Download +Tec - Blood Journal

From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
RAPID COMMUNICATION
Tee Protein-Tyrosine Kinase Is Involved in Interleukin-3 Signaling Pathway
By Hiroyuki Mano, Yoshihiro Yamashita, Ken Sato, Yoshio Yazaki, and Hisamaru Hirai
Among cytoplasmic protein-tyrosine kinases
(PTKs) Tec now
forms a novel subfamilywith recently identified Tec-related
PTKs (Btk and ltk/Tsk). Tec is known to be abundantly expressed in myeloid cells, and multiple forms of Tec protein
can be generated viathe mechanism of alternative splicing.
In this report, we have inveatigated 5“terminal diversityof
the tec messagesto demonstrate a predominant form
of the
Tec protein in mouse hematopoietic cell lines. Using anti-
N
ONRECEPTOR TYPE protein-tyrosine kinases (PTKs)
can be divided into two groups, namely, the Src-family
(Src, Yes, Fyn, Lyn, Blk, Lck, Hck, Fgr, and Yrk) and the
non-Src family (Tec, Btk, Itkfhk, Fps/Fes, Fer, Abl, k g ,
Zap-70, Syk, Tyk-2, Jak-l, and Jak-2).’ Well-shared characters among the members of the Src-family are (1) an Nterminal myristylation site: (2) a C-terminal tyrosine residue
as the negative regulatory site (corresponding to Tyr-527 in
c - S r ~ ) and
, ~ (3) Src homology (SH) 2 and SH3 domains in
the noncatalytic region.“ In contrast to the conserved protein
structure among the members of the Src family, the non-Src
family members have rather divergent structure^.^.^ None of
them has C-terminal phosphotyrosine-acceptor sites. Only
type IV protein of murine c-Ab1 among them is presumed
to be myristylated.’ Furthermore, the Jak kinases do not even
have SH2 or SH3 domains:
The Tec kinasewas introduced asa novel member of the
non-Src family.’ Tec has SH2,SH3, and kinase domains as
the members of the Src family.However,thereare
no
myristylation sites or C-terminalphosphotyrosine-acceptor sites in the predicted
Tec protein. Recently, two
Tec-related kinases have been reported by other groups.
Siliciano et a19 have identified the Itkkinase that is inducibly expressed by interleukin-2 (IL-2) in T cells, and the
same kinase was also reported by Heyeck and Berg” as
Tsk. Tsukada et all’ and Vetrie et all2 have independently
published another Tec-related kinase (Btk) responsible
for
X-chromosome-linked agammaglobulinemia (XLA). All
three kinases(Tec, Itk/Tsk, and Btk) have thesame protein
structure, and their amino acid sequences are exceptionallyhomologouscompared
with the othermembers of
nonreceptor PTKs. Therefore, these three kinases should
constitute a novel subfamily among the nonreceptor type
PTKs.
All members of the Tec family are abundantly expressed
in hematopoietic tissues. Because the Btk kinase plays a
pivotal role in Ig production in B cells, the other members
of the Tec family are expected to be directly involved in
the signaling systems of either mitogenic pathways or cellspecific functions in the hematopoietic system. In contrast
to the high expression of ItkrTsk in T cells and Btk in B cells,
Tec is abundantly expressed in myeloid ~el1s.l~
Therefore, it
has been an intriguing issue to investigate the in vivo role
of the Tec kinase in myeloid cells. We describe here the
detailed analysis of alternative splicing of the 5”region of
the tec messages. Furthermore, by using anti-Tec serum, we
could show that Tec is involved in the signaling pathway of
IL-3.
Blood, Vol 85, No 2 (January 15). 1995 pp 343-350
Tec serum,we could showthat stimulationwith interleukin3 (IL-3) can induce tyrosine phosphorylation of Tec both in
IL-3 stimulation was also
myeloid andpro-B-celllines.
shown to inducekinase activity of Tec. Furthermore, we
could demonstratethat Tec is constitutively associated
with
the Shc protein in vivo. Thus, we conclude that Tec is involved in the signaling pathway of IL-3.
0 l995 by The AmericanSociety of Hematology.
MATERIALS AND METHODS
Cells and culture. A myeloid cell line, 32D,I4 and a pro-B-cell
line, BaF3,” were maintained in RPM1 1640 medium (GIBCO,
Grand Island, NY) supplemented with 10% fetal calf serum (FCS)
and 25 U/mL of murine IL-3. For stimulation experiments, cells
were depleted of L 3 overnight and then stimulated with L - 3 for
the period of 5 minutes unless otherwise indicated. COS-l cellsi6
were maintained in Dulbecco’s modified Eagle’s medium (GIBCO)
with 10% FCS.
