Download Sp100 is important for the stimulatory effect of

Oncogene (2003) 22, 8731–8737
& 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00
www.nature.com/onc
Sp100 is important for the stimulatory effect of homeodomain-interacting
protein kinase-2 on p53-dependent gene expression
Andreas Möller1,2, Hüseyin Sirma3, Thomas G Hofmann3, Hannah Staege3,
Ekaterina Gresko2, Katharina Schmid Lüdi2, Elisabeth Klimczak1, Wulf Dröge1, Hans Will3
and M Lienhard Schmitz*,2
1
German Cancer Research Center, Division of Immunochemistry (G0200), Im Neuenheimer Feld 280, Heidelberg D-69120, Germany;
University of Bern, Department of Chemistry and Biochemistry, University of Bern, Freiestr. 3, Bern 3012, Switzerland; 3Department
of General Virology, Heinrich-Pette-Institute for Experimental Virology and Immunology, Martinistrasse 52, D-20251 Hamburg
D-20251, Germany
2
HIPK2 shows overlapping localization with p53 in
promyelocytic leukemia (PML) nuclear bodies (PMLNBs) and functionally interacts with p53 to increase gene
expression. Here we demonstrate that HIPK2 and the
PML-NB resident protein Sp100 synergize for the
activation of p53-dependent gene expression. Sp100 and
HIPK2 interact and partially colocalize in PML-NBs.
The cooperation of HIPK2 and Sp100 for the induction of
p21Waf1 is completely dependent on the presence of p53 and
the kinase function of HIPK2. Downregulation of Sp100
levels by expression of siRNA does not interfere with p53mediated transcription, but obviates the enhancing effect
of HIPK2. In summary, these experiments reveal a novel
function for Sp100 as a coactivator for HIPK2-mediated
p53 activation.
Oncogene (2003) 22, 8731–8737. doi:10.1038/sj.onc.1207079
Keywords: HIPK2; Sp100; p53; PML nuclear body
Introduction
The nucleus is highly organized into discrete substructures including the promyelocytic leukemia nuclear
bodies (PML-NBs) (Salomoni and Pandolfi, 2002).
The physiological functions of PML-NBs are still
controversially discussed and the proposed relevance
for transcriptional regulation (Eskiw and Bazett-Jones,
2002), replication (Sourvinos and Everett, 2002) and
genomic stability (Zong et al., 2000) or as a nuclear
depot (Negorev and Maul, 2001) is reviewed elsewhere
(Borden, 2002). Interestingly, PML-NBs are frequently
targeted by viral infections and disrupted in acute
promyelocytic leukemia (Weis et al., 1994). Among the
permanent residents of PML-NBs are several critical
regulators of cell proliferation, apoptosis and genome
*Correspondence: M Lienhard Schmitz;
E-mail: [email protected]
Received 2 May 2003; revised 2 August 2003; accepted 5 August 2003
stability, including HAUSP(USP7), Daxx, pRB, BLM
and Sp100 (Seeler and Dejean, 2001).
The Sp100 protein was identified using the sera from
patients suffering from primary biliary cirrhosis and,
due to its ‘speckled’ appearance in the nucleus, termed
Sp100 (for speckled protein of 100 kDa) (Szostecki et al.,
1990). The Sp100 family of proteins comprises the
Sp110, Sp140/LYSp100 and the autoimmune regulator
protein (AIRE), a transactivator which is mutated in a
hereditary autoimmune disease (Vogel et al., 2002). All
members of the Sp100 protein family share an
N-terminal HSR (homogeneously staining region) domain (Sternsdorf et al., 1999). Sp100 proteins occur in at
least four different spliced forms, with Sp100 A (480
amino acids, migrating aberrantly at 90–100 kDa) being
the most abundant form (Rogalla et al., 2000; Negorev
and Maul, 2001; Seeler and Dejean, 2001). The larger
variant Sp100 HMG encodes additional functional
domains such as a SAND domain and a HMG box.
