Download Analysis of the root-hair morphogenesis transcriptome reveals the

The Plant Journal (2006) 45, 83–100
doi: 10.1111/j.1365-313X.2005.02609.x
Analysis of the root-hair morphogenesis transcriptome
reveals the molecular identity of six genes with roles in
root-hair development in Arabidopsis
Mark A. Jones, Marjorie J. Raymond and Nicholas Smirnoff*
School of Biosciences, University of Exeter, Geoffrey Pope Building, Stocker Road, Exeter EX4 4QD, UK
Received 8 June 2005; revised 30 August 2005; accepted 20 September 2005.
*
For correspondence (fax þ44 1392 26 3700; e-mail [email protected]).
Summary
Root-hair morphogenesis is a model for studying the genetic regulation of plant cell development, and doublemutant analyses have revealed a complex genetic network underlying the development of this type of cell.
Therefore, to increase knowledge of gene expression in root hairs and to identify new genes involved in roothair morphogenesis, the transcriptomes of the root-hair differentiation zone of wild-type (WT) plants and a tipgrowth defective root-hair mutant, rhd2-1, were compared using Affymetrix ATH1 GeneChips. A set of 606
genes with significantly greater expression in WT plants defines the ‘root-hair morphogenesis transcriptome’.
Compared with the whole genome, this set is highly enriched in genes known to be involved in root-hair
morphogenesis. The additional gene families and functional groups enriched in the root-hair morphogenesis
transcriptome are cell wall enzymes, hydroxyproline-rich glycoproteins (extensins) and arabinogalactan
proteins, peroxidases, receptor-like kinases and proteins with predicted glycosylphosphatidylinositol (GPI)
anchors. To discover new root-hair genes, 159 T-DNA insertion lines identified from the root-hair morphogenesis transcriptome were screened for defects in root-hair morphogenesis. This identified knockout
mutations in six genes (RHM1–RHM6) that affected root-hair morphogenesis and that had not previously been
identified at the molecular level: At2g03720 (similar to Escherichia coli universal stress protein); At3g54870
(armadillo-repeat containing kinesin-related protein); At4g18640 (leucine-rich repeat receptor-like kinase
subfamily VI); At4g26690 (glycerophosphoryl diester phosphodiesterase-like GPI-anchored protein);
At5g49270 (COBL9 GPI-anchored protein) and At5g65090 (inositol-1,4,5 triphosphate 5-phosphatase-like
protein). The mutants were transcript null, their root-hair phenotypes were characterized and complementation testing with uncloned root-hair genes was performed. The results suggest a role for GPI-anchored
proteins and lipid rafts in root-hair tip growth because two of these genes (At4g26690 and At5g49270) encode
predicted GPI-anchored proteins likely to be associated with lipid rafts, and several other genes previously
shown to be required for root-hair development also encode proteins associated with sterol-rich lipid rafts.
Keywords: glycosylphosphatidylinositol-anchored proteins, root-hair morphogenesis, lipid rafts, tip growth,
differential gene expression, T-DNA insertion mutants.
Introduction
Root hairs are highly polarized cellular structures resulting
from tip growth of specific root epidermal cells. Root-hair
morphogenesis, which forms a model system for studying
polarized plant cell growth, can be subdivided into three
major stages: swelling formation (referred to hereafter as
root-hair initiation), the transition to tip growth and tip
growth (Dolan et al., 1994). Root-hair initiation is the earliest
visible stage of root-hair morphogenesis and is characterª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd
ized by changes in cytoplasmic and cell wall pH at the site of
root-hair development (Bibikova et al., 1998). Root-hair tip
growth requires highly directed delivery of cell wall and
membrane material to the growing tip, followed by wall
assembly and cross-linking. Growing root hairs readily burst
at their tips if perturbed, indicating the delicate balance
between growth and cell wall assembly. Expansins (Cho
and Cosgrove, 2002) and xyloglucan endotransglycosylase
83
84 Mark A. Jones et al.
activity (Vissenberg et al., 2001) have been localized in
growing root hairs. Coordination of tip growth involves both
the actin cytoskeleton (Baluška et al., 2000; Miller et al.,
1999) and microtubules (Bibikova et al., 1999). It is also
characterized by influx of Ca2þ at the tip and a tip-high
intracellular Ca2þ gradient (Bibikova et al., 1997; Schiefelbein et al., 1992; Véry and Davies, 2000; Wymer et al., 1997)
and requires tip-localized reactive oxygen species (ROS)
produced by an NADPH oxidase (Foreman et al., 2003). The
small guanosine triphosphatase (GTPase) ROP2 regulates
both root-hair initiation and tip growth (Jones et al., 2002).
Much remains to be discovered about how these multiple
components interact to produce organized tip growth.
Root hairs are not required for plant viability under
laboratory growth conditions, making it easy to screen for
mutant lines with abnormal root-hair phenotypes. To date,
some 40 different genes have been identified that affect one
or more stages of root-hair morphogenesis (Grierson and
Schiefelbein, 2002; Grierson et al., 2001), and single- and
double-mutant analyses have revealed a complex morphogenetic network in growing root hairs (Parker et al., 2000).
More root-hair genes await identification as the number of
alleles identified so far for known root-hair genes suggests
that mutant screens have not yet reached saturation (Parker
et al., 2000). Transcriptome analysis potentially provides an
alternative route for identifying genes involved in root-hair
morphogenesis. Ribonucleic acid could be sampled from
individual growing hairs, but although this is technically
possible (Jones and Grierson, 2003) another approach is to
compare the transcriptome in the root-hair differentiation
zone (RHDZ) between wild-type (WT) plants with normal
hairs with a mutant defective in root-hair morphogenesis. In
this case, genes that are highly expressed in root hairs would
be predicted to have lower expression in a mutant with
defective root-hair development than in WT plants. The
results of this approach are reported here using a comparison of the transcriptome of the RHDZs of WT Arabidopsis
thaliana plants and the rhd2-1 (root hair defective) mutant
(Parker et al., 2000; Schiefelbein and Somerville, 1990). This
mutant lacks the RHD2 transcript (M. A. Jones and
N. Smirnoff, unpublished results) and has normal root-hair
initiation but fails to make the transition to tip growth
(Wymer et al., 1997). RHD2 has recently been identified as an
NADPH oxidase (NOX) homologue (AtrbohC; Foreman
et al., 2003), of which there are nine others in A. thaliana.
The NOXs produce extracellular superoxide and, as well as
their role in root-hair growth, are involved in pathogen
responses (Torres et al., 2002), ABA-induced stomatal closure (Kwak et al., 2003) and other aspects of plant development (Sagi et al., 2004). Using the set of genes more highly
expressed in the WT RHDZ as the basis for the targeted
screening of T-DNA ‘knockout’ mutant collections, the
molecular identification of six genes with roles in root-hair
morphogenesis is reported. None of these root-hair genes
have previously been identified at the molecular level. The
results provide an insight into genome-wide gene expression during root-hair morphogenesis. Analysis of this roothair morphogenesis transcriptome also reveals that genes
encoding extensins, leucine-rich repeat proteins, receptorlike kinases and glycosylphosphatidylinositol (GPI)-anchored proteins are highly enriched, and suggests a role
for lipid rafts in the organization of root-hair tip growth.
Results
Global analysis of gene expression in the Arabidopsis
thaliana root-hair differentiation zone
Total RNA was extracted from pooled RHDZs dissected from
the primary roots of WT and rhd2-1 (Foreman et al., 2003;
Parker et al., 2000; Schiefelbein and Somerville, 1990;
Wymer et al., 1997) plants. There were three biological replicates for each genotype, the RNA being extracted from
plants grown under identical conditions but at different
times. Complementary RNA was prepared from each of
these six samples and was hybridized to an Affymetrix ATH1
GeneChip (Santa Clara, CA, USA). The data are deposited at
ArrayExpress (http://www.ebi.ac.uk/arrayexpress/; accession number E-NASC-54) and at the NASC Affymetrix service (http://affymetrix.arabidopsis.info/). The normalized
data from the three WT and three rhd2-1 GeneChips were
analysed by one-way analysis of variance without multiple
comparison correction. This showed that 660 genes had
significantly higher expression in the WT RHDZ compared
with the rhd2-1 RHDZ (P < 0.01), while 313 genes had higher
expression in the rhd2-1 RHDZ compared with the WT RHDZ
(P < 0.01). The genes that were more highly expressed in the
rhd2-1 RHDZ are not considered further. Eliminating genes
that were not called as present in all three biological replicates further filtered the 660 genes more highly expressed in
the WT RHDZ. This resulted in a list of 606 genes (Supplementary Table S1). Of these genes, 139 were differentially
expressed at P < 0.001 and 16 at P < 0.0001. The numbers
of genes (at P < 0.01) with two-, four- or 10-fold higher
expression in the WT RHDZ were 330, 87 and 17, respectively. At5g04730 has the greatest differential expression
(142-fold) and was called as not detectable in rhd2-1. This
gene is currently of unknown function.
Supplementary Table S2 shows a functional analysis,
using gene ontologies (GOs) from TAIR (http://www.
arabidopsis.org/), of the 87 genes that are fourfold or more
highly expressed in the WT RHDZ than in the rhd2-1 RHDZ,
compared with the whole genome. In terms of cellular
localization there are excesses of genes associated with
membranes and the extracellular matrix/cell wall. In terms of
molecular function there is an excess of genes associated
with structural molecules, nucleic acid binding and, less
strongly, with transport. For biological processes there are
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 85
excesses of genes predicted to be involved in cell organization, signal transduction and developmental processes.
Overall, this pattern is consistent with enrichment in signalling processes associated with membranes, cell wall synthesis and growth in the WT RHDZ. This analysis indicates
that the representation of functional categories in subsets of
genes more highly expressed in the WT RHDZ than in the
rhd2-1 RHDZ differs from the whole genome but the GO is
Table 1 Functional categorization and expression of 314 genes that
are more than twofold (P < 0.01) more highly expressed in the roothair differentiation zone of wild-type Arabidopsis thaliana plants
compared with the rhd2-1 mutant. The proportion of genes in each
category (%), the median expression level and the median ratio of
expression (WT/rhd2-1) are shown. The complete gene list and
annotations are shown in Supplementary Table S1
% of genes Expression Ratio
Cell wall enzymes
Leucine-rich repeat (LRR) proteins
Calcium signalling
Pathogen response
Redox processes
Proteases
Extensins
Metabolism
Membrane transport
Protein kinases
Signal transduction
Peroxidases
Intracellular trafficking
Cytoskeleton
Transcription factors
4.5
5.1
2.9
5.1
1.9
3.5
7.6
5.7
3.8
7.6
5.7
1.9
7.0
4.8
3.8
1441
155
165
297
365
119
1069
223
263
110
157
1688
184
210
161
4.2
3.5
3.4
3.2
3.2
3.1
3.0
2.9
2.9
2.9
2.8
2.7
2.7
2.5
2.4
not sufficiently detailed to identify categories of genes that
are over-represented. This was investigated in more detail in
two ways. Firstly, genes with twofold higher expression in
the WT RHDZ than in the rhd2-1 RHDZ (P < 0.01) were
classified into functional groups (Supplementary Table S1).