RNA-dependent polymerase chain reaction (PCR) amplifcation
of the 5’-region of the tec messages. Primers of the inner set
(sense,GCTCTAGATTGGCTTGTCTC;antisense,TCGGTACCTGCTTTGTGGA) and the outer set (sense,
GCAGTTTGGACGTCGCTC; antisense,AACCTTCTTCACCCATCGG) were
synthesized by the model 381A DNA synthesizer (Applied Biosystems, Foster City, CA). From 1 pg of total RNA of 32D cells,
the first strand of the tee cDNA was synthesized with the antisense
primer of the outer set using murine reverse transcriptase (SuperScript; BRL, Gaithersburg, MD) according to the manufacturer’s
instructions. The same reaction without reverse transcriptase was
used as the negative control for further experiments. One twentieth of the cDNA products was PCR-amplified by the primers of
the outer set at the cycle of 92°C for 1 minute, 37°C for 1 minute,
and 72°C for 2 minutes for 30 courses using AmpliTaq DNA
polymerase (Perkin Elmer Cetus, Norwalk, CT) according to the
manufacturer’s protocol. Onefiftieth of the first PCR-product was
further PCR-amplified by the primers of the inner set at the same
condition for 30 cycles. Recognition sequences of the restriction
enzymes, Xba I and Kpn I, were incorporated at the ends of the
sense primer and the antisense primer of the inner set, respectively, to facilitate subcloning.
From the Department of Molecular Biology, Jichi Medical
School, Yakushiji, Minami-Kawachi-machi, Kawachi-gun,Tochigiken, Japan; and The Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Hongo, Bunkyo-ku, Tokyo,
Japan.
Submitted July 21, 1994; accepted October 24, 1994.
Supported in part byGrants-in-Aid for Cancer Research from the
Ministry of Education, Science, and Culture and from the Ministry
of Health and Welfare, Japan.
Address reprint requests to Hiroyuki Mano, MD, PhD, Department of Molecular Biology, Jichi Medical School, 331 1-1 Yakushiji,
Minami-Kawachi-machi, Kawachi-gun, Tochigi-ken 329-04, Japan.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 I995 by The American Society of Hematology.
0006-4971/95/8502-0036$3,00/0
343
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
MAN0 ET AL
344
SH-3 SH-2
Kinase
domain
Type 1
Type
1
l
l
I
l
\
I
,
\
l
! I
Fig 1. Comparison the
of
predicted
structure
among Tec types 1, II, 111, and IV. Structures of the
Tec kinase are aligned. Divergent regions amongTec
(l,
subtypes generated
alternative
splicing by
of Tec
messages are differently shaded. SH2, SH3, and kinase domains are also indicated.
l l
Type
DNA sequencing of rhe PCRproducrs. The PCR products of
475-bp and 388-bp length were separated through 2 8 agarose gel
(NuSieve 3:1 Agarose: FMC BioProducts, Frederick, MD) and purified by the Geneclean kit (Bio 101, Inc. La Jolla, CA). Each fragment
was then subcloned into Bluescript phagemid vector (Stratagene, La
Jolla, CA). Double-stranded DNAs of the recombinant plasmids
were denatured and sequenced by the chain-termination method"
using the T7 or the T3 primers (Stratagene).
Prepararion of anti-Tec serum. The cDNA fragment encoding
the SH3 domain of mouse Tec type IV* (see Results) was PCRamplified and subcloned into the pGEX-3X vector (Pharmacia LKB
Biotechnology, Uppsala. Sweden). NMS22 cells (Stratagene) expressing this plasmid were grown i n LB medium containing S0
p'plmL ampicillin and stimulated with 0. I mmolL isopropyl-0-D*The amino acid sequences of Tec types 11, 111, and IV have
been deposited in the NRRF-PIR data base under accession numbers
JU021S. 3110227. and 3110228, respectively.
A
Protein
IA (87 bp)
-
5'
\
+G\
/J
/I
/'
/'
5'
+i+
U
IIA (41 bp)
cDNA
cDNA
I
Protein
"
B
2036 +
1636 +
1018 +
Fig 2. (A) Alternative splicing of 5"region of the
tec messages. Thin linesrepresent cDNAs of rectype
Isand type11.'' Nucleotide sequences specific t o each
type (IA or IIA sequences) are emphasized as thick
lines. Predicted N-termini of the Tee proteins are illustrated as boxes, aligned t o their corresponding
cDNAs. Divergent amino acid sequences between
type I and type II are differently shaded. Nucleotide
sequences used for primers in RNA-dependent PCR
amplification (see Materials and Methods) are delineated as arrows. (B) RNA-dependent PCR products
of the rec5"region. Sizes of molecular weight markers (l-kb ladder; BRL) are shown as basepairs at the
left side of the panel. The part of tec cDNA surrounding the IA and IIA sequences was PCR-amplified from thereaction of cDNA synthesis with I + ) or
without (-1 reverse transcriptase (see Materials and
Methods). The predominant 475-bp and 388-bp PCR
products are indicated by arrows.