Both splice variants can be covalently modified by
SUMO-1 and are transcriptionally upregulated by
interferons (Guldner et al., 1992). When attached to
DNA upon fusion to the DNA-binding domain of the
yeast Gal4 protein, Sp100 inhibits basal transcription.
The Sp100 protein bears a C-terminal transactivation
domain that is active in the full-length protein in yeast,
but not in mammalian cells where it is masked by the Nterminus (Bloch et al., 2000). Sp100 most likely does not
bind to DNA alone, but may be recruited to the DNA
via association with DNA-binding proteins such as
hHMG2/DSP1, heterochromatin protein 1 (HP1) (Seeler et al., 1998), the B-cell-specific transactivator Bright
(Zong et al., 2000) or ETS-1 (Wasylyk et al., 2002).
While interaction of Sp100 with hHMG2/DSP1, HP1 or
Bright mediates transcriptional repression, binding to
ETS-1 stimulates the expression of ETS-1 target genes.
Among the proteins inducibly associating with a
subfraction of PML-NBs are the serine/threonine kinase
HIPK2, the transcriptional regulator p53 and the
acetylase CBP. HIPK2 and its homolog HIPK1 can
bind via their C-terminal sequences to p53 (D’Orazi
et al., 2002; Hofmann et al., 2002; Kim et al., 2002;
Kondo et al., 2003). Binding of HIPK2 to p53 leads to
Sp100 is important for stimulatory effect
A Möller et al
8732
Results
Sp100 and HIPK2 cooperate to induce p53-dependent
gene expression
To investigate the impact of Sp100 on HIPK2-induced
p53 activity, human U2OS cells were transfected with
various combinations of expression vectors encoding
Sp100 and the wild-type and kinase inactive (K221A)
point mutant of HIPK2, along with a pG13-luc
luciferase reporter gene controlled by multimers of
intact p53-binding sites (Figure 1a). While expression of
HIPK2 induced p53-dependent transcription, Sp100 or
kinase inactive HIPK2 failed to trigger reporter gene
expression. Coexpression of HIPK2 and Sp100 synergistically stimulated reporter gene activity, thus suggesting a transactivating role for Sp100. To ensure that the
observed effects are dependent on the p53-binding sites,
the experiment was repeated using the pMG15-luciferase reporter gene containing mutated p53-binding sites
in the promoter (Figure 1b). The absence of intact p53
sites precluded HIPK2/Sp100-mediated gene induction,
thus revealing that the observed effects are p53dependent.
To measure the impact of Sp100 on HIPK2-mediated
gene expression in the context of a natural p53dependent promoter, p53-deficient H1299 cells were
transfected with a p21Waf1 promoter fused to the
luciferase gene together with vectors encoding HIPK2,
p53 and Sp100 (Figure 2a). In the absence of p53,
coexpression of HIPK2 and Sp100 failed to induce
transcription of p21Waf1. Upon expression of p53,
HIPK2-mediated upregulation of p21Waf1 was further
boosted by Sp100. To address the question as to whether
HIPK2 and Sp100 also synergize for the induction of
p21Waf1 expression within its natural chromatin context,
U2OS cells were transfected with vectors encoding
Oncogene
a
Luciferase
fold activation
pG13-luc
15
10
5
HIPK2 WT
-
+
HIPK2 K221A
-
-
Sp100
-
-
b
-
+
-
+
-
-
+
-
+
+
+
-
pMG15-luc
Luciferase
fold activation
phosphorylation of p53 at serine 46, thus enabling
subsequent CBP-mediated acetylation of p53, which in
turn promotes p53-dependent target gene expression.