The results are summarized in Table 1 and show the
frequency of each group along with median expression
level and fold difference. This analysis indicates that cell
wall-related transcripts (mostly cell wall enzymes) are the
most differentially expressed and have high abundance.
Extensin (cell-wall localized proline and hydroxyproline-rich
glycoproteins) transcripts also have high expression and are
abundant. This would be expected since root-hair tip growth
requires continual cell wall synthesis. There is also a high
proportion of transcripts with putative roles in intracellular
trafficking. Interestingly, leucine-rich repeat (LRR) protein
transcripts are frequent and differentially expressed, along
with transcripts related to calcium signalling and protein
kinases, suggesting a high level of signalling activity. The
other prominent groups are peroxidases and genes related
to pathogen response and redox homeostasis. The second
analytical approach was to choose defined sets of genes
based on the previous analysis and to compare their
frequency in the subset of genes more highly expressed in
the WT RHDZ than in the rhd2-1 RHDZ, with that in the whole
genome (Table 2). The set of 606 genes more highly
expressed in the WT RHDZ (P < 0.01; Supplementary
Table S1) was used along with the gene sets listed in
Supplementary Table S3. The frequency of genes with
known functions in root-hair morphogenesis (Supplementary Table S3) was 10-fold higher than in the genome as a
Table 2 A comparison of the frequency of selected gene families or functional groups within the whole Arabidopsis thaliana genome and
within the subset of genes more highly expressed in the root-hair differentiation zone of wild-type A. thaliana plants compared with the rhd2-1
mutant. Six hundred and six genes that are more highly expressed in WT compared with rhd2-1 (P < 0.01; see Supplementary Table S1) were
classified into functional groups or gene families. Root-hair gene lists were compiled by M. A. Jones. GPI-anchored proteins, AGPs, receptorlike kinases, monolignols and ABC transporters were from the ‘MATDB tables: protein function’ (http://mips.gsf.de/proj/thal/db/tables/
tables_func_frame.html). Extensins, peroxidases, pathogen response genes and cytochrome P450 oxygenases were compiled from database
searches at TAIR (http://arabidopsis.org/; see Supplementary Table S3 for the gene lists). The frequency (%) of these genes is compared with
their frequency in the whole genome (defined here as the 22 746 genes on the ATH1 GeneChip). The P value indicates the probability that the
frequencies do not differ using the two-tailed Fisher’s exact test (http://www.matforsk.no/ola/fisher.htm#INTRO)
No. of genes in the set
% of all genes in the set
Process/gene family
Genome
WT > rhd2
Genome
WT > rhd2
P-value
Root-hair morphogenesis
Root-hair patterning
Extensins and AGPs
Leucine-rich repeat proteins
Peroxidases
GPI anchor predicted
Receptor-like kinases
Pathogen response
ABC transporters
Cyt P450 oxygenases
Monolignol synthesis
41
17
161
223
72
212
576
79
116
205
58
13
0
26
19
6
14
29
3
2
2
0
0.180
0.075
0.708
0.980
0.317
0.932
2.532
0.347
0.510
0.901
0.255
2.145
0.000
4.290
3.135
0.990
2.310
4.785
0.495
0.330
0.330
0.000
8.89 · 10)10
1.00
3.23 · 10)12
0.000021
0.016
0.0024
0.0016
0.474
0.772
0.184
0.408
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
86 Mark A. Jones et al.
whole. This difference was statistically significant
(P ¼ 8.89 · 10)10) according to Fisher’s exact test (http://
www.matforsk.no/ola/fisher.htm#INTRO). This shows that
differential expression between WT and rhd2-1 does indeed
indicate genes associated with root-hair morphogenesis. In
contrast, the ‘root-hair genes’ involved in root epidermal
patterning, specification of cell fate or auxin and ethylene
signalling (Supplementary Table S1), all of which affect
root-hair development before the transition to tip growth,
when AtrbohC/RHD2 first contributes to root-hair morphogenesis, are not represented in the set of 606 genes
(Table 2). This might be expected, given the rhd2-1 roothair phenotype. Hereafter, this set of 606 genes (Supplementary Table S1) will be referred to as the ‘root-hair
morphogenesis transcriptome’. Extensins and arabinogalactan proteins (AGPs) are also significantly over-represented, along with receptor kinases, proteins with predicted GPI
anchors and peroxidases. Three other sets of genes were
chosen as ‘controls’ because they have no obvious specialized role in root-hair growth or function (ABC transporters,
cytochrome P450 oxygenases and monolignol synthesis).
These groups were not differentially expressed in the roothair morphogenesis transcriptome, when compared with
the whole genome (Table 2).
The reliability of the transcriptome data was tested by
semi-quantitative reverse transcriptase (RT)-PCR of five
transcripts chosen for differing expression level in the RHDZ
of WT and rhd2-1 plants. The plants were grown under
identical conditions to those used for the transcriptome
experiment. The genes were (WT expression level; rhd2-1
expression level) At1g61950 (putative Ca2þ-dependent protein kinase; 99; 6), At4g25220 (putative glycerol 3-phosphate
permease; 832; 31), At4g28850 (xyloglucan endotransglycosylase; 989; 60), At5g49770 (receptor kinase-like protein; 368;
20) and the ubiquitously expressed control gene At5g60390
(elongation factor EF1aA4; 3112; 3272; Nesi et al., 2000). The
relative expression level between genes, and the differences
between WT and rhd2-1, had the same pattern as the
transcriptome data (Figure 1a,b).
Selection and screening of candidate root-hair genes. The
root-hair morphogenesis transcriptome is enriched in genes
already known to affect root-hair morphogenesis, so its
predictive value for identifying new root-hair genes was
tested by targeted screening of insertion mutants. The SALK
T-DNA insertion database (Alonso et al., 2003; http://signal.
salk.edu/cgi-bin/tdnaexpress) was searched for transgenic
lines carrying predicted T-DNA insertions in candidate roothair genes. Around 300 candidate root-hair genes were
selected that had a mean WT expression level of at least 30
and were differentially expressed in the WT RHDZ relative to
the rhd2-1 RHDZ. The strategy was to screen the root-hair
phenotype of a single T-DNA insertion line for each candidate gene selected, thereby maximizing the number of
different genes screened. To increase the likelihood that the
selected T-DNA insertion might result in a transcript null
allele in the corresponding candidate gene, T-DNA insertions with the longest thermal asymmetric interlaced (TAIL)PCR products, that were predicted to lie closest to the 5¢ end
of the coding region, and preferably within an exon, were
selected. From the initial list of around 300 candidate roothair genes, 159 high-ranking candidate T-DNA insertion
lines were selected, corresponding to 159 different differentially expressed genes (Supplementary Table S1). Genes
already known to have roles in root-hair morphogenesis
were excluded (Supplementary Table S3). Small numbers of
seedlings from the segregating T3 generation of each line
were screened for abnormal root-hair morphogenesis.
Some of these plants had obvious root-hair defects. However, to avoid missing possible subtle root-hair phenotypes,
plants with root-hair phenotypes that only differed slightly
from those of WT plants grown at the same time and under
identical growth conditions were also selected. Twelve different lines were self-fertilized to produce a T4 generation. If
the phenotypes observed in the segregating T3 populations
were caused by recessive loss-of-function mutations the
self-fertilized plants would be homozygous at the affected
locus resulting in all progeny having the same mutant roothair phenotype. However, if the abnormal phenotypes were
artefacts caused by other environmental factors (e.g. differences in light conditions, density of plants, roots being in
contact with the bottom of the Petri dish, etc.), all the T4
progeny would have a WT root-hair phenotype. It is possible
that some of the plants selected from the segregating T3
populations might have been heterozygous and semidominant, with the corresponding homozygous plants being
lethal. However, there was no segregation of phenotypes
within the progeny of surviving self-fertilized plants; progeny that survived either had all mutant or all WT root-hair
phenotypes. Heritable root-hair phenotypes were identified
as a result of this screen in 7 of the 12 self-fertilized candidate
T-DNA insertion lines. One of these seven T-DNA insertion
lines, SALK_002124, is predicted to carry an insertion in
At4g34580 (WT expression 804, rhd2-1 expression 104, WT/
rhd2-1 ratio 7.8), which was confirmed by PCR (data not
shown). This gene, which is identical to the root-hair gene
COW1 (Grierson et al., 1997; Parker et al., 2000), has recently
been identified as a member of a novel class of plant phosphatidylinositol transfer protein (PITP)-like proteins (Böhme
et al., 2004; Kapranov et al., 2001) and is not discussed
further here.
For each of the six other candidate T-DNA insertion lines,
PCR was used to verify the presence of the T-DNA insertion
in the corresponding gene, as annotated in the SIGnAL
database (http://signal.salk.edu/cgi-bin/tdnaexpress). The
presence of the T-DNA insertion in the corresponding gene
was confirmed in all six lines (Figure 1c). Polymerase chain
reaction also distinguished between homozygous and
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 87
(a)
(b)
(c)
(d)
(e)
Figure 1. Reverse transcriptase PCR confirmation of transcriptomics data and transcript null status of T-DNA ‘knockout’ lines and PCR confirmation of transgenic
genotypes.
(a, b) Reverse transcriptase PCR confirmation of expression level from transcriptomics data of four randomly selected genes. The EF1aA4 positive control primer pair
resulted in a similar level of amplification from first-strand cDNA derived from RNA extracted from both WT and rhd2-1 RHDZs. Primer pairs designed against the
genes At1g61950, At4g25220, At4g28850 and At5g49770 resulted in lower amplification from rhd2-1 cDNA compared with WT cDNA. The cycle number was varied to
confirm that PCR amplification was in the linear phase. a: Gel images showing bands of expected size. b: Semiquantitative data based on relative pixel intensity of
bands shown in (a).
(c, d) Simultaneous confirmation of the site of each T-DNA insertion and identification of homozygous lines by PCR.
(c) Primary T-DNA insertion lines.
(d) Secondary T-DNA insertion lines.
(e) Reverse transcriptase PCR confirmation of transcript null status of T-DNA ‘knockout’ lines. The EF1aA4 positive control primer pair resulted in a similar level of
amplification from RNA extracted from whole root tissue of both WT plants and plants carrying T-DNA insertions. Primer pairs designed against genes
corresponding to five of the six primary T-DNA insertion lines resulted in amplification of a product of expected size from WT root RNA, but not from RNA extracted
from roots of the corresponding T-DNA insertion lines. The primer pair designed against the sixth gene, At4g18640 (MRH1), amplified a product of expected size
from both WT root RNA and RNA extracted from SALK_004879 (mrh1-1) roots, albeit at a much reduced level compared with WT root RNA. A new primer pair
designed against the same gene resulted in amplification of a product of expected size from WT root RNA, but not from RNA extracted from roots of an independent
T-DNA insertion line, SALK_020960 (mrh1-2).
heterozygous individuals. For all six genes, very similar roothair phenotypes were identified in an independent T-DNA
insertion line (Table 3), confirming that the root-hair phenotype of each of the six T-DNA insertion lines was caused by a
T-DNA insertion into the corresponding candidate gene.