517/506+
396 +
344
-g
298
220 -b
+475
+388
bp
bp
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
345
TECIS INVOLVED IN IL-3 SIGNALINGPATHWAY
thiogalactopyranoside (IPTG) for 3 hours. The fusion proteinof
Tec SH3 and glutathione S-transferase (GST) was purified through
glutathione-Sepharose 4B column (Pharmacia LKB Biotechnology)
according to the method of Smith and Johnson.’*The purified fusion
protein wasmixedwith
complete Freund’s adjuvant (Sigma, St
Louis, MO) and injected into rabbits to raise anti-Tec serum against
its SH3 domain. For boosting, the protein was mixed withincomplete
Freund’s adjuvant (Sigma).
Transient expression in COS-I cells. The tec type IV cDNA
was subcloned into an expression vector, pSSRal’ to generate the
pSSRa/tec plasmids. COS-l cells ( 5 X IO’ cells/experiment) were
transfected with 1 pg of pSSRa or pSSRaltec by the diethyl aminoethyl (DEAE)-dextran method?” After 72 hours of culture, cells
were lysed in the NP-Lysis buffer (50 mmol/L HEPES, pH 7.4,
0.5% Nonidet P-40, 150 mmol/L sodium chloride, 1 mmol/L sodium
fluoride, 1 mmol/L sodium orthovanadate. 200 U/mL aprotinin, and
1 mmol/L phenylmethylsulfonyl fluoride). After incubation for 30
minutes on ice, cell extracts were clarified by the centrifugation of
10,OOOg for 10 minutes.
Immunoprecipitation and in vitro kinase assay. Cell lysates of
32D or BaF3 cells (1 X IO’ cells/experiment) were prepared as
described above. For immunoprecipitation, equal amounts of cellular
proteins were mixed with either normal rabbit serum, anti-Tec serum
(1:400 dilution for each), or anti-Shc antibody (Upstate Biotechnology Inc. Lake Placid, NY) for 2hours at 4°C. Lysates were incubated
with protein A-Sepharose 4B beads (Sigma) on a rotating platform
for another 2 hours. The immunecomplexes were extensively washed
with the lysis buffer and boiled in Laemmeli’s sample buffer” for
3 minutes.
For in vitro kinase assay, the immunecomplexes were washed
three times with the NP-lysis buffer, washed three times with the
kinase buffer (20 mmol/L HEPES, pH 7.4, 150 mmol/L NaCI, IO
mmol/L MgClz, IO mmol/L MnCI,), and finally incubated with 0.37
MBq of [y-”P]ATP (Amersham, Arlington Heights, IL) for 15
minutes at room temperature.
Imrnunohlotring. Twenty micrograms of cellular proteins or one
third of the immunecomplexes were separated through 7.5% sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)”
and electroblotted onto polyvinylidene difluoride (PVDF) membrane
(Immobilon; Millipore, Bedford, MA) by the standard procedures.”
The membranes were incubated at 4°Covernight in TBST (20 mmoll
L Tris-HCI, pH 7.4, 150 mmollL NaCI, 0.05% Tween 20) with 2%
bovine serum albumin (fraction V; Sigma). The membranes were
incubated with anti-Tec serum (1:10,000) or antiphosphotyrosine
antibody (PY 20; ICN Biomedicals, Irvine, CA) at room temperature
for 1 hour in TBST. After extensively washed with TBST, the membranes were subsequently incubated with protein A/G conjugated
with horseradish peroxidase (Pierce, Rockford, IL) at room temperature for 1 hour in TBST and specific bindings were visualized by the
ECL detection system (Amersham) according to the manufacturer’s
instructions.
Metabolic laheling and phosphoamino acids analysis. For
[‘*P]orthophosphate labeling, 32D cells (1 X IO’lexperiment) were
cultured in phosphate-free RPM1 1640 medium (GIBCO) supplemented with 37 MBqlmL of [”Plorthophosphate (Amersham) without IL-3 or FCS for 2 hours and then stimulated with IL-3 for 5
minutes. Tec was immunoprecipitated from the lysates of these cells,
separated through 7.5% SDS-PAGE, and electroblotted onto PVDF
membranes as described above. After taking autoradiography, parts
of the membrane containing the Tec proteins were excised and boiled
in 5.7 N HCI according tothemethodofKampsand
Sefton.”
Phosphoamino acids were separated by one-dimensional electrophoresis at pH 3.5 on a cellulose thin-layer plate.”