Activated p53 then mediates either growth arrest at the
G1/S or G2/M cell cycle transitions or apoptosis
(Hofmann et al., 2002). Accordingly, the stimulatory
function of HIPK2 on p53 enhances the expression of
p53 target genes such as p21Waf1 or Bax and stops cell
proliferation or induces apoptosis depending on its
kinase activity (Greenwood, 2002). Immunofluorescence
studies revealed a minor fraction of HIPK2 in PMLNBs (Möller et al., 2003). Treatment of cells with UV
irradiation and As2O3 increased the colocalization
between p53 and HIPK2 in PML-NBs, while expression
of the PML isoform PML-IV efficiently translocated
HIPK2 into this subnuclear structure (D’Orazi et al.,
2002; Hofmann et al., 2002). Given the corecruitment of
HIPK2 and p53 to PML-NBs, we analysed the effects of
the putative transcriptional regulatory Sp100 protein on
HIPK2/p53-mediated transcription. A variety of experimental approaches revealed Sp100 as a coactivator for
HIPK2/p53-mediated transcription.
15
10
5
HIPK2 WT
-
+
-
-
+
-
HIPK2 K221A
-
-
+
-
-
+
Sp100
-
-
-
+
+
+
Figure 1 Synergistic activation of p53-dependent gene expression
by HIPK2 and Sp100. (a) U2OS cells were cotransfected with
luciferase reporter constructs controlled by multimers of intact
(pG13-Luc) p53-binding sites and expression vectors encoding
HIPK2, HIPK2 K221A or Sp100 as shown. (b) The experiment
was done as in (a), with the exception that a reporter gene
controlled by multimers of mutated (pMG15-Luc) p53-binding
sites was used. At 1 day post-transfection, cells were harvested and
tested for luciferase activity. Transactivation by the empty
expression vector was arbitrarily set as 1; bars indicate standard
deviations from three independent experiments
HIPK2 and/or Sp100 and analysed for p21Waf1 by
Western blotting. While HIPK2 alone increased
p21Waf1 protein levels, coexpression of Sp100 led to a
further increase in the amount of this cell cycle regulator
(Figure 2b). The transcriptional synergism between
HIPK2 and Sp100 for induction of the p21Waf1 promoter
also occurred in nontransformed HS27 cells (Figure 2c),
thus ensuring the physiological relevance of the observed effects.
Mapping of Sp100 and HIPK2 domains mediating the
cooperative effect on p53-induced transcription
In order to map the HIPK2 region mediating this
cooperative effect with Sp100, various deletion mutants
of HIPK2 were tested in the absence or presence of
coexpressed Sp100 for their effect on the p21Waf1
promoter-dependent luciferase reporter gene (Figure 3).
HIPK2 variants lacking either the C-terminal or
N-terminal regions or consisting of the kinase domain
all failed to cooperate with Sp100 for the induction of
Sp100 is important for stimulatory effect
A Möller et al
8733
a
Luciferase
fold activation
Luciferase
fold activation
20
10
p53
HIPK2 WT
HIPK2 K221A
-
- -
- -
- - + - -
-
+ + + + + +
10
+ -
Sp100
HIPK2 WT
-
- + -
- + -
- +
HIPK2 K221A
-
+ - - - + - - - + -
HIPK2 ∆C
-
-
-
-
HIPK2 ∆N HIPK2 KD -
-
-
-
-
-
- + + +
α p21 Waf1
α FLAG
20
+ - -
- + + +
HIPK2
Sp100
30
-
- + -
- + -
Sp100
b
p21Waf1-luc
p21Waf1-luc
-
-
+
-
+
+
+
HIPK2
-
+ + + + + - - - - + - - -
+
-
+ - - - + - - - + - - - + - - - - - - - + +
Figure 3 Mapping of the HIPK2 domains mediating cooperation
with Sp100. A p21Waf1-luciferase reporter gene and the indicated
HIPK2 variants were expressed either alone or together with Sp100
in U2OS cells. The next day, extracts were prepared and tested for
luciferase activity; results are displayed as in Figure 2. Correct
expression of the FLAG-tagged proteins was ensured by Western