Polymerase chain reaction confirmed that each independent
line carried a T-DNA insertion in the same gene as the T-DNA
insertion line used in the initial phenotypic screen
(Figure 1d). For two of the six genes, a third independent
T-DNA insertion line with a root-hair phenotype indistinguishable from that of the other two T-DNA insertion lines
was identified (Table 3). These lines were not characterized
further. These six genes are referred to hereafter as MRH1–
MRH6 (Table 3).
As all the lines were selected for predicted T-DNA
insertions lying close to the 5¢ end of each gene one might
predict that these insertions would result in transcript-null
alleles of the corresponding genes. This was tested by
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
18.69
165
Kerk et al. (2003)
82.56
759
Borner et al. (2003);
73.14
663
Roudier et al. (2002);
59.93
529
Berdy et al. (2001);
At4g26690
At5g49270
At5g65090
Multiple straight hairs
RT-PCR using whole-root RNA. Five of the six initial T-DNA
insertion lines were transcript-null alleles (Figure 1e). However, there was a low level of transcript in mrh1-1 root RNA.
This T-DNA insertion lies within the first intron of MRH1,
suggesting that although transcriptional efficiency may be
greatly reduced, the T-DNA may be spliced out of the
primary transcript. The transcript status in a second T-DNA
insertion line, mrh1-2, which lies within the second exon of
this gene, was also examined. Reverse transcriptase PCR
showed that this line is a transcript-null allele (Figure 1e).
There was no difference in the root-hair phenotype of these
two T-DNA insertion lines (see Figures 3, 4). BLAST searches
against the GenBank nucleotide and protein sequence
databases were used to gain information on the probable
function of each gene (Table 3). Interestingly, two of the
genes are predicted to encode GPI-anchored proteins,
suggesting a possible role for lipid rafts in root-hair
development.
AtrbohC/RHD2 is first required during root-hair morphogenesis for the transition to tip growth and rhd2 loss-offunction mutants are blocked at this stage of development
(Foreman et al., 2003; Parker et al., 2000; Schiefelbein and
Somerville, 1990). As the targeted mutant screen was based
on a comparison of gene expression in WT and rhd2-1 RHDZs
one might expect that genes in the root-hair morphogenesis
transcriptome would be more likely to act during or after this
transition rather than before it. This is because RNA extracted
from the rhd2-1 RHDZ might lack any transcripts that are only
expressed after the transition to tip growth. Consistent with
this hypothesis, most of these six genes are required either
during the transition to tip growth and/or during normal
tip growth only (see Figures 3, 4). However, perhaps surprisingly, some of the genes are also required for normal
root-hair initiation, an event that occurs normally in rhd2 lossof-function mutants (Parker et al., 2000; Wymer et al., 1997).
SALK_042433
(mrh6-1)
SALK_059696
(mrh6-2)
–
Complementation testing
At2g03720
Short, wide burst hairs
SALK_059800
(mrh4-3)
SALK_024208
(mrh5-3)
–
–
Wavy and branched
hairs
Straight hairs with
ballooned bases
Short, wide burst hairs
Inositol-1,4,5-triphosphate (IP3)
5-phosphatase-like protein
COBRA-like gene COBL9 GPI-anchored
protein
Glycerophosphoryl diester
phosphodiesterase (GPDP)-like
GPI-anchored protein
Similar to E. coli universal stress
protein A
105.19
941
Reddy and Day (2001)
76.75
686
Diévart and Clark (2003)
Leucine-rich-repeat (LRR) class of
receptor-like kinases subfamily VI
Kinesin heavy chain (KHC) subfamily
Short straight hairs
–
SALK_020960
(mrh1-2)
SALK_081412
(mrh2-2)
SALK_144302
(mrh3-2)
SALK_020771
(mrh4-2)
SALK_124152
(mrh5-2)
SALK_004879
(mrh1-1)
SALK_035063
(mrh2-1)
SALK_139271
(mrh3-1)
SALK_099933
(mrh4-1)
SALK_056562
(mrh5-1)
At3g54870
Gene
At4g18640
Third
insertion
Second
insertion
First
insertion
Table 3 T-DNA insertion mutants in six root-hair genes
Root-hair
phenotype
Gene product
Reference
Number of amino
acid residues
Predicted
molecular
weight (kDa)
88 Mark A. Jones et al.
In the mutant screen any root-hair genes that have already
been cloned (Grierson and Schiefelbein, 2002; Grierson
et al., 2001; Supplementary Table S3) were removed, so
none of the six root-hair genes have been identified previously at the molecular level. However, five of the corresponding loci map relatively close to known root-hair genes
that have not yet been cloned (Parker et al., 2000; Figure 2a).
It is possible that some of the T-DNA insertion lines are
allelic to one of these existing root-hair mutants. To examine
this possibility complementation testing was carried out by
crossing T-DNA insertion mutant lines with any mutants of
uncloned root-hair genes that map to the same chromosome (Table 4). Uncloned root-hair genes that map to the
opposite end of the same chromosome were excluded. As
there are no uncloned root-hair genes on chromosome II
MRH6 must be a previously unidentified root-hair gene.
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 89
Figure 2. Complementation testing.
(a) Genetic and physical maps showing relative positions of uncloned root-hair genes (genes not underlined on the genetic map) and the six genes identified in this
paper (arrows indicate approximate positions on the physical map).
(b) Root-hair phenotypes of shv2-1 and mrh4-1, and shv3-1 and mrh5-1 parents, together with the F1 progeny from the corresponding crosses. RHD4 maps to
chromosome IV (Wang et al., 2001). Genetic map in (a) reproduced with permission from Parker et al. (2000). Bar ¼ 150 lm.
There were no similarities between the root-hair phenotypes
of T-DNA insertion mutants mrh1-1, mrh2-1 and mrh3-1, and
the loss-of-function mutants for the four uncloned root-hair
genes that they were crossed with (cen2, bst1, rhd4, shv3;
Galway et al., 1999; Parker et al., 2000; Schiefelbein and
Somerville, 1990). However, the root-hair phenotypes of
T-DNA insertion mutants mrh4-1 and mrh5-1 closely
resembled both each other and the uncloned root-hair
mutants shv2-1 and shv3-1, which map to chromosomes V
and IV, respectively (Figure 2b; Parker et al., 2000). All the
progeny from the crosses involving the T-DNA insertion
mutants mrh1-1, mrh2-1 and mrh3-1 had WT root hairs (data
not shown). This means that these insertions cannot lie
within the same genes mutated in the uncloned root-hair
mutants. These three genes therefore represent previously
unidentified root-hair genes. However, all of the progeny
from the crosses between mrh5-1 and shv3-1 and between
mrh4-1 and shv2-1 had abnormal root-hair phenotypes closely resembling both parents (Figure 2b), strongly suggesting that SHV3 is MRH5 and that SHV2 is MRH4 (Table 4).
Detailed characterization of mutant root-hair phenotypes
Surprisingly, mutants in only one of the root-hair genes,
mrh1, are specifically disrupted in root-hair tip growth.
Mutants in the other five genes (mrh2–mrh6) are either also
affected in the transition to tip growth but not in root-hair
initiation (mrh2, mrh4, mrh5), or in root-hair initiation and
the transition to tip growth but not in tip growth itself (mrh3,
mrh6).
Tip-growth specific mutations
MRH1 (WT expression 434, rhd2-1 expression 148, WT/rhd2-1
ratio 2.9) encodes a predicted 77 kDa member of subfamily VI
of the LRR class of receptor-like kinases (Diévart and Clark,
2003). Root hairs of mrh1 plants are significantly shorter than
WT root hairs (Figures 3a, 4f) and have a slightly wider hair
shank (Figure 4c) but otherwise root-hair development is
normal (Figures 3b, 4). These mutant phenotypes suggest
that MRH1 is not required for root-hair initiation or for the
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
90 Mark A. Jones et al.
Figure 3. Root-hair phenotypes of T-DNA insertion mutants.
(a) Comparison of length and shape of root hairs in primary and secondary T-DNA insertion lines relative to WT root hairs.
(b) Bases of representative root hairs of a T-DNA insertion mutant for each gene. Bar in (a) ¼ 150 lm. Bar in (b) ¼ 25 lm.
transition to tip growth but is required specifically for root
hairs to fully elongate during tip growth.
Transition to tip-growth and tip-growth mutants. MRH2 (WT
expression 210, rhd2-1 expression 67, WT/rhd2-1 ratio 3.1)
encodes a predicted 105 kDa armadillo repeat containing
kinesin-related protein from an unnamed subfamily of plant
kinesin-related proteins showing greatest amino acid sequence homology to the kinesin heavy chain (KHC) subfamily (Reddy and Day, 2001). Root hairs of mrh2 plants are
of similar length to WT hairs (Figures 3a, 4f) but are wavy
(Figure 3a,b). Time-lapse imaging of individual mutant root
hairs revealed that this waviness is the result of a repeated
reorientation of the direction of tip growth (Supplementary
Video Clip S1). In addition, hairs of mrh2 plants are wider
at their base (Figures 3b, 4b) and are often branched
(Figures 3b, 4i). These plants also have an increased number
of root hairs per millimetre of primary root (Figure 4j);
however, as mutations in this gene do not affect the number
of hair-forming sites per cell (Figure 4h) this difference can
be explained by the hair-bearing epidermal cells being
shorter in these mutants than in WT plants (Figure 4k).
Therefore MRH2 is required for maintaining straight tip
growth, and for the maintenance of a single growing tip, but
not for tip growth itself. The wide base of these mutant hairs
also suggests that MRH2 has a role during the transition to
tip growth.
