/threonine protein
phosphatase 1a, NMDA receptor, and nucleoside diphosphate
kinase [26–28], while the remaining hubs, Na/K-transporting
ATPase a-1 and calmodulin [29,30] are involved in metabolic
processes and Ca2+ binding, respectively (Figure 2B, 2C). Nearly
23% of these binary interactions are common to both chick and
mouse and contain two major hubs, ATP synthase and NMDAR
(Figure 2C).
BKAPs were classified according to prior ion channel
associations, subcellular localization, and cellular processes
(Figure 3A–C; Table S4). To better determine BKAP involvement
with other ion channels, we manually mined curated literature
annotations (Figure 3A). These data reveal that for both
membrane/cytoskeletal and cytoplasmic fractions, ,76% of
BKAPs have a prior association with various types of ion channels,
whereas the remaining 24% are novel protein-ion channel
interactions. These data do not reflect the previous interactions
reported in mouse [9]. The majority of BKAP interactions are
with Ca2+ (30%, 26%) and K+ (10%, 24%) channels. Remaining
interactions for each respective membrane vs. cytoplasmic
fractions are in descending order, BK (6.7%, 10%), TRP (10%,
6%), Na+ (6.7%, 4%), voltage-dependent anion channel (VDAC)
(10%, 0%), Cl2 (3.3%, 4%), and nucleic acid (0%, 2%).
Primary BKAPs were consigned to a subcellular compartment
based on information from Swiss-Prot and GoPubMed databases
(Figure 3B; Table S4). The majority are membrane (30%) and
cytoplasmic (46%) proteins, whereas 18.3% and 16% are localized
to the mitochondrial membrane and matrix, respectively. The
second major compartment determined for each fraction was the
Golgi (10%, 10%), followed by proteins related to the ER (15%,
4%), cytoskeleton and microtubules (13.3%, 6%), and nucleus
(5%, 10%). The fewest number of BKAPS were secretion- (3.3%,
4%), ribosomal- (3.3%, 2%), and endosomal-related (1.7%, 2%).
These results support our previous findings [9], especially in
regard to mitochondrial associations, suggesting evolutionary
conservation in avia and mammals.
BKAPs were classified according to their cellular processes by
manual data mining of PubMed literature annotations and Gene
Ontology databases (Figure 3C, Table S4). BKAPs were associated
with eight specific cell processes. From both membrane/
cytoskeletal and cytoplasmic fractions, a majority of proteins were
involved in signal transduction- (33.3%, 14%) and metabolism(11.7%, 24%) related processes, while remaining proteins were
consigned to development/differentiation (10%, 18%), apoptosis
PLoS ONE | www.plosone.org
Conservation of interactions
To further determine the conservation of primary/secondary
BK interactions, we constructed a phylogenetic profile using data
from chick and the previously published dataset for mouse [9]
(Figure 4A–C). The binary interaction datasets from an IntAct
analysis of chick (199) and mouse (256) totals 455, of which we
were able to assign each member of 303 interacting pairs a
KOG_ID, available via the STRING database. Of the 303
interacting pairs, 48 are common to both chick and mouse,
whereas 66 and 141 are present in chick and mouse, respectively.
A phylogenetic profile of iCOGs was generated, using the six
different species available at the NCBI KOG, to determine which
binary interactions are conserved in both chcicken, mouse, and
their interologs (Figure 4; Table S5A–C). Results of a matrix
cluster analysis, plotted as dendrograms, showed that one or both
KOGs of a pair was primarily absent in non-vertebrates such as E.
cuniculi, S. cerevisiae, and A. thaliana. Additionally, these plots show
distinctly conserved clusters of iKOGs with a common function,
numbered 1–6; clusters of protein pairs with disparate functions
are not numbered. The most conserved functional iKOGs across
all six species are 2 (chick only) and 4 (mouse only), which are
composed of Ca2+-binding/chaperonins and trafficking/scaffolding proteins, respectively (Figure 4A–C). Moreover, cluster 2
shares protein pairs common to both chick and mouse, while
cluster 4 is composed of different pairs of proteins for both of these
species (Figure 4A–C). The second most functionally conserved
clusters of iKOGs are 5 and 6 (chick) and 1 (mouse) (Figure 4B,
4C). These clusters contain transport, development/differentiation, and apoptotic proteins, respectively, and are phylogenetically
conserved across 5 species. Moreover, clusters 1 and 6 contain
functional proteins common to both chick and mouse. Signal
transduction proteins comprise most of functional cluster 3, which
is common to both mouse and chick as well as to C. elegans, D.
melanogaster, and H. sapiens (Figure 4A). These analyses demonstrate
the biological relevance of these interactions, since many are
conserved phylogenetically and define essential sets of protein
activities in relation to the BK channel.