blotting (data not shown). Data are from two experiments
performed in duplicate; bars indicate standard deviations
Sp100
α β-Actin
p21Waf1-luc
Luciferase
fold induction
c
6
4
2
pcDNA3
+
-
-
-
HIPK2 WT
-
+
-
+
Sp100
-
-
+
+
Waf1
Figure 2 Sp100 and HIPK2 cooperate to induce p21
expression. (a) H1299 cells were transfected with a p21Waf1-luciferase
reporter gene in combination with expression vector for p53,
HIPK2, HIPK2 K221A or Sp100 as shown. Reporter gene
activation induced by empty control vector was arbitrarily set as
1. Error bars represent standard deviations from three independent
experiments performed in duplicate. (b) U2OS cells were transfected with the indicated expression vectors encoding FLAGtagged HIPK2 or FLAG-tagged Sp100. Aliquots of cell lysates
were tested by Western blotting for p21Waf1 (upper) and expression
of HIPK2, Sp100 and the loading control b-actin (lower). (c) HS27
cells were transfected with a p21Waf1-luciferase reporter gene and the
indicated expression vectors for HIPK2 and Sp100. Results from
two independent experiments performed in triplicate are shown;
error bars indicate the standard deviations
p21Waf1, indicating that the entire kinase is required for
this functional interaction. The relevance of various
Sp100 domains allowing cooperative induction of gene
expression was mapped using a similar experimental
approach. Sp100 mutants lacking the indicated functional domains (Figure 4a) were expressed either alone
or in combination with HIPK2 and the p21Waf1 luciferase
reporter gene.
Proteins lacking either the N-terminal HSR domain
or the C-terminal sequences failed to significantly
support HIPK2/p53-triggered transcriptional activation. Also, the Sp100 variant lacking the C-terminal
transactivation domain (Sp100 1–334) did not enhance
HIPK2-mediated transcription. A point mutant with a
lysine-to-alanine exchange in the SUMOlation site
(Sp100 K297R SUMO ) still fully retained its ability
to synergize with HIPK2 for the activation of the p21Waf1
(Figure 4b), arguing against the relevance of SUMO
modification for this synergism.
HIPK2 and Sp100 interact and partially colocalize
To investigate whether the functional interaction
between Sp100 and HIPK2 also involves physical association of both proteins, coimmunoprecipitation experiments were performed. HIPK2 was immunoprecipitated
from U2OS cell extracts. Subsequent immunoblotting
revealed that Sp100 coimmunoprecipitated only with
aHIPK2 antibodies, but not with control antibodies,
demonstrating the interaction of both endogenous
proteins in vivo (Figure 5a). Colocalization of both
proteins was investigated by expressing green fluorescent
protein (GFP)-tagged HIPK2 and Sp100 in cells.
Oncogene
Sp100 is important for stimulatory effect
A Möller et al
8734
a
Immunoprecipitation
HSR
TAD
HSR
TAD
SAND
HMG-Box
Co
nt
ro
l
HI
PK IgG
2
700 800 900
α
HMG
600
e
Sp100
400 500
SUMO
MHC Homology
A
300
α
100 200
Amino Acids
Ly
sa
t
a
HMG-Box
Sp100
Sp100 128-478
WB: α Sp100
IgGH
Sp100 296-890
Sp100 339-890
Sp100 619-890
WB: α HIPK2
Sp100 704-890
HIPK2
Sp100 1-334
b
K/A
Sp100 SUMO
b
HIPK2
+
Sp100 +
Sp100 128-478 +
Sp100 296-890 +
Sp100 339-890 +
Sp100 704-890 +
Sp100 208-480 +
Sp100 SUMO +
Sp100 1-334 +
Sp100 619-890 +
-fold activation of
p21Waf1-Luc
0
5
10
15
20
25
Figure 4 Mapping of the Sp100 domains mediating synergism
with HIPK2. (a) Schematic representation of the Sp100 A and
Sp100 HMG proteins and their derivatives. The positions of amino
acids are given at the left side; the domain structures are indicated.