MRH5 (WT expression 895, rhd2-1 expression 312, WT/
rhd2-1 ratio 2.9) encodes a predicted 83 kDa putative glycerophosphoryl diester phosphodiesterase (GPDP)-like GPIanchored protein (Goo et al., 1999). MRH4 (WT expression
763, rhd2-1 expression 371, WT/rhd2-1 ratio 2.1) is the
COBRA-like gene COBL9 (Roudier et al., 2002), which
encodes a predicted 73 kDa protein. COBRA is a
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 91
Table 4 Complementation testing
T-DNA
insertion
line
Root-hair
mutants
tested
Complemented
(Y/N)
Armadillo-repeat containing
kinesin-related protein
mrh2-1
rhd4
N
Leucine-rich-repeat (LRR) class
of receptor-like kinase
Glycerophosphoryl diester
phosphodiesterase (GPDP)-like
protein
COBRA-like gene COBL9
Inositol-1,4,5-triphosphate (IP3)
5-phosphatase-like protein
Inositol-1,4,5-triphosphate (IP3)
5-phosphatase-like protein
mrh1-1
shv3-1
N
Galway et al. (1999);
Schiefelbein and
Somerville (1990)
Parker et al. (2000)
mrh5-1
shv3-1
Y
Parker et al. (2000)
mrh4-1
mrh3-1
shv2-1
cen2-1
Y
N
Parker et al. (2000)
Parker et al. (2000)
mrh3-1
bst1
N
Parker et al. (2000)
AGI
number
Predicted gene
product
At3g54870
At4g18640
At4g26690
At5g49270
At5g65090
At5g65090
GPI-anchored protein involved in root growth (Schindelman
et al., 2001). The mutant phenotypes of these two genes are
so similar that they are described together. Root hairs of
mrh5 plants and mrh4 plants are shorter than WT hairs
(Figures 3a,b, 4f), and burst at their tips during or soon after
the establishment of tip growth (Figures 3a,b, 4g). In mrh4
plants this bursting can occur at multiple points on the cell
surface, and not just at the growing tip (data not shown).
Root-hair shape and root-hair length are much more variable
in mrh5 plants (Figure 3a,b) than in mrh4 plants. Root hairs
on all four mutants are wider than in WT plants, both at their
base (Figures 3a,b, 4b) and on their shank (Figures 3a,b, 4c).
In addition the root-hair initiation site in mrh5 plants, but not
in mrh4 plants, shows a slight basal shift relative to WT hairbearing cells (Figure 4d). Consistent with the cell bursting,
an increased number of hairs in mutants in both genes fail to
make the transition to tip growth (Figure 4e). These plants
also have an increased number of root hairs per millimetre
of primary root (Figure 4j); however, as mutations in these
two genes do not affect the number of hair-forming sites per
cell (Figure 4h) these difference can be explained by the hairbearing epidermal cells being shorter in these mutants than
in WT plants (Figure 4k).
Root-hair initiation and the transition to tip growth
mutants. MRH3 (WT expression 160, rhd2-1 expression 71,
WT/rhd2-1 ratio 2.2) encodes an inositol-1,4,5-triphosphate
(IP3) 5-phosphatase-like protein (Berdy et al., 2001) with a
predicted molecular weight of 60 kDa. Root hairs of mrh3
plants have root-hair initiation sites (Figures 3b, 4a) and hair
bases (Figures 3b, 4b) that are wider than in WT plants. Close
observation revealed that this ballooning occurs during, and
not after, these developmental stages (data not shown).
However, the width of the root-hair shank (Figures 3b, 4c)
and mature root-hair length (Figures 3a, 4f) are similar to WT.
These results show that MRH3 is required for restricting both
References
the size of the root-hair initiation site and the width of the root
hairs during the transition to tip growth, but, apparently, is
not required for normal subsequent tip growth.
MRH6 (WT expression 594, rhd2-1 expression 149, WT/
rhd2-1 ratio 4.0) encodes a predicted 19 kDa protein similar
to the Escherichia coli universal stress protein A (USPA; Kerk
et al., 2003). Root hairs of mrh6 plants are of a similar length
to WT root hairs (Figures 3a, 4f), but both the root-hair
initiation site (Figures 3b, 4a; P ¼ 0.05) and the root-hair
base (Figures 3b, 4b) are wider than in WT hairs. These
plants also have a significant number of multiple hairs on
the same hair-bearing cell (Figures 3a,b, 4h). In this respect
the mutants resemble transgenic plants over-expressing the
ROP2 GTPase (ROP2 OX; Jones et al., 2002). However, unlike
ROP2 OX plants, hairs of mrh6 plants show no sign of hair or
tip branching (Figures 3a, 4i). These results show that MRH6
is required for normal root-hair initiation and to restrict
development to a single root hair on each hair-bearing cell,
but is not required for the transition to tip growth or for tip
growth itself.
Other than mrh5-1, which had shorter primary roots than
WT (Figure 4l) and mrh3-1, which had slightly longer
primary roots than WT (Figure 4l), the other primary T-DNA
insertion mutants (mrh1-1, mrh2-1, mrh4-1 and mrh6-1) had
roots that were not significantly different in length from WT
roots. None of the mutants showed any obvious effect on
specification of epidermal cell fate (data not shown).
Predicted glycosylphosphatidylinositol-anchored proteins
reveal a potential role for lipid rafts in root-hair development
Two of the genes, MRH4 and MRH5, encode predicted GPIanchored proteins. The GPI anchor targets proteins to lipid
rafts in the outer leaflet of the plasma membrane (Mayor and
Riezman, 2004). A third gene, MRH3, encodes an IP3
5-phosphatase-like protein, a mammalian homologue of
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
92 Mark A. Jones et al.
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 93
which has been identified as a lipid raft-associated protein
(Foster et al., 2003). Lipid rafts are sterol-rich microdomains
that ‘float’ within the more loosely packed polyunsaturated
membrane phospholipids that comprises the majority of the
plasma membrane bilayer (Brown and London, 2000). Initially controversial, there is now strong evidence that lipid
rafts exist in living cells (Simons and Toomre, 2000). Lipid
rafts show a 10-fold enrichment for signalling proteins
compared with total membranes (Foster et al., 2003) and, in
yeast and mammalian cells, play a role in the activation of
specific responses during cell development (Bagnat and
Simons, 2002; Baron et al., 2003).
Discussion
The root-hair morphogenesis transcriptome
The root-hair morphogenesis transcriptome contains a large
proportion of genes already known to be involved in roothair morphogenesis. Using this data set, novel root-hair
phenotypes in knockout mutants of additional genes have
been identified, indicating the efficiency of such highly targeted mutant screening as a means for identify new genes
involved in root-hair morphogenesis. Any attempt to impose
arbitrary thresholds for determining differential gene
expression will lead to anomalies. For instance, MRH4 is not
represented in the root-hair transcriptome, although the less
stringent threshold for selecting candidate root-hair genes
revealed this gene has a role in root-hair morphogenesis.
This indicates that the data set offers a conservative estimate
of the number of root-hair genes.
Expressed sequence tags (ESTs) from a Medicago truncatula root-hair-enriched cDNA library identified genes
involved in pathogen defence, cell-wall synthesis and intracellular trafficking (Covitz et al., 1998) in agreement with the
root-hair morphogenesis transcriptome. However, many of
the categories of genes identified in this library are not in the
root-hair morphogenesis transcriptome, which is enriched
in genes involved in root-hair morphogenesis, presumably
because the EST library also contained genes that were
highly expressed in roots as well as in root hairs. For
example, the proteins intrinsic to the tonoplast and plasma
membrane (water channels) identified as the most abundant
in the root-hair-enriched EST library (Covitz et al., 1998) are
not in the root-hair morphogenesis transcriptome, but many
are expressed in both WT and rhd2-1 at a high level
(Table S3). It is possible that some of the genes identified
in the root-hair morphogenesis transcriptome are specific to
the nature of the mutation that prevents root-hair growth:
reduced production of ROS in the case of rhd2-1 (Foreman
et al., 2003). Interestingly, relatively few redox homeostasis
and antioxidant genes are differentially expressed (a dehydroascorbate reductase, a glutathione-S-transferase and
thioredoxin h5). The expression pattern of thioredoxin h5
(At1g45145) is confirmed by promoter–GUS fusions, which
shows that it is strongly localized to root hairs and epidermal
cells (Reichheld et al., 2002). Additionally this thioredoxin is
also induced by pathogens and oxidative stress (Laloi et al.,
2004). The high expression of peroxidases could also be
related to the availability of hydrogen peroxide, although as
discussed below their primary role may be in cross-linking
wall polymers as opposed to scavenging hydrogen peroxide. High expression of genes involved in pathogen or
elicitor responses is striking, particularly two PR1-related
proteins that have more than a fivefold difference. It is
possible that formation of ROS by the growing root hair
induces pathogen defence. This could be an inadvertent
effect, or perhaps could be advantageous in protecting root
hairs from soil-borne pathogens. The rhd2-1 mutation
knocks out AtrbohC/RHD2 expression, as detected by RTPCR using a primer pair spanning the site of the rhd2-1
mutation (M. Jones and N. Smirnoff, unpublished results), a
premature stop codon at amino acid position 597 (Foreman
et al., 2003). However, the GeneChip did detect some
AtrbohC/RHD2 expression in rhd2-1 tissue. This is likely to
be the result of probe hybridization to the truncated
AtrbohC/RHD2 mRNA in rhd2-1. AtrbohG and AtrbohI were
somewhat more highly expressed in the WT RHDZ than in
Figure 4. Quantitative characterization of root-hair phenotypes of T-DNA insertion mutants.
(a) Mean width of the root-hair initiation site (lm), defined as the distance between the first visible curvature from the surface of the epidermal cell on either side of
the root hair.
(b) Mean width of the base of the root hair (lm), defined as the distance between the opposite sides of the root hair measured between 20 and 40 lm from the surface
of the epidermal cell.
(c) Mean width of the root-hair shank (lm), defined as the distance between the opposite sides of the root hair measured 100 lm from the surface of the epidermal
cell.
(d) Mean apical–basal initiation ratio, defined as the distance from the apical end cell wall to the middle of the root-hair initiation site, expressed as a percentage of
the epidermal cell length.
(e) Mean number of root hairs under 40 lm in length per mm primary root.
(f) Mean mature root-hair length (lm).
(g) Mean number of burst root hairs per mm primary root.
(h) Mean number of multiple root hairs per mm primary root.
(i) Mean number of branched root hairs per mm primary root.
(j) Mean number of total root hairs per mm primary root.
(k) Mean length of the hair-bearing epidermal cell (lm).
(l) Mean primary root length (cm). Bars with asterisks indicate the values are not significantly different from WT (P > 0.05).
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
94 Mark A. Jones et al.
the rhd2-1 RHDZ, suggesting that, like AtrbohC/RHD2, they
may also be differentially expressed in root hairs.
Many of the genes in the root-hair morphogenesis transcriptome can be related to the intense cell-wall synthesis,
associated intracellular trafficking and cytoskeleton organization associated with tip growth. Four xyloglucan endotransglycosylases (XET/XTH) are very highly expressed,
including one that shows 16-fold higher expression in the
WT RHDZ than in the rhd2-1 RHDZ. Two expansins (AtEXP7/
At1g12560 and AtEXP18/At1g62980), pectinesterase, pectate
lyase and a putative cellulase are also highly expressed.
Both the expansins identified, AtEXP7 and AtEXP18, are
expressed in root hairs (Cho and Cosgrove, 2002), providing
further confirmation that the data set provides a reliable
indication of the root-hair morphogenesis transcriptome.
