* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download REPSA-Directed Identification of DNA
G protein–coupled receptor wikipedia , lookup
Magnesium transporter wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Promoter (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Transcription factor wikipedia , lookup
Community fingerprinting wikipedia , lookup
Interactome wikipedia , lookup
Protein moonlighting wikipedia , lookup
Protein structure prediction wikipedia , lookup
Western blot wikipedia , lookup
Protein adsorption wikipedia , lookup
Expression vector wikipedia , lookup
Nuclear magnetic resonance spectroscopy of proteins wikipedia , lookup
Molecular evolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Point mutation wikipedia , lookup
Homology modeling wikipedia , lookup
Gene expression wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
+ REPSA-Directed Identification of DNA-Binding Specificity for Orphan Transcription Factors Kamir Hiam Van Dyke Lab Dept. of Biochemistry KSU Symposium of Student Scholars 2015 + The Power of Modern Genetics Genetic Sequencing Raw Data Series of bases ≠ cellular function Further experimentation & data analysis needed Central Dogma of Biology DNARNAProtein Proteins responsible for the majority of cellular activities Transcription Factors are proteins that bind to DNA to regulate expression + The Incomplete Tale of E. coli Complete genome sequenced in 1997 (4.6+ Mbp) 4290 Open Reading Frames 240 potential TFs Detailed binding profiles for only 68 Understanding orphan regulatory proteins can improve public health Microbial disease Human microbiome + REPSA and Combinatorial Methods All combinatorial methods use large pools of randomized oligonucleotides difference in selection (A) CASTing involves physical separation of bound protein-DNA complex requires knowledge of protein (B) REPSA involves protein protection of enzymatic cleavage no prior knowledge of protein needed REPSA optimal technique for transcription factor discovery + A Closer Look at REPSA Selection Type IIS Restriction Enzymes cleave DNA at a defined distance from their recognition sites Selection Template (68 bp) 5’ - CTAGGAATTCGTGCAGAGGTGAAT NNNNNNNNNNNNNNNNNNNN TTA CATCC CTCCAG AAGCTTGGAC – 3’ 3’ - GATCCTTAAGCACGTCTCCACTTA NNNNNNNNNNNNNNNNNNNN AAT GTAGG GAGGTC TTCGAACCTG – BsgI HphI FokI BpmI 5’ + Orphan TF Specificity in the Van Dyke Lab General Experimental Procedure Clone bacteria (E. coli K12) with gene of interest Induce protein expression Perform combinatorial selection for sequence specificity (REPSA) Sequence final pool of DNA Analyze data for consensus sequence Verify, Hypothesize, & Publish Repeat! + LexA as model protein for REPSA Previously characterized repressor protein SOS response regulator Known consensus binding sequence DNase I protection EMSA Weight Matrix Studies Combinatorial methods never used Ideal candidate for REPSA protocol optimization Overall structure of E. coli LexA-DNA complex + Representative Round of REPSA Protein/ No Enzyme No Protein/ Enzyme Protein/ Enzyme 6 Rounds PCR 9 Rounds PCR 12 Rounds PCR + Unexpected Consensus Sequences Round 7: 553/1000 sequences e=4.0e-290 • What are structural features of T-rich sequences? • Why would this inhibit cleavage? Round 14: 923/1000 sequences e=9.3e-2093 • Doesn’t this sequence look familiar? • Why would this inhibit cleavage? According to previous literature, FokI cleaves DNA without regard for sequence specificity… Yet we appear to have found violations of this rule. + Future Direction LexA Specificity Studies Examine Orphan Transcription Factors Work out issues with protein binding In E. coli and other organisms such as extremophiles Mixtures of Transcription Factors Develop REPSA techniques to handle multiple TFs at one time Ultimate goal to work with less pure cellular extracts + Acknowledgements Van Dyke Lab Members NSF STEM Scholarship LSAMP Scholarship OVPR KSU Foundation NIH