The BK interactome reflects cell life/death events
An HA-tagged BK-DEC variant, cloned from cochlear tissues,
was designed to determine the effect of selected BKAPs on BK
expression. CHO cells were transfected with this variant and
selected BKAPs knocked down using RNAi. Six BKAPS were
chosen, representing different aspects of cellular processes and
location such as survival (14-3-3), trafficking (Anxa5), cytoskeletal
(c-actin), nucleus/structural (LMN), mitochondrial (SOD), and
proteasomal (VCP). HA-BK was measured in response to BKAP
silencing (Figure 5A–F). Using siRNAs, a knockdown of
endogenous 14-3-3c (33%) and AnxA5 (23%) resulted in a
respective 25% and 17%, increase in HA-BK expression,
compared to scRNA controls. Silencing of c-actin (21%), LMN
(19%), VCP (32%), and SOD1 (38%) caused BK to decrease by
31%, 48%, 38%, and 51%, respectively.
BK sensitivity to Ca2+ can be regulated through channel
phosphorylation by serine-threonine and tyrosine kinases [5].
Thirty putative phosphorylation sites were identified from seven
different BK splice variants [4]. Our BK-DEC variant has an
additional 60 amino acids, containing 11 serine/threonine and
tyrosine residues at the extreme end of the C-terminus (Figure 6A).
The effects on BK in relation to the six different BKAPs led us to
5
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
Figure 2. The BK interactome of the cochlea. (A) Visualization of primary and secondary BKAPs using Cytoscape revealed 19 networks involving
193 proteins and 190 interactions. Of these proteins, 119 are nodes linked with 136 edges to form a single global network. Within this network are 8
major hubs consisting of a single node connected to 6 or more nodes that may or may not be linked to the larger network. The central nodes in these
major hubs include protein kinase C, ATP synthase b, c-actin, protein SET, Na/K- transporting ATPase, transitional ER ATPase (VCP), calmodulin, and
NMDA receptor. (B) The remaining BKAPs consist of 71 nodes and 53 edges that form 18 smaller, distinct modules with 19 or fewer nodes. There are
two hubs consisting of a central node with 6 or more proteins. The central nodes consist of ser/thr phosphatase PP1a and nucleoside diphosphate
kinase B. (C) The interactome containing BKAPs common to both mouse and chick consists of a single global network with 45 nodes linked with 47
edges. Within this network are 2 major hubs consisting of a single node connected to more than 6 nodes that may or may not be linked to the larger
network. Central nodes in these hubs include NMDA receptor, and ATP synthase. The remaining BKAPs consist of 14 nodes and 9 edges that form 5
smaller modules with 5 or fewer nodes. Different-colored nodes represent contributions from either membrane/cytoskeletal or cytoplasmic fractions,
PLoS ONE | www.plosone.org
6
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
or from the IntAct database. Different-colored edges indicate interactions derived from the BK coIP assays or from IntAct. Colored fields represent
portions of the network that are located in different subcellular locations. BKAPs involved in deafness/NIHL are indicated by a star symbol.
doi:10.1371/journal.pone.0028532.g002
examine an important survival hub protein, the serine/threonine
kinase, Akt/PKB (reviews in [31]). This line of reasoning was
underscored by previous evidence showing that BKAPs, such as
14-3-3, LMN, and VCP interact or are part of the Akt pathway
[31–33]. Sequence analysis of BK revealed that aa 1122–1128
contain an RxxRxxS/T motif (Figure 6B), which is a potential
Akt1 substrate binding site [31]. This motif is conserved in BK
mouse and rat orthologs, and can vary between aa 1079 and 1169
in other mammalian species. Akt1 substrate binding sites are not
found in reptiles, amphibians and fishes, suggesting that this motif
is relegated to mammals. To further examine the possibility that
BK may associate with other pro-/anti-apoptotic kinases, the BKDEC sequence was examined for motifs binding 14-3-3, GSK, and
PDK, the latter two of which can regulate Akt effects. Depending
on the species, sequence analyses showed a 14-3-3 binding site
(RXXS/T) between aa 1091–1164, a GSK3b site (SXXS)
between aa 239–314, and a PDK1 site (FXXF) between aa 156–
314 (Figure 6B).
We determined whether the BK/Akt effect was a result of direct
interactions between these proteins, given these putative binding
sites (Figure 6C). Reciprocal coIPs revealed that BK coimmunoprecipitated Akt (56 kDa) and vice-versa, suggesting a direct
physical interaction. Similar interactions were revealed for GSK3b
(47 kDa) and PDK1 (63 kDa) using reciprocal coIPs. We then
tested whether silencing Akt, GSK3b, and PDK1 affects BK
expression (Figure 6D–F). The result was a 57% increase in BK
expression with a 54% decrease in Akt1, whereas BK decreased
45% and 30% with a decrease in PDK1 (31%) and GSK3b (46%)
(p,0.05), respectively. The loading control, b-actin, showed no
differences between sc- and siRNA-treated conditions (p.0.05).