XET/XTH activity has been strongly localized to the site of
root-hair initiation but is more diffusely spread in walls of
tip-growing root hairs (Vissenberg et al., 2001). The root-hair
morphogenesis transcriptome provides an indication of
which members of this large gene family are likely to be
involved in root-hair growth. After genes known to be
involved in root-hair morphogenesis, the most highly
enriched (at a frequency 60-fold higher than in the whole
genome) and abundant genes encode extracellular matrix
hydoxyproline-rich glycoproteins (HRGPs) of the extensin
and arabinogalactan protein (AGP) families. This suggests a
key role for these proteins in root-hair growth. Extensins
have been considered to have a largely structural role in cell
walls, but mutations in two extensins with additional LRR
domains (LRX1 and LRX2) disrupt root-hair development
(Baumberger et al., 2003). This suggests they could be
involved in signalling, although they lack the kinase domain
found in receptor-like kinases (RLKs) with LRR domains
(Diévart and Clark, 2003). LRX1 (At1g12040) is in the roothair morphogenesis transcriptome while LRX2 was not
significantly different, although more than twofold differentially expressed. In tomato, two extensins are preferentially
expressed in root hairs and inhibition of proline hydroxylation by 3,4-dehydroproline inhibited root-hair growth (Bucher et al., 1997, 2002). Arabinogalactan proteins are overrepresented in the root-hair morphogenesis transcriptome
and are implicated in development, including pollen tube
growth and signalling (Pilling and Höfte, 2003) and root-hair
development (Shi et al., 2003). Most AGPs have predicted
GPI–lipid anchors and the over-representation of this group
of proteins is discussed further below. Extensins (Schnabelrauch et al., 1996) and AGPs (Kjellbom et al., 1997) can be
peroxidatively cross-linked by cell wall peroxidases, so the
function of these proteins could be linked to the high
expression of peroxidases in the data set. Although the
function of ROS produced by AtrbohC/RHD2 in root-hair
growth is not fully understood (Foreman et al., 2003), it is
tempting to speculate that one role of extracellular hydrogen
peroxide is in peroxidative cross-linking behind the growing
tip, thereby preventing bursting under turgor pressure.
Bursting in rhd2-1 actually occurs offset from the extreme
root-hair apex (M. A. Jones and N. Smirnoff, unpublished
results), which supports this hypothesis. Receptor-like protein kinases form a very prominent group of genes (about
5% of the root-hair morphogenesis transcriptome). A knock
out in one of these genes (MRH1) results in short root hairs
that are otherwise morphologically normal. Possibly many
of this large number of RLKs are functionally redundant,
making it difficult to find severe phenotypes in single
mutants. The reason for this diversity would merit further
investigation. They could be involved in coordinating cell
wall growth, perhaps by detecting physical (Morris and
Walker, 2003) or chemical changes in the wall. Since root
hairs have a role in improving nutrient uptake, particularly of
immobile species such as phosphate and iron (Schmidt and
Schikora, 2001), it might be expected that membrane
transport proteins would be expressed at a high level.
Putative sulphate, potassium, iron, sugar and glycerol 3-P
transporters, along with a proton-ATPase were prominent.
Unfortunately, a number of genes that have no predicted
function were not available as T-DNA insertion mutants.
Once available, these mutants may reveal further novel
aspects of root-hair growth or function. Furthermore, the
root-hair morphogenesis transcriptome could be used to
carry out in silico analysis of cis-acting elements determining root-hair expression.
Identification of genes involved in root-hair morphogenesis
Six root-hair genes not previously identified at the molecular
level (MRH1–MRH6) have been identified. The ‘hit rate’ in
identifying lines with heritable root-hair phenotypes was
4.4% (7 out of 159 lines). MRH1 encodes a member of the LRR
class of RLKs (subfamily VI; Diévart and Clark, 2003). MRH1 is
clearly required for normal elongation of root hairs, suggesting that it may act in a signalling network that enables tip
growth to continue once the hair has reached a certain length.
It is known that transcription is required for sustained tip
growth as actinomycin D arrests tip growth without disrupting cytoplasmic streaming (Ketelaar et al., 2002). It will be
interesting to investigate which genes, if any, are downregulated, relative to the WT RHDZ, in the RHDZ of mrh1 plants.
These genes might be strong candidates to encode proteins
required for sustained tip growth, especially if they are present in the root-hair morphogenesis transcriptome.
The root-hair phenotype of mrh2 plants, which are
disrupted in the gene encoding a predicted KRP, is very
similar to that of WT root hairs treated with the microtubulestabilizing drug taxol and the microtubule disrupting drug
oryzalin (Bibikova et al., 1999), in that hairs are wavy and
branched but that tip growth rate appears to be unaffected.
The phenotype also closely resembles that of the mor1
microtubule-associated protein loss-of-function mutant
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 95
(Whittington et al., 2001). The root-hair phenotype of mrh2-1
plants appears to be correlated with an unusual microtubule
distribution pattern in these hairs (H. Van der Honing,
M. Jones and G. Wasteneys, unpublished results).
MRH3 encodes an IP3 5-phosphatase-like protein (Berdy
et al., 2001). IP3 5-phosphatases terminate IP3 signalling by
sequentially dephosphorylating IP3 to free inositol (Berdy
et al., 2001). Inositol-1,4,5-triphosphate is involved in triggering the release of Ca2þ from intracellular stores in plants
(Allen et al., 1995). Whilst the substrate specificity of the
predicted protein encoded by MRH3 is not known, phylogenetic analysis shows has shown that it is closely related to
At5PTase1, which hydrolyses IP3 and Inositol 1,3,4,5-phosphate (IP4; Berdy et al., 2001). Although growing root hairs
show a tip-localized influx of extracellular Ca2þ (Véry and
Davies, 2000) the role of Ca2þ released from intracellular
stores is less clear (Bibikova et al., 1997). Recently, an IP3activated Ca2þ channel was identified in Neurospora crassa
that regulates the release of the intracellular Ca2þ that
maintains the tip-high Ca2þ gradient during fungal tip growth
(Silverman-Gavrila and Lew, 2002). It seems reasonable to
speculate that the predicted IP3 5-phosphatase-like protein is
involved in regulating a similar IP3-induced release of Ca2þ
during early root-hair development. The root-hair initiation
site in mrh3 plants is wider than in WT plants. This is puzzling
as the tip-high [Ca2þ
i ] gradient that is required for root-hair tip
growth (Bibikova et al., 1997) can only be detected in the
emerging root hair after root-hair initiation is complete
(Wymer et al., 1997). However, despite this anomaly, the
wide base of root hairs in mrh3 plants does suggest a likely
role for MRH3 during the establishment of the tip-high [Ca2þ
i ]
gradient. Given that two of the other new genes encode
predicted GPI-anchored proteins, it is interesting that a
mammalian IP3 5-phosphatase was recently identified as a
component of lipid rafts (Foster et al., 2003).
MRH4 encodes a GPI-anchored protein, COBL9 (Roudier
et al., 2002), which, like COBRA, is likely to be targeted to the
outer leaflet of the plasma membrane (Schindelman et al.,
2001). The COBRA gene, which is highly expressed in rapidly
elongating root cells, encodes a protein that localizes to the
longitudinal sides of root cells and regulates the orientation
of root cell expansion (Schindelman et al., 2001). Mutants
for this gene have less cellulose in the cell wall in the root
growth zone, suggesting that COBRA exerts some direct
or indirect effect on cellulose synthesis. Indeed, COBL9
belongs to the COBL7 subgroup of the COBRA family,
characterized by two potential cellulose-binding sites, unlike
the single site in the COBRA subgroup.
MRH5 encodes a putative GPDP-like GPI-anchored protein
(Borner et al., 2003). Glycerophosphoryl diester phosphodiesterase splits glycerophosphocholine into sn-glycerol3-phosphate and free choline (van der Rest et al., 2002).
Yeast-based signal sequence trapping detected an Arabidopsis GPDP cDNA as encoding a secreted or plasma
membrane protein (Goo et al., 1999). Although a vacuolar
GPDP has been identified in plants (van der Rest et al., 2002)
the presence of the GPI anchor sequence and root-hair tip
bursting suggests that this gene is likely to encode an
extracellular protein, probably involved in phospholipid
catabolism during turnover of the root-hair plasma membrane.
Complementation testing strongly suggests that mrh5-1 is
allelic to shv3-1 and that mrh4-1 is allelic to shv2-1 (Parker
et al., 2000). Interestingly, the results show relative differences between mrh5 plants and mrh4 plants in both the
proportion of root hairs under 40 lm in length and in mature
root-hair length that are similar to the previously published
differences between the shv3 and shv2 mutants, respectively (Parker et al., 2000). It has already been established that
SHV2 and SHV3 are required for the transition to tip growth
and for tip growth itself (Parker et al., 2000). The single
mutant phenotypes (root-hair shanks wider than those in
WT hairs) support roles for MRH5 and MRH4 in controlling
the shape of root hairs. Previous double-mutant analyses
involving shv2 and shv3 have suggested roles for these
genes in controlling the shape of root hairs (Parker et al.,
2000). Both SHV2 and SHV3 appear to act in the same
developmental pathway as SHV1, and the NOX gene
AtrbohC/RHD2 (Foreman et al., 2003), and in opposition to
TIP1, RHD3, CEN1 and SCN1 (Parker et al., 2000).
The E. coli USPA is essential for the survival of cells in the
stationary phase (Kerk et al., 2003). However, within the
family of 44 predicted Arabidopsis USPA domain proteins,
the predicted MRH6 protein belongs to the ‘small plant’
cluster which lacks several of the functionally important
residues in the E. coli protein (Kerk et al., 2003). This
suggests that its function may have diverged considerably
during the course of evolution. One clue to the possible
function of this predicted protein is the mild ethyleneinduced induction of gene expression of a tomato USPA
homologue (Zegzouti et al., 1999).
More detailed work on each of the new mutants is
needed to establish their role in root-hair morphogenesis
and segregating populations derived from crosses with
other root-hair mutants are being screened for potential
double-mutant phenotypes (M. Jones and N. Smirnoff,
unpublished results). This approach can be informative as
double-mutant analyses can reveal subtle information
about the developmental stage at which a particular gene
acts that cannot be determined from observations of the
single-mutant phenotype (Parker et al., 2000). The screening for new root-hair genes has almost certainly excluded
other important genes, not least because, at the time,
T-DNA insertion lines were only available for a proportion
of the candidate genes. Indeed, the OXI1 gene, which
encodes a protein kinase required for ROS-mediated
signal transduction (Rentel et al., 2004), and which has
short root hairs (WT/rhd2-1 ratio 1.9) was not included in
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
96 Mark A. Jones et al.
the screen. Further targeted mutant screening using the
data set may well reveal more new and important roothair genes. The results show the utility of performing
targeted screening of T-DNA insertion lines using transcriptomics data as a means to identify new genes with
roles in a specific developmental process.
were plated beneath the surface of semisolid growth medium
containing 0.5% (w/v) phytagel and grown in vertical orientation.