RESULTS
Alternativesplicing of the tec messages. After first reporting the rec cDNA,” we could obtain other cDNAs that
205
117 -b
80 -W
+Tec
Fig 3. Tec type IV is a peptide of 70 kD in vivo. Total cell lysates
of COS-l cells (2 pgllane) transfectedwith either pSSRa vector alone
(Vector) or the tec-expressionconstruct (tecl or total celllysates
of 32D cells 120 p g ) (32D) were subjected to 7.59/0 SDS-PAGE and
immunoblotted with anti-Tec serum. Theposition of Tec is indicated
by an arrow. The positionsof molecularweight standards are shown
at the left (xlo-’)).
can encode different forms of Tec proteins.” The original
cDNA (type l)* and the recently identified one (type
were generated from alternatively spliced tec messages and
can encode different sets of N- and C-termini of the Tec
proteins (Fig 1). Each cDNA of type I and I1 has a specific
insertion of nucleotides at its 5”region (shown as l-A or IIA sequences in Fig 2A), resulting in alteration of the Ntermini of the predicted proteins. However, detailed analyses
including the molar ratio of the two insertions have not been
performed. To show the predominant N-termini of Tec in
hematopoietic cells, the tec cDNA fragments encompassing
the two insertion points were PCR-amplified by the nested
primer sets (denoted by arrows in Fig 2A). As shown in Fig
2B, two major PCR products of 475-bp and 388-bp length
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
MAN0 ET AL
346
A
B
205
aP-Tyr
+Tec
-
80 -
116
aP-Tyr
+Tee
50
0
IC
aTec
1
5
aTec
10 20
C
aP-Tyr
aTec
Fig 4. Induction of tyrosine phosphorylation of Tec. (A) Total cell lysates (20 pg/lane) and immunoprecipitates of normal rabbit
serum
(NRS)or anti-Tec serum (aTec) from 32D cells (1 x 10’ cellslexperiment) with (+) or without (-1 11-3 stimulation (100 UlmL for 5 minutes)
were separated through 7.5% SDS-PAGE and subjected t o immunoblotting with antiphosphotyrosine antibodylaP-Tyr). The same filter was
reprobed with anti-Tec serum (crTec) t o compare the amounts ofTec loaded. The position of Tee is indicated by anarrow. (B) The same set
of experiment as in (AI were performedin BaF3 cells. The positions of molecular weight standards are shown at theleft (xlo-’)). (C) 32D cells
(1 x lo7 cellslexperiment) were starved of IL-3 overnight and restimulated with IL-3 (100 UlmL) for 0, 1, 5, 10, or 20 minutes as indicated at
the top. Tec was immunoprecipitated from each cell lysate and was subjected t o immunoblotting with antiphosphotyrosine antibody (aPTyr). The same filter was reprobed with
anti-Tec serum (crTec).
were amplified in equal amounts. Because the two products
could notbe generated from the reaction without reverse
transcriptase, they were not synthesized from contaminated
genomic DNAbut rather from RNA. DNA sequencing of
the two fragments has shown that the 475-bp product contains both l-A and 11-A insertions (designated as the IA+/
IIA+ fragment), whereas the 388-bp product contains only
11-A (designated as the IA-/HA+ fragment). Based on nucleotide sequences, tec cDNAs containing either the IA+/
IIA+ fragment or the IA-/HA+ fragment should use the
same translation start site used for Tec type
Therefore,
the predominant N-terminus of the Tec kinase should be the
same as that of Tec type 11. As previously reported, the
predominant C-terminus of the Tec kinase is the same as
that of Tec type 1.l3 Thus, Tec proteins with the type II-N-
terminus and the type l-C-terminus should be predominant.
We could observe that Tec proteins of this form are predominant not only in hematopoietic cells but also in liver (data
not shown). In addition, two forms of the Tec SH3 domain
have been reported to be generated by alternative splicing
of the tec messages.” In conclusion, there should betwo
major forms of the Tec kinase in vivo; both have the same
type 11-N-termini and the type I-C-termini, but differ in the
SH3 domain. We designate them, respectively, as Tec type
I11 (with the truncated SH3 domain) and type IV (with the
full SH3 domain), whose predicted molecular weights are
71 116 and 73604, respectively (Fig 1). In the case of 32D
and BaF3 cells, PCR analysis of the SH3 domain of the tec
messages could identify only the long form of the SH3 domain (type IV) but not the short one (type 111) (data not
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
TEC IS INVOLVED IN IL-3 SIGNALING PATHWAY
shown). Thus, type IV should be the predominant form of
Tec in these cell lines.
IL-3 caninducetyrosine phosphorylation of Tec. First,
anti-Tec serum was verified using COS-l cells expressing
the Tec protein. Total cell lysates of 32D cells and COS-l
cells transfected with either pSSRa alone or pSSRa/tec (type
IV cDNA) were immunoblotted with anti-Tec serum. As
shown in Fig 3, anti-Tec serum could recognize a peptide
of approximately 70 kD specifically in 32D cells and the
tec-transfected COS-l cells, but not in the vector-transfected
A
200 +
117+
80 +
50 +
B
( 4
.