Figure 3. BKAP relationships to ion channels, subcellular localization, and cellular process. (A) The manual mining of PubMed revealed
ion channel partners for BKAPs isolated from membrane and cytoplasmic fractions of chick cochlea. Two major partners are Ca2+ and K+, whereas
,24% are new associations and 9–10% were reported previously as BKAPs. Fewer than 10% are found as partners of channels such as Na+, TRP, Cl2,
and VDAC. (B) A search of UniProtKB found BKAPs localized in different subcellular compartments. While a majority are found in the membrane,
cytoplasm and mitochondrion, .10% are localized to the ER, Golgi, and cytoskeleton. (C) Mining of Gene Ontology, GOSlim, and PubMed revealed
that .15% are relegated to cellular processes that include signaling, metabolism, development/differentiation, trafficking/scaffolding, and
phosphorylation.
doi:10.1371/journal.pone.0028532.g003
PLoS ONE | www.plosone.org
7
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
PLoS ONE | www.plosone.org
8
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
Figure 4. Phylogenetically conserved patterns of iKOGs across six species. Dendrograms are shown for interologs common to (A) chick
only, (B) mouse only, or (C) both chick and mouse. Each row in a plot corresponds to one of six eukaryotes and each column corresponds to the iKOG
pairs. Both (+,+), neither (2,2) or either (+,2 or 2,+) member of an iKOG pair is conserved for each eukaryote. Some profiles are separated into
conserved functional clusters such as transport, Ca2+ binding and chaperonin, signal transduction, etc.
doi:10.1371/journal.pone.0028532.g004
Discussion
Conservation of interactions across species
We have taken a systems-biology approach using coIP with 2-D
gels, mass spectrometry, and bioinformatics to identify BK
interactions that contribute to cochlear metabolism, signal
transduction, phosphorylation, and apoptosis. The limitations of
coIP-based assays and mass spectrometry include false positive and
false negative discovery rates. Therefore, when we set out to
develop the BK interaction network, we implemented several
strategies to reduce these limitations. For example, non-specific
antibody and bead controls, Scaffold analysis against a reversed
database, high peptide coverage (minimum of four) for protein ID,
and high MASCOT score cut-off values minimize the likelihood of
false positive interactions [34,18]. The guidelines of these
parameters produced a high-confidence BK interactome.
A phylogenetic profile for interacting protein families was
constructed using the eukaryotic (orthologous group) ortholog
database. The BK interaction network contains protein interactions that are conserved from microsporidia to mammals,
including conservation between chicken and mouse. This result
suggests that certain parts of these interactomes have evolved
through the preferential addition of interactions between lineagespecific proteins [35]. Clusters 2 and 4, which were highly
enriched for Ca2+-binding and trafficking/scaffolding BKAPs,
respectively, were among the most highly conserved. Common
Ca2+-binding proteins were found across all six species. These
protein families appeared very early in the history of cells to
maintain extra- and intracellular Ca2+ homeostasis, mediating
Ca2+-induced cell damage and maintaining cell survival [36]. The
Figure 5. Characterization in vitro of BK and BKAPs using siRNA. (A,B) Transfection of CHO cells with HA-BK and siRNAs reveals that a
knockdown of endogenous 14-3-3c and AnxA5, increases BK expression compared to scRNA controls. (C–F) Silencing c-actin, VCP, SOD1, and LMNA
reduces BK expression compared to scRNA controls. Densitometry measurements were normalized to the highest densitometric value (normalized to
100%) within a given set of lanes, consisting of triplicates for sc- and siRNA-treated cells. Statistical significance was determined using an unpaired,
two-tailed t-test to obtain **, p,0.001. Error bars represent the S.D.
doi:10.1371/journal.pone.0028532.g005
PLoS ONE | www.plosone.org
9
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
Figure 6. Putative binding sites for life/death signals alter BK expression. (A,B) The BK C-terminus of 10 different vertebrates has putative
binding sites for Akt1, 14-3-3c, GSK3b, and PDK1. (C) Akt1, PDK, and GSK3b interact with BK, as verified by reciprocal coIP using total cochlear lysate.
Label above photos indicate antibody used for coIP, whereas the label below photos indicate the protein coimmunoprecipitated. Akt1
coimmunoprecipitated one isoform of BK (130 kDa), whereas GSK3b and PDK1 coimmunoprecipitated multiple isoforms (90–130 kDa). In the
reciprocal experiment, BK coimmunoprecipitated Akt1 (56 kDa), GSK3b (47 kDa), and PDK1 (63 kDa). The IgG band is signified by an (*). (D–F) CHO
cells were transfected with HA-BK and scRNA, or HA-BK and siRNAs for Akt1, PDK, and GSK3b. HA-BK increased with knockdown of Akt and decreased
with knockdowns of GSK3b and PDK1. Densitometry measurements were normalized and statistical significance determined in D–F as in Figure 5 to
obtain *, p,0.01, **, p,0.001. Error bars represent the S.D.
doi:10.1371/journal.pone.0028532.g006
partner, colocalizes with BK, as they interact via Ca2+ influx
through NMDARs, which activates the BK channel [38].