(b) U2OS cells were transfected with a p21Waf1-luciferase gene and
expression vectors for the indicated Sp100 variants and HIPK2 as
shown. Reporter activity is given as fold induction; error bars show
standard deviations derived from three independent experiments
Immunofluorescence staining revealed predominant
localization of HIPK2 in discrete subnuclear speckles
which were partially colocalizing with the Sp100 protein
(Figure 5b). Colocalization between the endogenous
proteins was investigated in U2OS cells, which showed
areas of overlapping residence for both proteins in
nuclear bodies, as revealed by confocal microscopy
(Figure 5c).
Sp100 contributes to HIPK2-mediated p53 activation
The importance of Sp100 for HIPK2-mediated p53
activation was investigated by testing the effect of
siRNAs specific for Sp100 on HIPK2/p53-induced
Oncogene
GFP-HIPK2
Sp100
HIPK2
Sp100
Merge
Hoechst
Merge
DraQ5
c
Figure 5 Sp100 and HIPK2 co-precipitate and colocalize in the
nucleus. (a) U2OS cells were treated for 8 h with INFg and lyzed.
Endogenous HIPK2 was immunoprecipitated from an aliquot of
the cell lysates with rabbit polyclonal aHIPK2 antibodies. Control
antibodies were added to another aliquot of the cell extract.
Proteins were eluted from the washed immunoprecipitates with 1 SDS sample buffer and analysed by Western blotting either for the
occurrence of Sp100 (upper) or HIPK2 (lower). (b) U2OS cells were
transfected to express GFP-HIPK2. GFP-HIPK2 was detected by
the intrinsic fluorescence of GFP; Sp100 (red) was visualized by
indirect immunofluorescence. An overlay of both stainings reveals
areas of colocalization in yellow, as indicated by the arrows.
Nuclear DNA was visualized with Hoechst. (c) U2OS cells were
stained by indirect immunofluorescence for endogenous HIPK2
(green) and endogenous Sp100 (red), and analysed by confocal
microscopy. Areas of overlapping localization (yellow) are
indicated by arrows
transcription. A control experiment ensured that transfection of U2OS cells with pSUPER-Sp100, a vector
that directs the synthesis of small interfering RNAs
(siRNAs) specific for Sp100, leads to a reduction of
relative Sp100 expression levels (Figure 6a). The
incomplete reduction can be attributed to the limited
transfection efficiency. To look for the effects on gene
expression, U2OS cells were transfected with the p21Waf1
luciferase reporter gene and expression vectors encoding
HIPK2 in the absence or presence of pSUPER-Sp100.
HIPK2-induced transcription was impaired in the
presence of Sp100 siRNAs (Figure 6b), indicating that
Sp100 is important for stimulatory effect
A Möller et al
8735
a
triggered transcription was decreased. These experiments suggest that Sp100 acts upstream from p53.
WB:
αSp100
Sp100
β-Actin
β
α β-Actin
pSUPER
+
-
pSUPER-Sp100
-
+
b
p21Waf1-luc
Luciferase
fold activation
8
*
6
4
2
HIPK2
pSUPER
-
+
-
+
+
+
-
pSUPER-Sp100
-
-
-
+
c
Luciferase
Fold activation
p21Waf1-luc
*
10
5
-
-
-
-
-
-
+
+
+
+
+
+
-
+
-
-
+
+
-
+
-
-
+
+
pSUPER
-
-
+
-
+
-
-
-
+
-
+
-
pSUPER-Sp100
-
-
-
+
-
+
-
-
-
+
-
+
p53
HIPK2 wt
Figure 6 Interference with Sp100 expression attenuates HIPK2mediated activation of p53-dependent gene expression. (a) U2OS
cells were transfected either with the empty pSUPER control vector
or pSUPER-Sp100, which allows production of a siRNA
attenuating endogenous Sp100 expression. Equal amounts of
protein contained in lysates were tested by immunoblotting for
the occurrence of Sp100 (upper) and b-actin (lower). (b) U2OS cells
were transiently transfected with a p21Waf1-dependent reporter gene,
along with an expression vector encoding HIPK2, the pSUPER
vector or pSUPER-SP100, and luciferase activity was determined.