'
2
.
cells. This peptide could not be detected in the lysate of 3T3
cells that do not express the tec message endogenously (data
not shown). Therefore, we conclude that Tec type IV is a
peptide of 70 kD in vivo. A peptide of approximately 80 kD
observed in Fig 3, lane 32D, is of the nonspecific binding
of protein NG-horseradish peroxidase, because this band
could not be observed when a different detection system
with alkaline phosphatase was used (data not shown). To
analyze the role of Tec in the IL-3 signaling pathway, tyrosine-phosphorylation of Tec was investigated in an IL-3dependent myeloid cell line, 32D (Fig 4A). Total cell lysates,
normal rabbit serum immunoprecipitates, and anti-Tec serum
immunoprecipitates from 32D cells were immunoblotted
with antiphosphotyrosine antibody (aP-Tyr part). IL-3 stimulation results in the induction of tyrosine phosphorylation
of pp7OTCc.
The same filter was reprobed with anti-Tec serum
to compare the amount of the Tec proteins immunoprecipitated (aTec part). To show that Tec is involved in the IL-3
signaling system in lymphoid cells as well as in myeloid
cells, the same set of experiments was performed in an IL3-dependent pro-B-cell line, BaF3. As shown in Fig 4B,
Tec is also inducibly tyrosine-phosphorylated in BaF3 cells
with the stimulation of IL-3. Next, the time-course of Tec
phosphorylation by the IL-3 stimulation was investigated in
32D cells. As shown in Fig 4C, tyrosine phosphorylation of
pp70T" reaches to the maximum at 1 to 10 minutes after the
IL-3 stimulation and decreases thereafter.
Phosphorylation level of Tec. To confirm the effect of
L - 3 on Tec phosphorylation, Tec was immunoprecipitated
from the lysates of 32D cells metabolically labeled with
[32P]orthophosphateand was blotted onto PVDF membrane.
An autoradiogram of the membrane shows that 5 minutes
of IL-3 stimulation could induce phosphorylation of pp7OTec
(Fig 5A). The parts of the membrane containing the Tec
proteins were subsequently excised and boiled in 5.7 N HCI.
One-dimensional electrophoresis of the acid-hydrolyzed
peptides shows that Tec is faintly phosphorylated on serine
and threonine residues in the absence of IL-3 (Fig 5B, -).
In contrast, IL-3 stimulation could induce phosphorylation
of all serine, threonine and tyrosine residues (Fig 5B, IL-3).
IL3 can induce kinase activity of Tec. Tec was immunoprecipitated from 32D cells at various periods after
L 3 stimulation and was subjected toin vitro kinase assay without exoge-
4
IL-3
8
347
p-Ser
p-Thr
Fig 5. Phosphoamino acids contents of Tec. (A) Tec lafec) was
immunoprecipitatedfrom cell lysatesof 32D cells l1 x lo7cellslexperimentl metabolically labeled with 13'Plorthophosphatewith (IL-3) or
without (-1 IL-3 stimulation (5 minutes) and was subjected to 7.5%
SDS-PAGE. Normal rabbit serum immunoprecipitatesINRS) from the
corresponding cells are also subjected to 7.5% SDS-PAGE. The proteins were electrotransferredonto PVDF membrane and autoradiographed. The positions of molecular weight standards are shown at
the left IxlO-'). (B)The parts of the membrane containing the Tec
protein immunoprecipitatedfrom 320 cells with IIL-31 orwithout (-1
the IL-3 stimulation were excised and subjected
to thephosphoamino
acidanalysis.Acid-hydrolyzedTee
was separatedbyone-dimensional electrophoresis at pH 3.5 on a cellulose thin-layer plate. The
positions of phosphoserine (p-Ser), phosphothreonine (p-Thr), and
phosphotyrosine (p-Tyr) are indicated at the right. The regions of
migration of the unlabeled phosphoamino acids aremarked by dotted lines.
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
MAN0 ET AL
348
0
5
io
20 30 40
Fig 6. In vitro kinase assay of Tec. After starvation
of IL-3.32D cells were stimulated with IL-3 for 0,5,10,
20,30, or 40 minutes as indicated at thetop. Tec was
immunoprecipitatedfrom each fraction and subjected
to in vitro kinase assaywithout exogenous substrates.
The positions of Tec, p68, p63, and p58 are shown.
noussubstrates.Asshown
in Fig 6, stimulationwith L 3
induced a phosphorylation level of Tec (indicated by an arrow),
p68, and p63. The kinase activity reached
its maximum 5 to
10 minutes after the IL-3 stimulation. Faint phosphorylationof
another cellular protein (p58) can be recognized when the Tec
kinase activity reaches the maximum (lanes 5 and IO).
Tec can associate with Shc in vivo. We then investigated
the role of Tec in vivo. The Shc protein is an adapter peptide
containing an SH2 motif, and overexpression of Shc can
transform NIH 3T3 fibroblasts.2sShc is known to transduce
mitogenic signals from PTKs to the Ras pathway through
the association with Grb-2 and SOSproteins.2hBecause Shc is
abundantly expressed in hematopoietic tissues, we examined
whether Tec is involved in the Shc-mediated signalings.
Anti-Shc immunoprecipitates from BaF3 cells with or without the IL-3 stimulation were blotted with anti-Tec serum.