Presently, there is no evidence for a direct physical interaction,
nor is there one suggested by the interactome. NMDA2B receptors
are present in spiral ganglion cells and adjacent to inner and outer
hair cells of human cochlea [39]. Similarly, BK channels are found
in ganglion cells and at the base of outer hair cells [19].
ATP synthase, an enzyme that converts ADP to ATP using
inorganic phosphate, is found on the inner mitochondrial
membrane, as is the BK channel (reviews in [40]). Presently,
there is no evidence for a direct physical interaction, although the
interactome described herein suggests a relationship. ATPase may
be part of a larger multiprotein complex that forms the
permeability transition pore (PTP), which is linked to apoptosis
that commences with Ca2+ overload. Both BKmito and KATP
channels are thought to protect against ischemia by inhibiting the
PTP, either by direct physical interaction or by inhibiting the
trafficking/scaffolding iKOGs of mouse were found to have
common ancestors across all six species examined, whereas those
of the chick were common only to three. This outcome suggests a
possible divergence between chick and mouse with regard to
trafficking/scaffolding protein-protein interactions. Numerous
trafficking/scaffolding proteins evolved to dominate the mode of
multiple protein interactions found in a complex assembly at the
plasmalemma and excitatory synapses [37]. Further investigations
of, for example, their domains may provide insights into
underlying interactome evolution, as evidence suggests domains
can take evolutionary jumps associated with changes in function
[37].
Two primary hub proteins shared by both chick and mouse are
NMDA2B receptors and the enzyme, ATPase, which is found in
the inner mitochondrial membrane. These hubs connect 45
proteins in a conserved network of primary and secondary
interactions. The NMDA receptor, which acts as a secondary
PLoS ONE | www.plosone.org
10
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
hinge on other BKAP kinases, since 14-3-3 interacts with kinases
such as GSK [56]. Interestingly, GSK activation via phosphorylation increases cell viability, but is moreover correlated with the
coupling of GSK to 14-3-3 [56]. How these kinases might affect
each other and their interactions with BK may be related to a
kinase central to survival, Akt.
factors that initiate the opening of the PTP [40]. Recent evidence
suggests the presence of BKmito in the cochlea [9,19], although its
relation to ATP synthase and the PTP requires further studies.
Silencing of apoptotic-related BKAPs alters BK expression
BKAPs chosen from the interactome have functions related to
pro- or anti-apoptotic events. Knockdown of VCP, LMNA,
SOD1, and c-actin decreased BK expression. VCP is a hub in the
BK interactome and a member of the ATPase-associated (AAA)
family that binds ubiquitin and acts as a chaperone of proteins
marked for degradation in the proteasome. Similar to nucleoside
diphosphate kinase (NDK), another BK hub protein, VCP has a
role in ER stress-induced apoptotic execution [41]. While NDK
was found outside the large interactome, previous evidence
suggests that NDK participates in this network by virtue of the
ER-associated SET complex found in the large network. Protein
SET is an inhibitor of NDK/NM-23 [42] and when removed
allows cell death via DNA degradation [43]. Consequently, when
considered together, these interactions generate at least 18 BKAPs
potentially involved in apoptosis, including ubiquitin regulatory X
(UBX) -containing proteins and Fas-associated Factor (FAF).
Interestingly, NDK increases the activity of a Ca2+-activated K+
channel (KCa3.1) in CD4 cells, by directly binding and
phosphorylating histidine 358 at the C-terminus [44]. Here, as
in vascular smooth muscle, a Ca2+-activated K+ channel regulates
Ca2+ influx. In the inner hair cells of mammals, BK channels are
found in extrasynaptic regions, at the apex of the cell, and near the
sites of Ca2+ influx via transduction channels in the stereocilia.
Thus, the regulation of Ca2+ as well as K+ via these channels might
have a role in not only signal processing but also cellular
homeostasis.
BK decreased with the silencing of LMNA, SOD1, and c-actin
in CHO cells. All three are important to cell viability since they are
antiapoptotic. The nuclear lamina, a network of lamins and
membrane-associated proteins, is attached to the inner face of the
nuclear membrane. Lamins are among the first apoptotic targeted
proteins during the breakdown of the nuclear structure [45]. In
contrast, SOD1 resides both in the cytosol and mitochondria and
is an antioxidant isoenzyme that dismutates superoxide anions to
H2O2 in response to oxidative stress. Its mimetic, tempol, can
activate BK channels [46]. Future studies are needed to examine
these relationships, since BK may reside in the nuclear envelope
[47] and/or nucleus [48,19] as well as in the mitochondria of
cochlear cells [9,19]. Finally, as with LMNA and SOD1, actins
play a role during apoptosis, since they are targeted by caspases,
leading to their disassembly [49]. BK associates with both a- and
c-actin, which with leptin can cluster BK channels at synapses
[50,51].