Plated seeds were stratified for 48 h at 4C then transferred to
growth cabinets at 20C with a 24-h light regime. For complementation testing, seedlings were transferred to soil and grown at 20C
under a 12-h light, 12-h dark regime. For total RNA isolation the WT
Columbia (Col-4) ecotype and the rhd2-1 mutant (Schiefelbein and
Somerville, 1990) were used. For phenotypic characterization the
WT Columbia (Col-0) ecotype was used as a reference standard.
The role of glycosylphosphatidylinositol-anchored proteins
and lipid rafts in root-hair morphogenesis
RNA isolation
Glycosylphosphatidylinositol-anchored proteins are essential for normal cell wall synthesis and cell morphogenesis
(Gillmor et al., 2005; Lalanne et al., 2004). There is mounting
evidence that lipid rafts are present in plants (Mongrand
et al., 2004) and that GPI-anchored proteins are likely to be
major components of plant lipid rafts (Borner et al., 2003,
2005; Eisenhaber et al., 2003; Peskan et al., 2000). There is
circumstantial evidence that lipid rafts might play a role in
root-hair development:
(i) GPI-anchored proteins are over-represented in the roothair morphogenesis transcriptome when compared
with the whole genome, suggesting an important role
for these proteins in root-hair development.
(ii) Two of the genes identified here, MRH4 and MRH5,
encode predicted GPI-anchored proteins and a third,
MRH3, encodes a plant homologue of a mammalian
lipid raft-associated protein.
(iii) Both ROP GTPases and NOXs, which are components of
plant lipid rafts (Mongrand et al., 2004), have wellestablished roles in root-hair morphogenesis (Foreman
et al., 2003; Jones et al., 2002; Molendijk et al., 2001).
(iv) Sterol biosynthesis mutants have disrupted root-hair
development (Souter et al., 2002; Willemsen et al.,
2003). In support of this proposal, preliminary experiments showed that the sterol sequestering drug filipin
III (Grebe et al., 2003) inhibits root-hair tip growth and
the tip-localized ROS formation (Foreman et al., 2003)
required for tip growth (Supplementary Figure S1).
Root-hairs may provide a useful model system for investigating the role of GPI-anchored proteins and lipid rafts in
plant cell development.
Experimental procedures
Plant material and growth conditions
Arabidopsis thaliana seed were surface sterilized for 4 min in 10%
(v/v) household bleach, 4 min in ethanol:water:bleach mixture
[7:2:1] and rinsed 2 · 2 min in sterile water. For total RNA isolation,
initial phenotypic screening of T-DNA ‘knockout’ seedlings, filipin
treatment and nitroblue tetrazolium (NBT) staining, seeds were
plated on the surface of sterile semisolid growth medium (Jones
et al., 2002) containing 0.1% (w/v) phytagel, and grown in horizontal
orientation. For phenotypic characterization of selected lines, seeds
Three-day-old seedlings were picked up individually by their aerial
parts using forceps and transferred into a droplet of liquid growth
medium (Jones et al., 2002). Root-hair differentiation zones from
primary roots were dissected out using a sterile scalpel blade and a
headband magnifier with a 3.5· magnification lens. First the root tip
was excised with a cut proximal to the RHDZ, and then the primary
root was cut at or immediately distal to the point where root hairs
had stopped elongating. As a result, this material contained some
tissue from the adjacent primary root elongation zone and possibly
a small amount of tissue from the mature root-hair zone. The dissected material was transferred using the scalpel blade onto a
sterile RNAse-free microscope slide pre-chilled on a bed of dry ice. A
small droplet of growth medium was frozen on the slide to provide a
single identifiable point where dissected material could be collected. Dissected material froze on contact with this droplet. Total RNA
was extracted from approximately 100 mg fresh weight of tissue
using the RNeasy Plant Kit according to the manufacturer’s
instructions (Qiagen, Valencia, CA, USA). Ribonucleic acid was
concentrated by eluting from the column in 30 ll sterile RNAse-free
water, which was immediately reapplied to the column and eluted
again. The yield and purity of the RNA was determined spectrophotometrically, and its integrity was checked at the Nottingham
Arabidopsis Stock Centre (NASC) using an Agilent 2100 Bioanalyser
(Agilent Technologies, Boblingen, Germany).
Complementary DNA synthesis
Synthesis, labelling and hybridization of cDNA and cRNA was carried out by the GARNet transcriptomics service (http://affymetrix.
arabidopsis.info/). Approximately 5 lg of total RNA was reverse
transcribed at 42C for 1 h to generate first-strand DNA using 100
pmol oligo-dT(24) primer containing a 5¢-T7 RNA polymerase promoter sequence, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2,
10 mM dithiothreitol (DTT), 10 mM deoxyribonucleotides (dNTPs)
and 200 units of SuperScript II reverse transcriptase (Invitrogen Life
Technologies, Carlsbad, CA, USA). Following first-strand synthesis,
second-strand DNA synthesis was done using 10 units of E. coli
polymerase I, 10 units of E. coli DNA ligase and two units of RNase H
in a reaction containing 25 mM Tris-HCl (pH 7.5), 100 mM KCl, 5 mM
MgCl2, 10 mM (NH4)SO4, 0.15 mM b-NADþ and 10 mM dNTPs. The
second-strand synthesis reaction proceeded at 16C for 2 h before
10 units of T4 DNA polymerase was added and the reaction allowed
to proceed for a further 5 min. The reaction was terminated by
adding 0.5 M EDTA. Double-stranded cDNA products were purified
using the GeneChip sample clean-up module (Affymetrix).
Synthesis of cRNA probe
The synthesized cDNAs were in vitro transcribed by T7 RNA
polymerase (ENZO BioArray high yield RNA transcript labelling
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 97
kit; Enzo Biochem, NY, USA) using biotinylated nucleotides to
generated biotinylated cRNAs. The cRNAs were purified using
the GeneChip sample cleanup module (Affymetrix). The cRNAs
were then randomly fragmented at 94C for 35 min in a buffer
containing 40 mM Tris-acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate to generate molecules of
approximately 35–200 bases long.
GeneChip hybridization and data analysis
The Affymetrix ATH1 A. thaliana GeneChip array was hybridized
with 15 lg of the fragmented labelled cRNA for 16 h at 45C as
described in the Affymetrix technical analysis manual. GeneChips were stained with streptavidin–phycoerythrin solution and
scanned with an Agilent G2500A GeneArray scanner (Agilent
Technologies, Boblingen, Germany). Microsoft Excel (Microsoft,
Redmont, WA, USA) was used to manage and filter the microarray data using MAS 5.0 (Affymetrix) signals. The expression data
were further subjected to per chip normalization (to the 50th
percentile) and per gene normalization (to the median) using
GeneSpring 6 software (Agilent technologies: http://www.chemagilent.com). Analysis of variance on log transformed expression
values was carried out with GeneSpring. The data are deposited at ArrayExpress (http://www.ebi.ac.uk/arrayexpress/accession
number E-NASC-54) and at the NASC Affymetrix Service (http://
affymetrix.arabidopsis.info/).
Genotype analysis
The presence of T-DNA insertions was detected by PCR using genomic DNA and a triplet of primers; two primers complementary to
genomic DNA sequences situated on either side of the putative
insertion site and a third primer complementary to the left border of
the vector pROK2 (http://signal.salk.edu/tdnaprimers.2.html). Genomic DNA extraction and PCR were performed using a REDExtractN-Amp Plant PCR kit (Sigma Aldrich Co. Ltd., Poole, UK). Primer
sequences were as follows (expected product sizes in bp from WT
genomic DNA are shown after each pair of primer sequences.
Expected product sizes from transgenic genomic DNA vary
according to the formula 410 bp þ N bp (410 bp ¼ distance from
right primer (RP) to the insertion site, 300 þ N bases, plus 110 bases
from LBb1 to the left border of the vector; N ¼ distance between the
actual insertion site and the flanked sequence position, usually
0–300 bases): LBb1 of pBIN-pROK2 GCGTGGACCGCTTGCTGCAACT; mrh1-1 left primer (LP; 5¢-TTCTCTTGCTTGCCCTACCCG),
mrh1-1 RP (5¢-CCGTCAACACAAGTAACCCCTG), 867; mrh1-2 LP
(5¢-GAGCGGACAAATTCCACCTGA), mrh1-2 RP (5¢-TTGACAGCTCTTTTCCGGCAG), 934; mrh2-1 LP (5¢-TTTCATTCCACAGGAAAAGCGA), mrh2-1 RP (5¢-TCCCACATAAATTGGCAAGCG), 942;
mrh2-2 LP (5¢-TCTTCCTTGAATTTGCCTGCT), mrh2-2 RP (5¢-TAATACCACGCTCAGCTGCAT), 917; mrh3-1 LP (5¢-GTCCTGGAATTGAAGGCTTG), mrh3-1 RP (5¢-TTCGCTTGTGTCAGAATCTTG),
887; mrh3-2 LP (5¢-TCTTGATCCCAAGTTTCATTGC), mrh3-2 RP
(5¢-TAAGCGACCCATGATTCCTCT), 914; mrh4-1 LP (5¢-TGGCAACTTGCATCGTGAAGA), mrh4-1 RP (5¢-AACGAGGGTTGGCTCTGTCCT), 912; mrh4-2 LP (5¢-TTTGGTATCTCGGTTTTGGCT), mrh4-2
RP (5¢-TGTAAACAAAAAGTGGACTTTCAA), 896; mrh5-1 LP (5¢-CGGATCACTGCAACACGTGAA), mrh5-1 RP (5¢-CGCGTAATTTTGGTAGACTGCAA), 939; mrh5-2 LP (5¢-AAGAGAGGCAAGAACCATTGC),
mrh5-2 RP (5¢-TAATGGCCACACCACTCATGT), 891; mrh6-1 LP
(5¢-TTGTTTTGGGAGCTTATTTTTGT), mrh6-1 RP (5¢-CCTGTCCATACTCAAATCAAAACCA), 884; mrh6-2 LP (5¢-AAATAATTTTTGCCAGGTTGGA), mrh6-2 RP (5¢-TGCTGTTGCTTAAAGCTTACGTT), 899.