As shown in Fig 7, Tec was shown to be associated with
Shc protein irrespective of IL-3 stimulation. Therefore, Tec
is capable of making a stable complex with Shc in vivo.
DISCUSSION
We have characterized the Tec protein-tyrosine kinase in
hematopoietic cell lines, showing the predominant structure
of the Tec protein and its involvement in the IL-3 signaling
pathway.
We show here that type 111 and type IV of Tec are the
predominant forms in mouse tissues. Although these two
types of Tec could be indeedidentified in several mouse
organs, only type IV could be observed in all hematopoietic
cell lines examined (Sato et al, personal communication,
July 1994). The difference of biologic roles between type
111 and IV is currently under investigation. There have been
several reports of alternatively spliced messages for cytoplasmic PTKs. Neuronal c-Src has a six-amino acid insertion
in its noncatalytic domain2’ anda totally different open reading frame can be usedfroman alternatively spliced c-src
message in chicken skeletal muscle.2RAmino acid insertions
are also reported in the Lyn protein.29The N-terminal alteration of PTKs is known in the case of c-Abl.’ There are four
different c-Ab1 mRNAs with divergent 5”termini; only one
of them (type IV) can encode a peptide with a myristylation
signal. Thus, alternative splicing mechanismcanregulate
subcellular localization of PTKs.In our present report, neither form of Tec type 111 or type IV has putative myristylation sites or C-terminal tyrosine residues corresponding to
Tyr-527 in c-Src. The biologic significance of the two predominant forms of 5”region in the tec message is yet to be
shown. Both types of cDNAs encode the same N-terminus
of Tec, but they differ in the 5”noncoding region. Marth et
a!’’ reported that deletion of 5”noncoding sequence of the
Ick message, including 3 ATG sequences, significantly increased translational efficiency of ~ 5 6 They
. ~found
~ that
morethan 65% of mammalian genes withsuch5’-ATG
sequences are proto-oncogenes. Messages of fgr, fin, hck,
Ick, and src actually possess the multiple 5’-ATG sequences
that are not used for the translational start sites. Thus, they
hypothesized that presence of multiple ATG sequences in
the 5”noncoding region of PTK messages suppresses their
translational efficiency in vivo and prevents malignant transformation. Interestingly, the IA sequence in the tec message
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
349
TECIS INVOLVED IN IL-3SIGNALINGPATHWAY
IL-3
4- Tec
4- IgH
in the system of myeloid cells. Although IL-3or granulocytemacrophage colony-stimulating factor can induce tyrosine
phosphorylation in a set of cellular proteins in myeloid cells,
it was unclear what kinases mediate such signals in vivo.
Recently, Jak-2 has been shown to be activated in response
to erythropoietin," IL-3;' and IL-6..'*However, significance
of Jak-2 in the mitogenic signaling pathways of these cytokines is still obscure. Because Tec is expressed no less than
known cytoplasmic PTKs in myeloidcells,13 it wouldbe
reasonable to presume that the Tec kinase plays an important
role in vivo. We could actually show that Tec is involved
in the stem cell factork-Kit signaling m e c h a n i ~ m .We
~~
could also show that the N-terminal unique domain of Tec
is involved in IL-3 signaling and is associated with the Lyn
kinase in myeloidcells.3" In this report, we haveshown
that IL-3 stimulation can induce tyrosine phosphorylation of
pp7OTC'in myeloid cells as well as in pro-B cells. Furthermore, Tec was shown to associate with Shc in vivo. Although
our data do not fully clarify the function of Tec, they support
the idea thatTec is involvedin the mitogenic signaling mechanism of IL-3. Tec proteins are composed of four domains,
namely, an N-terminal unique domain, an SH3 domain, an
SH2 domain, and a kinase domain. The overall structure of
Tec is, therefore, similar to that of the Src family members.
In contrast, Jak kinases have rather unusual structures. They
are composed of an N-terminal unique domain, a kinase-like
domain, and a kinase domain. They do not contain any SH2
or SH3 motifs. Considering the difference between the structures of Tec and Jakkinases, it is likely that theyare assigned
divergent roles in vivo. Tang et a1'9 could indeed prove that
Tec is involved in the stem cell factodc-Kit signaling system,
while Jak-2 is not. Because IL-3 can exert pleiotropic effects
on hematopoietic cells, Tec and Jak-2 may play differential
roles in the IL-3 signaling pathways.
ACKNOWLEDGMENT
Fig 7. Tec can associate with Shc. The Shc protein was immunoprecipitated from BaF3 cells with (+) or without (-1 11-3 stimulation
and was blotted with anti-Tec serum. The positions of Tec and lg
heavy chain (IgH) are indicated by arrows.
