* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Class11 POGIL Translation Full Win17 all pages
Artificial gene synthesis wikipedia , lookup
Lipid signaling wikipedia , lookup
Polyadenylation wikipedia , lookup
Paracrine signalling wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Signal transduction wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Gene regulatory network wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Protein structure prediction wikipedia , lookup
Point mutation wikipedia , lookup
Gene expression wikipedia , lookup
Metalloprotein wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Messenger RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genetic code wikipedia , lookup
Bio200 POGIL Cell Biology POGIL5 - Translation (Developed by M. Schivell) MODEL 1: = "codon" = "anticodon" Critical Thinking Questions 5. Label as many components of the cartoon as you can. 6. Label the 5' and 3' sides of each codon and anticodon. 7. a. How many nucleotides are there in a codon? __________ in an anticodon? __________ b. Do codons overlap? __________ c. Which molecule contains codons? ___________ Which contains anticodons? __________ d. How many amino acids does each tRNA carry? ______ 8. a. Define the term "codon": b. Define the term "anticodon": 9. Translation ALWAYS begins with a tRNA carrying the amino acid Met. From the picture above, what is the sequence of the "Start Codon"? Label with 5' and 3'. _________________ 10. In which direction must the ribosome move ("translocate") along the mRNA? Circle one: From 5' to 3' or from 3' to 5'? 1 Bio200 POGIL Cell Biology POGIL5 - Translation (Developed by M. Schivell) MODEL 2: Initiation of translation (from Freeman, 4e) 11. a. The ribosome contains a small segment of RNA that binds loosely to the ribosome binding site (RBS) in the mRNA. Complementary sequence in the ribosome is not exact, but is a pyrimidine-rich region. Circle the likely RBS in this mRNA. a. Is the RBS closer to the 5' or 3' end of the mRNA? _____ b. Which are more common in the RBS binding part of the mRNA, pyrimidines or purines? c. What types of bonds associate between the mRNA and small ribosomal subunit? _______ d. Why might an RBS be useful for translation in the complex environment of the cell? 12. a. Does the first tRNA bind before or after the ribosome is completely formed? ____________ b. What is a name for the 3-base sequence that the first tRNA binds to? ______________ 13. a. How many nucleotides are there between... ... the RBS and the start codon? _______ ... the 5' end of the mRNA's and the start codon? ______ b. Are either of your answers in "a" multiples of 3? _______ c. What establishes the "frame" of triplet codons for translation? ___________________ 14. In the mRNA sequence below, circle and label a likely RBS and the exact start codon. 5' UCUUAAGAAGGAUCUGUAAUGUCUGUAUGUCUGUAGUGUAUGUCUUGUAUCG 3' 2 Bio200 POGIL Cell Biology POGIL5 - Translation (Developed by M. Schivell) MODEL 3: This model shows the molecular changes to amino acids and tRNAs during translation. amino acid 15. Which end of the tRNA is attached to the amino acid, 5' or 3'? tRNA with the nucleotide at one end shown much larger than the rest of the molecule 16. a. In the top half of the model... ... circle the two atoms that will be connected by a new bond. ... draw a slash through the bond that will be broken. b. In the bottom half of the model, circle the newly formed bond. 17. If all of the proteins were taken away from the ribosome, it could still catalyze the reaction shown above (although much more slowly). What type of molecule is catalyzing the reaction? 18. The drawing to the right shows a short protein of 8 amino acids that is complete, but is still in the ribosome. a. Circle the bond that needs to be broken before the protein can be used. b. Label the amino terminus and the soon-to-be-carboxyl terminus of the protein. c. Draw a square around a peptide bond. 3 Bio200 POGIL Cell Biology POGIL5 - Translation (Developed by M. Schivell) MODEL 4: Termination of translation (from Freeman, 4e) "release factor" 19. Compare the two tRNAs in this model with release factor. List two things that release factor does NOT have that the tRNAs do have (or had at some point). ________________________ ________________________ 20. Release factor is NOT a nucleic acid, yet it is capable of catalysis. What is it most likely made of? _______________ 21. One covalent bond is broken in the figure above. a. What two things are held together by that covalent bond? ____________________________ b. What is the catalyst that breaks that bond? ______________________________ 22. What is the nucleotide sequence of the codon that binds release factor? ___________ (This is called a "stop codon".) 23. Using the codon table on page 7, list two different codons that a release factor can bind to: (include 5' and 3' labels) ______________ _____________ 24. Is release factor an enzyme? _______ What is your reasoning for this answer (see question 17 for help.) 4 Bio200 POGIL Cell Biology POGIL5 - Translation (Developed by M. Schivell) MODEL 5: This diagram shows an amino-acyl tRNA (top), and four different amino-acyl tRNA synthetase enzymes. These enzymes are responsible for attaching the appropriate amino acid to a tRNA. tRNA (light gray) amino acid 4 different "amino-acyl tRNA synthetase" enzymes (dark gray) www.pdb.org 25. Draw a square around the part of the tRNA (at the top) that contains the anti-codon. 26. a. Using the name "amino-acyl tRNA synthetases" as a guide, name two different substrates of these enzymes: ____________ _______________ b. These enzymes also require ATP as a substrate. Explain. 27. The aa-tRNA synthetases (an abbreviation) are a large family of enzymes found in every living cell. a. What parts of the enzymes must be different between different members of this family? b. Are the reactions catalyzed by different members of this family the same or different? How do you know? 28. How many different aa-tRNA synthetase enzymes are needed (at the very least) by a cell? _________ 5 Bio200 POGIL Cell Biology POGIL5 - Translation On your own: 1. This is the sequence of a complete mRNA from a bacterial cell: (Developed by M. Schivell) 5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3' a. Write the protein sequence that is translated from this mRNA on the line below, and label the amino (N) and carboxyl (C) termini of the protein. b. How many tRNAs will bind to the ribosome to make this protein? _________ c. Which of the following sequences within the mRNA most likely contains the ribosome binding site? (Circle ONE) 5'UAGCUAGCA3' 5'UUAAUGG3' 5'AAGGAGGC3' 2. For each different mutant cell described below, assume that ONE specific molecule or part of a molecule is mutated in that cell so that the molecule’s function has changed. Name as many molecules that could result in the description (but remember that for the mutant phenotype, you are considering each mutation by itself). Cell 1: In many different types of proteins, there is the amino acid Thr (threonine) where an Ala (alanine) should be. Cell 2: Many different types of proteins are much shorter than in a normal cell, but have the correct sequence up to that point. tRNA levels are normal in the cell. Cell 3: mRNAs are bound to small ribosomal subunits, but nothing else is attached. Large ribosomal subunits are floating in the cytoplasm, and no proteins are made. ________________________ ________________________ ________________________ 3. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not? 6