Reverse transciptase polymerase chain reaction
For testing whether T-DNA insertion mutants were transcript null
alleles, total RNA was extracted from approximately 100 mg (fresh
weight) whole roots using the RNeasy Plant Kit according to the
manufacturer’s instructions (Qiagen). Five hundred nanograms of
total RNA was used with each Ready-To-Go RT-PCR bead (Amersham Biosciences, Little Chalfont, UK). Intron-spanning primer pair
sequences were as follows (expected product sizes in bp from
genomic DNA and cDNA, respectively, shown after primer sequence): EF1A4-UP At5g60390 (5¢-ATGCCCCAGGACATCGTGATTTCAT); EF1A4-RP At5g60390 (5¢-TTGGCGGCACCCTTAGCTGGATCA)
809, 709; mrh1-1 forward (F) (5¢-CGCCTATCAGATAAGGAGACAG);
mrh1-1 reverse (R) (5¢-CCACCAAAGAGGAGAGGATC) 855, 579;
mrh2-1 F (5¢-GATCTTTCAAAAGGATCAGCAG); mrh2-1 R (5¢-TTCCCACATAAATTGGCAAG) 909; 458; mrh3-1 F (5¢-TGATGACCTAGACCACCACTATG); mrh3-1 R (5¢-CTTGGTGCTCTTGATTCTTCAC)
946, 510; mrh4-1 F (5¢-CGGTTCCTTTGCCATCCAAC); mrh4-1 R (5¢CGGATCGGTTGAAATCAGGAG) 971; 585; mrh5-1 F (5¢-ACGGTCTCCCTAACTGCTTTC); mrh5-1 R (5¢-TTTATCTCAACGGTTGCATCAG) 968, 668; mrh6-1 F (5¢-TGGTTGTTGTGGACACAACTTC); mrh61 R (5¢-GCCAAGAGCCAGAAATCTTTG) 857, 493.
For confirming the validity of the transcriptomics data total RNA
was extracted from dissected RHDZs using the same kit as above.
One microgram total RNA was reverse transcribed into first-strand
cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, Hemel
Hempsted, UK) in a 20 ll reaction. The optimum amount of
first-strand cDNA synthesis reaction used in each subsequent PCR
(ll) was determined empirically: EF1aA4 (0.75); At1g61950 (2.25);
At4g25220 (1.5), At4g28850 (1.5), At5g49770 (1.5). Intron-spanning
primer pair sequences were as follows (expected product sizes in
bp from genomic DNA and cDNA, respectively, shown after
primer sequence): EF1A4-UP At5g60390 (5¢-ATGCCCCAGGACATCGTGATTTCAT); EF1A4-RP At5g60390 (5¢-TTGGCGGCACCCTTAGCTGGATCA) 809, 709; At1g61950 F (5¢-CGCCGGAGTTATTCTCTACATC); At1g61950 R (5¢-TTATCGAAATGTTGAAAAGCTTTG) 922,
606; At4g25220 F (5¢-ACTCTACCATGAGGCTCGGTG); At4g25220 R
(5¢-ACATGAGGATGACATTGATGGTC) 507, 420; At4g28850 F(5¢CGTTAATGTTCGTTCTGGCAG); At4g28850 R(5¢-CTGATCGGAGTTCCATCGAC) 1039, 472; At5g49770 F(5¢-GCTCTTGATCTTGCTTTTCTTC); At5g49770 R(5¢-AAAGAAGCCCCATCAGAAAC) 983,
534.
Acknowledgements
The BBSRC GARNet programme funded the Affymetrix
GeneChips. The authors are grateful to John Okyere at
NASC for performing probe synthesis and microarray hybridizations.
Supplementary Material
The following supplementary material is available for this article
online:
Table S1 The root-hair morphogenesis transcriptome
Table S2 Categorisation of 124 genes that are >4-fold more highly
expressed in the wild type root-hair differentiation zone of
Arabidopsis thaliana compared to the rhd2-1 mutant
Table S3 Gene lists used to categorise the root-hair morphogenesis
transcriptome in Table 2 and referred to in the Discussion
Video Clip S1. Time-lapse movie of root-hair tip growth in T-DNA
insertion line SALK_035063 (At3g54870-Armadillo repeat containing kinesin-related protein).
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
98 Mark A. Jones et al.
Figure S1. The lipid raft disrupting drug filipin III rapidly arrests tip
growth in root.
This material is available as part of the online article from http://
www.blackwell-synergy.com.
References
Allen, G.J., Muir, S.R. and Sanders, D. (1995) Release of Ca2þ from
individual plant vacuoles by both InsP3 and cyclic ADP-ribose.
Science, 268, 735–737.
Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genomewide insertional mutagenesis of Arabidopsis thaliana. Science,
301, 653–657.
Bagnat, M. and Simons, K. (2002) Cell surface polarization during
yeast mating. Proc. Natl Acad. Sci. USA 99, 14183–14188.
Baluška, F., Salaj, J., Mathur, J., Braun, M., Jasper, F., Šamaj, J.,
Chua, N.-H., Barlow, P.W. and Volkmann, D. (2000) Root hair
formation: F-actin-dependent tip growth is initiated by local
assembly of profilin-supported F-actin meshworks accumulated
within expansin-enriched bulges. Dev. Biol. 227, 618–632.
Baron, W., Decker, L., Colognato, H. and Ffrench-Constant, C. (2003)
Regulation of integrin growth factor interactions in oligodendrocytes by lipid raft microdomains. Curr. Biol. 13, 151–155.
Baumberger, N., Steiner, M., Ryser, U., Keller, B. and Ringli, C.
(2003) Synergistic interaction of the two paralogous Arabidopsis
genes LRX1 and LRX2 in cell wall formation during root hair
development. Plant J. 35, 71–81.
Berdy, S.E., Kudla, J., Gruissem, W. and Gillaspy, G.E. (2001)
Molecular characterization of At5PTase1, an inositol phosphatase
capable of terminating inositol trisphosphate signalling. Plant
Physiol. 126, 801–810.
Bibikova, T.N., Zhigilei, A. and Gilroy, S. (1997) Root hair growth in
Arabidopsis thaliana is directed by calcium and an endogenous
polarity. Planta, 203, 495–505.
Bibikova, T.N., Jacob, T., Dahse, I. and Gilroy, S. (1998) Localized
changes in apoplastic and cytoplasmic pH are associated with
root hair development in Arabidopsis thaliana. Development,
125, 2925–2934.
Bibikova, T.N., Blancaflor, E.B. and Gilroy, S. (1999) Microtubules
regulate tip growth and orientation in root hairs of Arabidopsis
thaliana. Plant J. 17, 657–665.
Böhme, K., Li, Y., Charlot, F., Grierson, C., Marrocco, K., Okada, K.,
Laloue, M. and Nogué, F. (2004) The Arabidopsis COW1 gene
encodes a phosphatidylinositol transfer protein essential for root
hair tip growth. Plant J. 40, 686–698.
Borner, G.H.H., Lilley, K.S., Stevens, T.J. and Dupree, P. (2003)
Identification of glycosylphosphatidylinositol-anchored proteins
in Arabidopsis. A proteomic and genomic analysis. Plant Physiol.
132, 568–577.
Borner, G.H.H., D. Sherrier, J., Weimar, T., Michaelson, L.V., Hawkins, N.D., MacAskill, A., Napier, J.A., Beale, M.H., Lilley, K.S. and
Dupree, P. (2005) Analysis of detergent-resistant membranes in
Arabidopsis. Evidence for plasma membrane lipid rafts. Plant
Physiol. 137, 104–116.
Brown, D.A. and London, E. (2000) Structure and function of
sphingolipid- and cholesterol-rich membrane rafts. J. Biol. Chem.
275, 17221–17224.
Bucher, M., Schroeer, B., Willmitzer, L. and Riesmeier, J.W. (1997)
Two genes encoding extensin-like proteins are predominantly
expressed in tomato root hair cells. Plant Mol. Biol. 35, 497–508.
Bucher, M., Brunner, S., Zimmermann, P., Zardi, G.I., Amrhein, N.,
Willmitzer, L. and Riesmeier, J.W. (2002) The expression of an
extensin-like protein correlates with cellular tip growth in tomato.
Plant Physiol. 128, 911–923.
Cho, H.-T. and Cosgrove, D.J. (2002) Regulation of root hair initiation and expansin gene expression in Arabidopsis. Plant Cell, 14,
3237–3253.
Covitz, P.A., Smith, L.S. and Long, S.R. (1998) Expressed sequence
tags from a root-hair-enriched Medicago trunculata cDNA library.
Plant Physiol. 117, 1325–1332.
Diévart, A. and Clark, S.E. (2003) Using mutant alleles to determine
the structure and function of leucine-rich repeat receptor-like
kinases. Curr. Opin. Plant Biol. 6, 507–516.
Dolan, L., Duckett, C.M., Grierson, C., Linstead, P., Schneider, K.,
Lawson, E., Dean, C., Poethig, S. and Roberts, K. (1994) Clonal
relationships and cell patterning in the root epidermis of Arabidopsis. Development, 120, 2465–2474.
Eisenhaber, B., Wildpaner, M., Schultz, C.J., Borner, G.H.H., Dupree,
P. and Eisenhaber, F. (2003) Glycosylphosphatidylinositol lipid
anchoring of plant proteins. Sensitive prediction from sequenceand genome-wide studies for Arabidopsis and rice. Plant Physiol.
133, 1691–1701.
Foreman, J., Demidchik, V., Bothwell, J.H.F. et al. (2003) Reactive
oxygen species produced by NADPH oxidase regulate plant cell
growth. Nature, 422, 442–446.
Foster, L.J., de Hoog, C.L. and Mann, M. (2003) Unbiased quantitative proteomics of lipid rafts reveals high specificity for signaling
factors. Proc. Natl Acad. Sci. USA 100, 5813–5818.
Galway, M.E., Lane, D.C. and Schiefelbein, J.W. (1999) Defective
control of growth rate and cell diameter in tip-growing root hairs of
the rhd4 mutant of Arabidopsis thaliana. Can. J. Bot. 77, 494–507.
Gillmor, C.S., Lukowitz, W., Brininstool, G., Sedbrook, J.C.,
Hamann, T., Poindexter, P. and Somerville, C. (2005) Glycosylphosphatidylinositol-anchored proteins are required for cell wall
synthesis and morphogenesis in Arabidopsis. Plant Cell, 17,
1128–1140.
Goo, J.H., Park, A.R., Park, W.J. and Park, O.K. (1999) Selection of
Arabidopsis genes encoding secreted and plasma membrane
proteins. Plant Mol. Biol. 41, 415–423.
Grebe, M., Xu, J., Möbius, W., Ueda, T., Nakano, A., Geuze, H.J.,
Rook, M.B. and Scheres, B. (2003) Arabidopsis sterol endocytosis
involves actin-mediated trafficking via ARA6-positive early
endosomes. Curr. Biol. 13, 1378–1387.
Grierson, C. and Schiefelbein, J. (2002) Root hairs. In The Arabidopsis Book (Somerville, C.R. and Meyerowitz, E.M., eds). Rockville, MD: American Society of Plant Biologists, (aspb.org/
publications/arabidopsis/) doi: 10.1199/tab.0060, pp. 1–22.