In contrast to the previous four proteins, silencing of Annxa5
and 14-3-3 increased BK expression. Trafficking and cytoskeletal
proteins, such as annexin and actin, work in concert to maintain
membrane complexes regulated by Ca2+, which alters the
conformation of Annxa5 [52]. One of these complexes consists
of apolipoprotein A1 (ApoA1) and annexin, which form in a Ca2+dependent manner [53] and of which apolipoprotein, found in
cochlear hair cells, alters the biophysical characteristics of BK
[54]. In comparison, 14-3-3 reportedly interacts with dSlo via the
accessory subunit dSlob in Drosophila [5]. Our data, however,
suggest a direct relationship with a putative binding site for 14-3-3.
A template for this interaction is the TASK K+ channel/14-3-3
relationship, where the C-terminus of TASK directly interacts
with multiple isoforms of 14-3-3. However, unlike the TASK/143-3 interaction, where 14-3-3 increases TASK cell surface
expression [55], 14-3-3 decreases BK. These differences may
PLoS ONE | www.plosone.org
Life/death signals alter BK expression
The BK channel has a long C-terminus with a number of
phosphorylation sites [4]. Primary and secondary partners of BK
revealed apoptosis-related signals, leading us to examine kinase
effectors that may bind to this channel. Central to these life/death
effectors is the serine/threonine kinase Akt. Akt has a central role in
cell survival, inhibiting apoptosis by phosphorylating and inactivating
targets such as BAD [31], and caspase-9 [31]. Moreover, Akt binds to
phosphatidylinositol (3,4,5)-trisphosphate at the plasma membrane,
initiating activation by phospholipid binding and phosphorylation
and using 14-3-3 as a substrate. [31]. Previous studies suggest Akt
regulates BK activity as part of an estrogen transduction-signaling
component, where estrogen stimulates nNOS via the PI3 kinase/Akt
pathway [57]. Akt can also mediate plasmalemma expression of BK
through neuregulin [58]. However, our data suggest direct Akt/BK
interaction via Akt and 14-3-3 binding sites that overlap at the Cterminus of BK. Knockdown of Akt1 and 14-3-3 increases BK
expression, suggesting that BK is kept in check by these kinases. In
contrast, GSK3b and PDK1 knockdown resulted in decreased
expression of BK in CHO cells. Interestingly, Akt inhibits GSKb, an
initiator of apoptosis whereas PDK1 partially activates Akt via
phosphorylation [31]. These results, when taken in concert with
putative binding sites for GSK3b, PDK, 14-3-3, and Akt implicate
the phosphorylation of BK in cell death/survival. Moreover, they beg
the question of whether these kinases act separately or in concert to
activate/deactivate BK directly and whether their relationship to
their counterparts in the larger cell death/survival pathways regulates
cell viability via BK?
The outcome of our study reveals a highly connected protein
network that forms several functional regulatory pathways whose
interactions are conserved across a number of eukaryotes.
Intriguingly, we found putative BKAPs that are involved in both
BK phosphorylation, and cell survival/apoptosis. Thus, the BK
channel may have a role not only in excitation, but possibly cellular
homeostasis, as a function of possessing motifs that bind death/
survival kinases. BK channel participation in saving cells from
ischemia is well documented in relation to its role in mitochondria,
as is the regulation of cellular homeostasis by K+ efflux through
channels in the plasmalemma (reviews in [59]). Given these
findings, the importance of BK in hair cells under stress, as would
occur during noise-induced hearing loss, cannot be underestimated,
especially in light of studies that show BK knockouts are protected
from such a loss [8]. Our data provide a foundation for future
studies of an expanded network and its relation to where and when
interactions take place, how they are regulated, and the logic of this
complex biological network in relation to hearing.
Data Availability
The interactions in this study have been submitted to the IMEx
consortium (http://imex.sourceforge.net) through the IntAct
database (http://www.ebi.ac.uk/intact/, accession number IM9475).
Supporting Information
Figure S1 Images of 2-D gel electrophoresis of chick
cochlear proteome and controls. Two-dimensional gel
11
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
electrophoresis of the total proteome for the (A) membrane/
cytoskeletal and (B) cytoplasmic fractions shows 253 and 196
visible features, respectively. (C) Results for membrane/cytoskeletal and (D) cytoplasmic fractions of mouse cochleae incubated
with protein G beads without anti-BK antibody. The non-specific
proteins were washed and eluted from the beads as in the
experimental groups. (E,F) Fractions, as before, were incubated
with beads bound with a non- specific antibody to the cochlea,
anti-VSV-G antibody. Any non-specific proteins captured were
washed, eluted, and analyzed, as described previously.