MurineIL-3 was kindlyprovided
(Tokyo, Japan).
by KirinBrewery
CO Ltd
REFERENCES
1. BolenJB:
contains 4 ATG sequences that are not used for the translational start sites of the Tec protein. Therefore, the rec message without the IA sequence may be translated much more
efficiently than that with the I A sequence. We are currently
investigating whether the presence of the IA sequence in the
message may affect the Tec activity in vivo.
Accumulating evidence has proved that several PTKs of
the Src family are involved in the mitogenic mechanism
of lymphocytes. Lck, for example, is associated withand
activated by antibody-stimulated CD4/CD8 molecules in T
cells.7' Hatakeyama et alz2could demonstrate the physical
association of the Lck kinase and the IL-2 receptor. The Fyn
kinase has been revealed to belinked to T-cell receptor
complex.33The Lyn kinase has been also shown to be activated by the stimulation of surface IgM molecules in B
cells.34Importantly, some of them are already known to play
a role in the process of malignant transformation.3s
However, little was understood about such "key kinases"
Nonreceptor tyrosine protein kinases. Oncogene
8:202S,1993
2. Kaplan JM, Mardon G, Bishop JM, Varmus HE: The first Seven
aminoacidsencoded bythev-src
oncogeneact as a myristylation
signal: Lysine 7 is a critical determinant. Mol Cell Biol 8:243S. 1988
3. Hunter T A tail of two src's: Mutatismutandis.Cell 49:l.
I987
4. Pawson T, Gish CD: SH2 and SH3 domains: From structure
to function. Cell 71:359, 1992
S. Wilks AF, Kurban RR: Isolation and structural analysis of
murine c-fes cDNA clones. Oncogene 3:289, 1988
6. Wilks AF, Harpur AG,Kurban RR. Ralph SJ, Ziircher G,
Ziemiecki A: Two novel protein-tyrosine kinases, each with a second
phosphotransferase-related catalytic domain, define a new class of
protein kinase. Mol Cell Biol I1:20S7,1991
7. Ben-Neriah Y, Bernards A, Paskind M, Daley GQ, Baltimore
D: Alternative S' exons in c-ah/ mRNA. Cell 44577. 1986
8. Mano H. lshikawa F, Nishida J, Hirai H. Takaku F: A novel
protein-tyrosine kinase, rec. is preferentially expressed in liver. Oncogene S: 178I , I990
9. Siliciano JD, Morrow TA, Desiderio SV: irk, a T-cell-specific
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
350
tyrosine kinase gene inducible by interleukin 2. Proc Natl Acad Sci
USA89:11194, 1992
IO. Heyeck SD, Berg LJ: Developmental regulation of a murine
T-cell-specific tyrosine kinase gene, Tsk.Proc Natl Acad Sci USA
90:669, 1993
11. Tsukada S, Saffran DC, Rawlings DJ, Parolini 0, Allen RC,
Klisak I, Sparkes RS, Kubagawa H, Mohandas T, Quan S, Belmont
JW, Cooper MD, Conley ME, Witte ON: Deficient expression of a
B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia. Cell 72:279, 1993
12. Vetrie D, Vorechovsky I, Sideras P, HollandJ, Davies A,
Flinter F, Hammarstrom L, Kinnon C, Levinsky R, Bobtce M, Smith
CIE, Bently DR: The gene involved in X-linked agammaglobulinaemia is a member of the src family of protein-tyrosine kinases. Nature
361:226, 1993
13. Mano H, Mano K, Tang B, Kohler M, Yi T, Gilbert DJ,
Jenkins NA, Copeland NG, Ihle JN: Expression of a novel form
of Tec kinase in hematopoietic cells and mapping of the gene to
chromosome 5 near Kit. Oncogene 8:417, 1993
14. Greenberger JS, Sakakeeny MA, Humphries RK, Eaves CJ,
Eckner RJ: Demonstration of permanent factor-dependent multipotential (erythroidneutrophilhasophil) hematopoietic progenitor cell
lines. Proc Natl Acad Sci USA 80:2931, 1983
15. Palacious R, Steinmetz M: IL-3 dependent mouse clones that
express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell 41:727, 1985
16. Gluzman Y: SV4O-transformed simian cells support the replication of early SV40 mutants. Cell 23:175, 1981
17. Sanger F, Nicklwn S, Coulson AR:DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463, 1977
18. Smith DB, Johnson KS: Single-step purification of polypeptides expressed in Escherichia coli as fusions withg1utathione-Stransferase. Gene 67:31, 1988
19. Toyoshima H, Kozutsumi Y, Maru K, Hagiwara K, Furuya
A, MiohH, Hanai N, Takaku F, Yazaki Y, Hirai H: Differently
spliced cDNAs of human leukocyte tyrosine kinase receptor tyrosine
kinase predict receptor proteins with and without a tyrosine kinase
domain and a soluble receptor protein. ProcNatlAcad Sci USA
90:5404, 1993
20. Sambrook J, Fritsch EF, Maniatis T (eds): Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1989
2 1. Laemmli UK: Cleavage of structural proteins during the assembly of the bead of bacteriophage T4. Nature 227:680, 1970