(c) H1299 cells expressing the indicated combinations of p53 and
HIPK2 were tested for p21Waf1-luciferase production in the absence
(pSUPER) or presence (pSUPER-Sp100) of siRNA specific for
Sp100. In all experiments, the mean values showing luciferase
activity from four independent experiments performed in duplicate
are displayed. Error bars show standard deviations; the statistical
significance (Po0.01) is indicated by a star
diminished amounts of Sp100 negatively interfere with
HIPK2 function. In order to learn whether interference
with Sp100 expression targets only HIPK2- or also p53mediated signals, H1299 cells were transfected with the
p21Waf1 luciferase reporter gene along with various
combinations of p53 and HIPK2 expression vectors in
the absence or presence of pSUPER-Sp100 (Figure 6c).
Reduced Sp100 expression remained without any impact
on p53-induced gene expression, while HIPK2/p53-
Discussion
Here we show that Sp100 and HIPK2 cooperate to
induce p53-dependent gene expression, as revealed by a
variety of experimental approaches. Enhancement of
transcriptional activity occurs in the absence of Sp100
DNA binding, as the coactivating function was also seen
for Sp100 A, the predominant Sp100 variant that lacks
the DNA-binding SAND and HMG domains. Although
Sp100 contains no typical coactivator consensus motifs
such as the LXXLL signature, the integrity of the
C-terminal transactivation domain is important for its
coactivating function. Also, the deletion of N-terminal
sequences important for PML-NB recruitment and
Sp100 self-aggregation (Negorev et al., 2001) precluded
the coactivator function. Similar to the PML protein,
Sp100 also displays transcriptional regulatory properties. Sp100 has been implicated in transcriptional
repression (Lehming et al., 1998) and there is also
recent evidence for a role as a coactivator for ETS-1driven transcription (Wasylyk et al., 2002). This work
adds evidence for a role of Sp100 in transcriptional
coactivation. HIPK2 and Sp100 interact, and partial
colocalization is seen in distinct nuclear bodies and the
nucleoplasm. It is currently not clear whether both
proteins bind directly or indirectly via contact to a
common binding partner. Since both proteins have
several reported binding partners, the stoichiometry or
the existence of distinctly composed complexes remains
to be solved. We also investigated the possible HIPK2mediated phosphorylation of Sp100, but several in vivo
and in vitro experiments failed to give evidence for such
a direct phosphorylation under the conditions used
(data not shown).
The stimulatory role of Sp100 for HIPK2 function
may be explained by several mechanisms: (I) HIPK2mediated events could cause a loss of Sp100-mediated
repression, for example, by lowering the affinities of
Sp100 to repressor proteins. Accordingly, HIPK2 can
control the corepressor activity of Groucho (Choi et al.,
1999). Since the interaction of Sp100 with members of
the HP1 family of nonhistone chromosomal proteins is
regulated by SUMOlation (Seeler et al., 1998), the full
coactivator function of Sp100 SUMO mutant argues
against an involvement of HP1 proteins. (II) HIPK2
could induce the oligomerization of Sp100 with the
transactivating Sp100 family members Sp110 and
Sp140/LYSp100 or other transcriptional activators.
(III) The reported decomposition of PML-NBs
mediated by HIPK2 (Engelhardt et al., 2003) or HIPK1
(Ecsedy et al., 2003) could possibly induce relocation of
Sp100 to opened chromatin sites allowing transcriptional initiation. Since overexpressed Sp100 is preferentially deposited outside from PML-NBs (Negorev and
Maul, 2001) and mutual binding of HIPK2 and Sp100
was only observed after interferon-induced upregulation
of Sp100, it might be possible that HIPK2/Sp100
Oncogene
Sp100 is important for stimulatory effect
A Möller et al
8736
interactions occur outside from PML-NBs. Accordingly, the main fraction of HIPK2 is contained in HIPK
domains that are distinct from PML-NBs (Möller et al.,
2003). Further support for the idea that the coactivating
function of Sp100 is exerted outside from the PML-NBs
comes from the finding that the coactivating function of
Sp100 for transcription factor ETS-1 occurs after ETS1-mediated displacement of Sp100 from PML-NBs
(Wasylyk et al., 2002). (IV) Our experiments show that
Sp100 is important for HIPK2-mediated effects, while
p53-driven transcription remains unaffected. This selectivity shows that Sp100 acts upstream from p53, and
may be taken as an indication that the function of Sp100
as a repressor or a coactivator might depend on the
activating signal and/or the chromatin context.