(TIF)
Table S4 Primary BKAPs, from membrane/cytoskeletal and
Table S1 List of antibodies and primers used in the study.
We thank Dr. Paul Fuchs for cSlo cDNA and Dr. John Koomen and
Elizabeth Remily from the Moffit Cancer and Research Center Proteomics
Facility.
cytoplasmic fractions, categorized according to organelle location,
ion channel association, and cellular process.
(XLS)
Table S5 UniProt IDs of primary and secondary partners with
their corresponding KOG_IDs common to mouse alone, chick
alone, and mouse and chick together.
(XLS)
Acknowledgments
(XLS)
Table S2 List of BKAPs identified by LC-MS/MS from the
membrane/cytoskeletal and cytoplasmic fractions.
(XLS)
Author Contributions
Table S3 List of BKAPs from membrane and cytoplasmic
Conceived and designed the experiments: BS. Performed the experiments:
MH YS. Analyzed the data: BS SO SS MH. Contributed reagents/
materials/analysis tools: BS SO SS YS. Wrote the paper: BS.
fractions and their interactions with binary partners, as determined by IntAct. These proteins appear in the interactome.
(XLS)
References
1. Latorre R, Brauchi S (2006) Large conductance Ca2+-activated K+ (BK)
channel: activation by Ca2+ and voltage. Biol Res 39: 385–401.
2. Yuan P, Leonetti MD, Pico AR, Hsiung Y, MacKinnon R (2010) Structure of
the human BK channel Ca2+-activation apparatus at 3.0 A resolution. Science
329: 182–186.
3. Shipston MJ (2001) Alternative splicing of potassium channels: a dynamic switch
of cellular excitability. Trends Cell Biol 11: 353–358.
4. Yan J, Olsen JV, Park KS, Li W, Bildl W, et al. (2008) Profiling the phosphostatus of the BKCa channel alpha subunit in rat brain reveals unexpected
patterns and complexity. Mol Cell Proteomics 7: 2188–2198.
5. Lu R, Alioua A, Kumar Y, Eghbali M, Stefani E, et al. (2006) MaxiK channel
partners: physiological impact. J Physiol 570: 65–72.
6. Hafidi A, Beurg M, Dulon D (2005) Localization and developmental expression
of BK channels in mammalian cochlear hair cells. Neuroscience 130: 475–484.
7. Fettiplace R, Fuchs PA (1999) Mechanisms of hair cell tuning. Annu Rev Physiol
61: 809–834.
8. Pyott SJ, Meredith AL, Fodor AA, Vázquez AE, Yamoah EN, et al. (2007)
Cochlear function in mice lacking the BK channel alpha, beta1, or beta4
subunits. J Biol Chem 282: 3312–3124.
9. Kathiresan T, Harvey M, Orchard S, Sakai Y, Sokolowski B (2009) A protein
interaction network for the large conductance Ca(2+)-activated K(+) channel in
the mouse cochlea. Mol Cell Proteomics 8: 1972–1987.
10. White RE, Kryman JP, El-Mowafy AM, Han G, Carrier GO (2000) cAMPdependent vasodilators cross-activate the cGMP-dependent protein kinase to
stimulate BK(Ca) channel activity in coronary artery smooth muscle cells. Circ
Res 86: 897–905.
11. Zhou XB, Wulfsen I, Utku E, Sausbier U, Sausbier M, et al. (2010) Dual role of
protein kinase C on BK channel regulation. Proc Natl Acad Sci U S A 107:
8005–8010.
12. Denson DD, Wang X, Worrell RT, Aikhalili O, Eaton DC (2001) Cytosolic
phospholipase A2 is required for optimal ATP activation of BK channels in
GH(3) cells. J Biol Chem 27: 7136–7142.
13. Kerrien S, Alam-Faruque Y, Aranda B, Bancarz I, Bridge A, et al. (2007)
IntAct–open source resource for molecular interaction data. Nucleic Acids Res
35: D561–565.
14. Cline MS, Smoot M, Cerami E, Kuchinsky A, Landys N, et al. (2007)
Integration of biological networks and gene expression data using Cytoscape.
Nat Protoc 2: 2366–2382.
15. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, et al. (2003)
The COG database: an updated version includes eukaryotes. BMC Bioinformatics 4: 41.
16. Zhou Y, Landweber LF (2007) BLASTO: a tool for searching orthologous
groups. Nucleic Acids Res 35: W678–682.
17. Harvey MC, Sokolowski BHA (2009) In vivo verification of protein interactions
in the inner ear by coimmunoprecipitation. In: Sokolowski BHA, ed. Auditory
and Vestibular Research: Methods and Protocols. New York: Humana Press/
Springer Protocols 493: 299–310.
18. Stoop MP, Lamers RJ, Burgers PC, Sillevis Smitt PA, Hintzen RQ, et al. (2008)
The rate of false positive sequence matches of peptides profiled by MALDI MS
and identified by MS/MS. J Proteome Res 11: 4841–4847.