22. Harlow E, Lane D (eds): Antibodies: A Laboratory Manual.
Cold Spring Harbor, NY, Cold Spring Harhor Laboratory, 1988
23. Kamps MP, Sefton BM: Acid and base hydrolysis of phosphoproteins houndto Immobilon facilitates analysis of phosphoamino acids in gel-fractionated proteins. Anal Biochem. 176:22,
1989
24. Hunter T, Sefton B: Transforming gene product of Rous sarcoma virus phosphorylates tyrosine. Proc NatlAcadSciUSA
77:1311, 1978
25. Pelicci G, Lanfrancone L, Grignani F, McGlade J, Cavallo
MAN0 ET AL
F, Forni G , Nicoletti I, Grignani F, Pawson T, Pelicci PG: A novel
transforming protein (SHC) withan SH2 domain is implicated in
mitogenic signal transduction. Cell 70:93, 1992
26. Skolnik EY, Lee C-H, Batzer A,Vicentini LM, Zhou M,
Daly R, Myers JMJ, Backer JM, Ullrich A, White MF, Schlessinger
J: The SH2/SH3 domain-containing protein Grb2 interacts with tyrosine-phosphorylated IRSl and Shc: Implications for insulin control
for ras signalling. EMBO J 12:1929, 1993
27. Martinez R, Mathey-Prevot B, Bernards A, Baltimore D: Neuronal pp60"'" contains a six-amino acid insertion relative to its nonneuronal counterpart. Science 237:411, 1987
28. Dorai T, Wang L-H: An alternative non-tyrosine protein kinase product of the c-src gene in chicken skeletal muscle. Mol Cell
Biol 10:4068, 1990
29. Yi T, Bolen JB, Ihle JN: Hematopoietic cells express two
forms of lyn kinase differing by 21 amino acids in the amino terminus.Mol Cell Biol 11:2391, 1991
KE, Krebs EG, Perlmutter RM:
30. Marth JD, Overell RW, Meier
Translational activation of the lck proto-oncogene. Nature332171, 1988
3 1. Abraham N, Miceli MC, Parnes JR, Veillette A: Enhancement
of T-cell responsiveness by the lymphocyte-specific tyrosine kinase
p56"*. Nature 350:62, 1991
32. Hatakeyama M, Kono T, Kobayashi N, Kawahara A, Levin
SD, Perlmutter RM, Taniguchi T: Interaction of the IL-2 receptor
with the src-family kinase p561ck: Identification of novel intermolecular association. Science 252:1523, 1991
33. Samelson LE, Phillips AF, Luong ET, Klausner RD: Association of the fyn protein-tyrosine kinase with the T-cell antigen receptor. Proc Natl Acad Sci USA 87:4358, 1990
34. Yamanashi Y, Fukui Y, Wongsasant B, Kinoshita Y, Ichimori
Y, Toyoshima K, Yamamoto T: Activation of Src-like protein-tyrosine kinase Lyn and its association with phosphatidylinositol 34%
nase upon B-cell antigen receptor-mediated signaling. Proc Natl
Acad Sci USA 89: 1 l 18, 1992
35. Marth JD, Peet R, Krebs EG, Perlmutter RM: A lymphocytespecific protein-tyrosine kinase gene is rearranged and overexpressed
in the murine T cell lymphoma LSTRA. Cell 43:393, 1985
36. Witthuhn BA, Quelle F W , Silvennoinen 0, Yi T, Tang B,
Miura 0, Ihle JN: JAK2 associates with the erythropoietin receptor
and is tyrosine phosphorylated and activated following stimulation
with erythropoietin. Cell 74:227, 1993
37. Silvennoinen 0, Witthuhn BA, Quelle F W , Cleveland JL, Yi
T, Ihle JN: Structure of the murine Jak2 protein-tyrosine kinase and
its role in interleukin 3 signal transduction. Proc Natl Acad Sci USA
90:8429, 1993
38. Shuai K, Ziemiecki A, Wilks A, Harpur AG, Sadowski HB,
Gilman MZ, Damell JE: Polypeptide signalling tothe nucleus
through tyrosine phosphorylation of Jak and Stat proteins. Nature
366580, 1993
39. Tang B, Mano H,Yi T, Ihle JN: Tec kinase associates with
c-Kit and is tyrosine phosphorylated and activated following stem
cell factor binding. Mol Cell Biol (in press)
40. Mano H, Sato K, Yazaki Y, HiraiH: Tec protein-tyrosine
kinase directly associates with Lyn protein-tyrosine kinase through
its N-terminal unique domain. Oncogene 9:3205, 1994
From www.bloodjournal.org by guest on June 18, 2017. For personal use only.
1995 85: 343-350
Tec protein-tyrosine kinase is involved in interleukin-3 signaling
pathway
H Mano, Y Yamashita, K Sato, Y Yazaki and H Hirai
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/2/343.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.