Grierson, C.S., Roberts, K., Feldmann, K.A. and Dolan, L. (1997) The
COW1 locus of Arabidopsis acts after RHD2, and in parallel with
RHD3 and TIP1, to determine the shape, rate of elongation, and
number of root hairs produced from each site of hair formation.
Plant Physiol. 115, 981–990.
Grierson, C.S., Parker, J.S. and Kemp, A.C. (2001) Arabidopsis
genes with roles in root hair development. J. Plant Nutr. Soil Sci.
164, 131–140.
Jones, M.A. and Grierson, C.S. (2003) A simple method for obtaining cell-specific cDNA from small numbers of growing root-hair
cells in Arabidopsis thaliana. J. Exp. Bot. 54, 1373–1378.
Jones, M.A., Shen, J.-J., Fu, Y., Li, H., Yang, Z. and Grierson, C.S.
(2002) The Arabidopsis Rop2 GTPase is a positive regulator of
both root hair initiation and tip growth. Plant Cell, 14, 763–776.
Kapranov, P., Routt, S.M., Bankaitis, V.A., de Bruijn, F.J. and
Szczyglowski, K. (2001) Nodule-specific regulation of phosphatidylinositol transfer protein expression in Lotus japonicus. Plant
Cell, 13, 1369–1382.
Kerk, D., Bulgrien, J., Smith, D.W. and Gribskov, M. (2003) Arabidopsis proteins containing similarity to the universal stress protein
domain of bacteria. Plant Physiol. 131, 1209–1219.
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
Molecular identification of six root-hair genes 99
Ketelaar, T., Faivre-Moskalenko, C., Esseling, J.J., de Ruijter, N.C.A.,
Grierson, C.S., Dogterom, M. and Emons, A.M.C. (2002) Positioning of nuclei in Arabidopsis root hairs: an actin-regulated
process of tip growth. Plant Cell, 14, 2941–2955.
Kjellbom, P., Snogerup, L., Stohr, C., Reuzeau, C., McCabe, P.F. and
Pennell, R. (1997) Oxidative cross-linking of plasma membrane
arabinogalactan proteins. Plant J. 12, 1189–1196.
Kwak, J.M., Mori, I.C., Pei, J.-M., Leonhardt, N., Torres, M.A., Dangl,
J.L., Bloom, R.E., Bodde, S., Jones, J.D.G. and Schroeder, J.I.
(2003) NADPH oxidase AtrbohD and AtrbohF genes function in
ROS-dependent ABA signaling in Arabidopsis. EMBO J. 22, 2623–
2633.
Lalanne, E., Honys, D., Johnson, A., Borner, G.H.H., Lilley, K.S.,
Dupree, P., Grossniklaus, U. and Twell, D. (2004) SETH1 and
SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination
and tube growth in Arabidopsis. Plant Cell, 16, 229–240.
Laloi, C., Mestres-Ortega, D., Marco, Y., Meyer, Y. and Reichheld,
J.-P. (2004) The Arabidopsis cytosolic thioredoxin h5 gene
induction by oxidative stress and its W-Box-mediated response to
pathogen elicitor1. Plant Physiol. 134, 1006–1016,
Mayor, S. and Riezman, H. (2004) Sorting GPI-anchored proteins.
Nat. Rev. Mol. Cell Bio. 5, 110–120.
Miller, D.D., de Ruijter, N.C.A., Bisseling, T. and Emons, A.M.C.
(1999) The role of actin in root hair morphogenesis: studies with
lipochito-oligosaccharide as a growth stimulator and cytochalasin as an actin perturbing drug. Plant J. 17, 141–154.
Molendijk, A.J., Bischoff, F., Rajendrakumar, C.S.V., Friml, J.,
Braun, M., Gilroy, S. and Palme, K. (2001) Arabidopsis thaliana
Rop GTPases are localized to tips of root hairs and control polar
growth. EMBO J. 20, 2779–2788.
Mongrand, S., Morel, J., Laroche, J., Claverol, S., Carde, J.-P.,
Hartmann, M.-A., Bonneu, M., Simon-Plas, F., Lessire, R. and
Bessoule, J.-J. (2004) Lipid rafts in higher plant cells: purification
and characterization of Triton X-100-insoluble microdomains
from tobacco plasma membrane. J. Biol. Chem. 279, 36277–
36286.
Morris, E.R. and Walker, J.C. (2003) Receptor-like protein kinases:
the keys to response. Curr. Opin. Plant Biol. 6, 339–342.
Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M. and
Lepiniec, L. (2000) The TT8 gene encodes a basic helix-loop-helix
domain protein required for expresson of DF and BAN genes in
Arabidopsis siliques. Plant Cell, 12, 1863–1878.
Parker, J.S., Cavell, A.C., Dolan, L., Roberts, K. and Grierson, C.S.
(2000) Genetic interactions during root hair morphogenesis in
Arabidopsis. Plant Cell, 12, 1961–1974.
Peskan, T., Westermann, M. and Oelmüller, R. (2000) Identification
of low-density Triton X-100-insoluble plasma membrane microdomains in higher plants. Eur. J. Biochem. 267, 6989–6995.
Pilling, E. and Höfte, H. (2003) Feedback from the wall. Curr. Opin.
Plant Biol. 6, 611–616.
Reddy, A.S. and Day, I.S. (2001) Kinesins in the Arabidopsis
genome: a comparative analysis among eukaryotes. BMC Genomics, 2, 2.
Reichheld, J.-P., Mestres-Ortega, D., Laloi, C. and Meyer, Y. (2002)
The multigenic family of thioredoxin h in Arabidopsis thaliana:
specific expression and stress response. Plant Physiol. Biochem.
40, 685–690.
Rentel, M.C., Lecourieux, D., Ouaked, F. et al. (2004) OXI1 kinase is
necessary for oxidative burst-mediated signalling in Arabidopsis.
Nature, 427, 858–861.
van der Rest, B., Boisson, A.-M., Gout, E., Bligny, R. and Douce, R.
(2002) Glycerophosphocholine metabolism in higher plant cells.
Evidence of a new glyceryl-phosphodiester phosphodiesterase.
Plant Physiol. 130, 244–255.
Roudier, F., Schindelman, G., DeSalle, R. and Benfey, P.N. (2002)
The COBRA family of putative GPI-anchored proteins in Arabidopsis. A new fellowship in expansion. Plant Physiol. 130, 538–548.
Sagi, M., Davydov, O., Orazova, S., Yesbergenova, Z., Ophir, R.,
Stratmann, J.W. and Fluhr, R. (2004) Plant respiratory burst
oxidase homologs impinge on wound responsiveness
and development in Lycopersicon esculentum. Plant Cell, 16,
616–628.
Schiefelbein, J.W. and Somerville, C. (1990) Genetic control of root
hair development in Arabidopsis thaliana. Plant Cell, 2, 235–243.
Schiefelbein, J.W., Shipley, A. and Rowse, P. (1992) Calcium influx
at the tip of growing root-hair cells of Arabidopsis thaliana.
Planta, 187, 455–459.
Schindelman, G., Morikami, A., Jung, J., Baskin, T.I., Carpita, N.C.,
Derbyshire, P., McCann, M.C. and Benfey, P.N. (2001) COBRA
encodes a putative GPI-anchored protein, which is polarly
localized and necessary for oriented cell expansion in Arabidopsis. Genes Dev. 15, 1115–1127.
Schmidt, W. and Schikora, A. (2001) Different pathways are involved in phosphate and iron stress-induced alterations of root
epidermal cell development. Plant Physiol. 125, 2078–2084.
Schnabelrauch, L.S., Kieliszewski, M., Upham, B.L., Alizedeh, H.
and Lamport, D.T.A. (1996) Isolation of pl 4.6 extensin peroxidase
from tomato cell suspension cultures and identification of ValTyr-Lys as putative intermolecular cross-link site. Plant J. 9, 477–
489.
Shi, H., Kim, Y.S., Guo, Y., Stevenson, B. and Zhu, J.-K. (2003) The
Arabidopsis SOS5 locus encodes a putative cell surface adhesion
protein and is required for normal cell expansion. Plant Cell, 15,
19–32.
Silverman-Gavrila, L.B. and Lew, R.R. (2002) An IP3-activated Ca2þ
channel regulates fungal tip growth. J. Cell Sci. 115, 5013–5025.
Simons, K. and Toomre, D. (2000) Lipid rafts and signal transduction. Nat. Rev. Mol. Cell Bio. 1, 31–41.
Souter, M., Topping, J., Pullen, M., Friml, J., Palme, K., Hackett, R.,
Grierson, D. and Lindsey, K. (2002) hydra mutants of Arabidopsis
are defective in sterol profiles and auxin and ethylene signaling.
Plant Cell, 14, 1017–1031.
Torres, M.A., Dangl, J.L. and Jones, J.D.G. (2002) Arabidopsis
gp91(phox) homologues AtrbohD and AtrbohF are required for
accumulation of reactive oxygen intermediates in the plant defense response. Proc. Natl Acad. Sci. USA 99, 517–522.
Véry, A.-A. and Davies, J.M. (2000) Hyperpolarization-activated
calcium channels at the tip of Arabidopsis root hairs. Proc. Natl
Acad. Sci. USA 97, 9801–9806.
Vissenberg, K., Fry, S.C. and Verbelen, J.-P. (2001) Root hair initiation is coupled to a highly localized increase of xyloglucan
endotransglycosylase action in Arabidopsis roots. Plant Physiol.
127, 1125–1135.
Wang, X., Cnops, G., Vanderhaeghen, R., De Block, S., Van Montagu, M. and Van Lijsebettens, M. (2001) AtCSLD3, a cellulose
synthase-like gene important for root hair growth in Arabidopsis.
Plant Physiol. 126, 575–586.
Whittington, A.T., Vugrek, O., Wei, K.J., Hasenbein, N.G., Sugimoto, K., Rashbrooke, M.C. and Wasteneys, G.O. (2001) MOR1 is
essential for organizing cortical microtubules in plants. Nature,
411, 610–613.
Willemsen, V., Friml, J., Grebe, M., den Toorn, A., Palme, K. and
Scheres, B. (2003) Cell polarity and PIN protein positioning in
Arabidopsis require STEROL METHYLTRANSFERASE1 function.
Plant Cell, 15, 612–625.
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100
100 Mark A. Jones et al.
Wymer, C.L., Bibikova, T.N. and Gilroy, S. (1997) Cytoplasmic free
calcium distributions during the development of root hairs of
Arabidopsis thaliana. Plant J. 12, 427–439.
Zegzouti, H., Jones, B., Frasse, P., Marty, C., Maitre, B., Latché, A.,
Pech, J.-C. and Bouzayen, M. (1999) Ethylene-regulated gene
expression in tomato fruit: characterization of novel ethyleneresponsive and ripening related genes isolated by differential
display. Plant J. 18, 589–600.
ª 2005 The Authors
Journal compilation ª 2005 Blackwell Publishing Ltd, The Plant Journal, (2006), 45, 83–100