19. Sakai Y, Harvey M, Sokolowski BHA (2011) Identification and quantification of
full-length BK channel variants in the developing mouse cochlea. J Neurosci Res
89: 1747–1760.
PLoS ONE | www.plosone.org
20. Salwinski L, Licata L, Winter A, Thorneycroft D, Khadake J, et al. (2009)
Recurated protein interaction datasets. Nat Methods 6: 860–861.
21. Yu H, Luscombe NM, Lu HX, Zhu X, Xia Y (2004) Annotation transfer
between genomes: protein-protein interologs and protein-DNA regulogs.
Genome Res 14: 1107–1118.
22. Higashiyama H, Hirose F, Yamaguchi M, Inoue YH, Fujikake N, et al. (2002)
Identification of ter94, Drosophila VCP, as a modulator of polyglutamineinduced neurodegeneration. Cell Death Differ 9: 264–273.
23. Veitonmäki N, Cao R, Wu LH, Moser TL, Li B, et al. (2004) Endothelial cell
surface ATP synthase-triggered caspase-apoptotic pathway is essential for k1-5induced antiangiogenesis. Cancer Res 64: 3679–3686.
24. Madeira A, Pommet JM, Prochiantz A, Allinquant B (2005) SET protein
(TAF1beta, I2PP2A) is involved in neuronal apoptosis induced by an amyloid
precursor protein cytoplasmic subdomain. FASEB J 19: 1905–1907.
25. Sunesson L, Hellman U, Larsson C (2008) Protein kinase Cepsilon binds
peripherin and induces its aggregation, which is accompanied by apoptosis of
neuroblastoma cells. J Biol Chem 283: 16653–16664.
26. Kim MJ, Jo DG, Hong GS, Kim BJ, Lai M, et al. (2002) Calpain-dependent
cleavage of cain/cabin1 activates calcineurin to mediate calcium-triggered cell
death. Proc Natl Acad Sci U S A 99: 9870–9875.
27. Ruel J, Chabbert C, Nouvian R, Bendris R, Eybalin M, et al. (2008) Salicylate
enables cochlear arachidonic-acid-sensitive NMDA receptor responses. J Neurosi
28: 7313–7323.
28. Nakano T, Doi T, Yoshimoto J, Doya K (2010) A kinetic model of dopamineand calcium-dependent striatal synaptic plasticity. PLoS Comput Biol 6:
e1000670.
29. Wallace RW, Tallant EA, Cheung WY (1982) Multifunctional role of
calmodulin in biologic processes. Cold Spring Harb Symp Quant Biol 46:
893–901.
30. Zhang CL, Ho PL, Kintner DB, Sun D, Chiu SY (2010) Activity-dependent
regulation of mitochondrial motility by calcium and Na/K-ATPase at nodes of
Ranvier of myelinated nerves. J Neurosci 30: 3555–3566.
31. Manning BD, Cantley LC (2007) AKT/PKB signaling: navigating downstream.
Cell 129: 1261–1274.
32. Cenni V, Bertacchini J, Beretti F, Lattanzi G, Bavelloni A, et al. (2008) Lamin A
Ser404 is a nuclear target of Akt phosphorylation inC2C12 cells. J Proteom Res
7: 4727–4735.
33. Vandermoere F, El Yazidi-Belkoura I, Slomianny C, Demont Y, Bidaux G,
et al. (2006) The valosin-containing protein (VCP) is a target of Akt signaling
required for cell survival. J Biol Chem 281: 14307–14313.
34. Weatherly DB, Atwood JA, III, Minning TA, Cavola C, Tarleton RL (2005) A
heuristic method for assigning a false-discovery rate for protein identifications
from Mascot database search results. Mol Cell Proteomics 4: 762–772.
35. Pagliarini DJ, Calvo SE, Chang B, Sheth SA, Vafai SB, et al. (2008) A
mitochondrial protein compendium elucidates complex I disease biology. Cell
134: 112–123.
36. Case RM, Eisner D, Gurney A, Jones O, Muallem S, et al. (2007) Evolution of
calcium homeostasis: from birth of the first cell to an omnipresent signaling
system. Cell Calcium 42: 345–350.
37. Jin J, Xie X, Chen C, Park JG, Stark C, et al. (2009) Eukaryotic protein domains
as functional units of cellular evolution. Sci Signal 2: ra76.
12
December 2011 | Volume 6 | Issue 12 | e28532
Conserved BK Protein-Protein Interactions
49. Franklin-Tong VE, Gourlay CW (2008) A role for actin in regulating apoptosis/
programmed cell death: evidence spanning yeast, plants and animals. Biochem J
413: 389–404.
50. O’Malley D, Irving AJ, Harvey J (2005) Leptin-induced dynamic alterations in
the actin cytoskeleton mediate the activation and synaptic clustering of BK
channels. FASEB J 19: 1917–1919.
51. Zou S, Jha S, Kim EY, Dryer SE (2008) A novel actin-binding domain on Slo1
calcium-activated potassium channels is necessary for their expression in the
plasma membrane. Mol Pharmacol 73: 359–368.
52. Turnay J, Olmo N, Gasset M, Iloro I, Arrondo JL, et al. (2002) Calciumdependent conformational rearrangements and protein stability in chicken
annexin A5. Biophys J 83: 2280–22891.
53. Brownawell AM, Creutz CE (1996) Calcium-dependent binding of the plasma
protein apolipoprotein A-I to two members of the annexin family. Biochemistry
35: 6839–6845.
54. Sokolowski B, Duncan KD, Chen S, Karolat J, Kathiresan T, et al. (2009)
Apolipoprotein A1 alters the biophysical characteristics of the BK channel.
Biochem Biophys Res Commun 387: 671–675.
55. Rajan S, Preisig-Müller R, Wischmeyer E, Nehring R, Hanley PJ (2002)
Interaction with 14-3-3 proteins promotes functional expression of the potassium
channels TASK-1 and TASK-3. J Physiol 545: 13–26.
56. Mwangi S, Anitha M, Fu H, Sitaraman SV, Srinivasan S (2006) Glial cell linederived neurotrophic factor-mediated enteric neuronal survival involves
glycogen synthase kinase-3beta phosphorylation and coupling with 14-3-3.
Neuroscience 143: 241–251.
57. Han G, Ma H, Chintala R, Miyake K, Fulton DJ, et al. (2007) Nongenomic
endothelium-independent effects of estrogen on human coronary smooth muscle
are mediated by type I (neuronal) NOS and PI3-kinase-Akt signaling.
Am J Physiol Heart Circ Physiol 293: H314–321.
58. Chae K-S, Martin-Caraballo M, Anderson M, Dryer SE (2005) Akt activation is
necessary for growth factor–induced trafficking of functional KCa channels in
developing parasympathetic neurons. J Neurophysiol 93: 1174–1182.
59. Yu SP (2003) Regulation and critical role of potassium homeostasis in apoptosis.
Prog Neurobiol 70: 363–386.
38. Isaacson JS, Murphy GJ (2001) Glutamate-mediated extrasynaptic inhibition:
direct coupling of NMDA receptors to Ca(2+)-activated K+ channels. Neuron
31: 1027–1034.
39. Nordang L, Cestreicher E, Arnold W, Anniko M (2000) Glutamate is the
afferent neurotransmitter in the human cochlea. Acta Otolaryngol 120:
359–362.
40. O’Rourke B, Cortassa S, Aon MA (2005) Mitochondrial ion channels:
gatekeepers of life and death. Physiology 20: 303–315.
41. Rao RV, Niazi K, Mollahan P, Mao X, Crippen D, et al. (2004) Coupling
endoplasmic reticulum stress to the cell-death program: a novel HSP90independent role for the small chaperone protein p23. Cell Death Differ 13:
415–425.
42. Fan Z, Beresford PJ, Oh DY, Zhang D, Lieberman J (2003) Tumor suppressor
NM23-H1 is a granzyme A-activated DNase during CTL-mediated apoptosis,
and the nucleosome assembly protein SET is its inhibitor. Cell 112: 659–672.
43. Chowdhury D, Beresford PJ, Zhu P, Zhang D, Sung JS (2006) The exonuclease
TREX1 is in the SET complex and acts in concert with NM23-H1 to degrade
DNA during granzyme A-mediated cell death. Mol Cell 23: 133–142.
44. Srivastava S, Li Z, Ko K, Choudhury P, Albaqumi M (2006) Histidine
phosphorylation of the potassium channel KCa3.1 by nucleoside diphosphate
kinase B is required for activation of KCa3.1 and CD4 T cells. Mol Cell 24:
665–675.
45. Lazebnik YA, Takahashi A, Moir RD, Goldman RD, Poirier GG (1995) Studies
of the lamin proteinase reveal multiple parallel biochemical pathways during
apoptotic execution. Proc Natl Acad Sci U S A 92: 9042–9046.
46. Xu H, Bian X, Watts SW, Hlavacova A (2005) Activation of vascular BK
channel by tempol in DOCA-salt hypertensive rats. Hypertension 46:
1154–1162.
47. Yamashita M, Sugioka M, Ogawa Y (2006) Voltage- and Ca2+-activated
potassium channels in Ca2+ store control Ca2+ release. FEBS J 273:
3585–3597.
48. Lhuillier L, Dryer SE (2002) Developmental regulation of neuronal K(Ca)
channels by TGFbeta1: an essential role for PI3 kinase signaling and membrane
insertion. J Neurophysiol 88: 954–964.
PLoS ONE | www.plosone.org
13
December 2011 | Volume 6 | Issue 12 | e28532