Immunofluorescence
Cells were grown in 12-well plates on coverslips and either left
untransfected or transfected with 100 ng of the indicated
expression vectors. The next day, cells were washed with
phosphate-buffered saline (PBS) and fixed for 1 min at 201C
with methanol/acetone (1 : 1). After drying, cells were rehydrated in PBS and blocked in PBS containing 5% (v/v) goat
serum for 30 min. Cells were then incubated with the primary
antibodies for 60 min at room temperature and washed five
times for 5 min in PBS before incubation with the appropriate
fluorochrome-conjugated secondary antibodies for 45 min.
The following secondary antibodies were used: Alexa Fluor488-coupled goat anti-rabbit and Alexa Fluor 594-coupled
goat anti-rat (Molecular Probes). After washing once with
PBS, chromosomal DNA was stained with Hoechst 33258
(1 mg/ml) or DraQ5 for 15 min. Cells were washed four more
times in PBS, mounted on glass slides and examined using a
confocal laser microscope (Leica).
Materials and methods
Co-precipitation experiments and immunoblotting
Cell culture and transfections
Human U2OS, HS27, and H1299 cells were maintained in
Dulbecco’s modified Eagle’s medium supplemented with 10%
(v/v) fetal calf serum and 1% (v/v) penicillin/streptomycin (all
from Life Technologies). These cell lines were transfected using
the Superfects reagent (Qiagen Inc.), according to the
instructions of the manufacturer.
Plasmids and antibodies
The reporter plasmids pG13-Luc, pMG15-Luc (Kern et al.,
1992) and p21Waf1-Luc (el Deiry et al., 1993), as well as the
vectors encoding HIPK2, HIPK2 K221A, HIPK2DC (amino
acids 1–520), HIPK2DN (amino acids 551–1191), HIPK2 KD
(amino acids 189–520) and GFP-HIPK2 were published
(Hofmann et al., 2002). Sp100 and its mutant derivatives were
described (Sternsdorf et al., 1999). The pSUPER-Sp100 vector
was constructed by inserting the annealed oligonucleotides:
5-GATCCCCACCAGTAGCAAATGAGATGTTCAA GAGACATCTCATTTGCTACTGGTTTTTTGGAAA
and
5-AGCTTTTCCAAAAAACCA GTAGCAAATGAGATGT
CTCTTGAACATCTCATTTGCTACTGGTGGG in the
pSUPER vector (Brummelkamp et al., 2002) opened with
BglII and HindIII. All constructs were characterized by
restriction digest and DNA sequencing. Antibodies recognizing Flag (M2), p21Waf1 (F-5), p53 (DO-1) and b-actin were
from Santa Cruz Inc. The rat aSp100 antibody (Sternsdorf
et al., 1999) and affinity-purified rabbit polyclonal aHIPK2
antibody (Hofmann et al., 2002) were described.
Luciferase assays
Total cell extracts were measured in a luminometer (Duo
Lumat LB 9507, Berthold) by automatically injecting 50 ml of
assay buffer and measuring light emission for 10 s after
injection according to the instructions of the manufacturer
(Promega Inc.). Luciferase activities were normalized on the
basis of b-galactosidase activity of a cotransfected RSV-b-gal
vector.
Cell extracts contained in NP-40 high salt lysis buffer (20 mM
Tris/HCl pH 7.5, 300 mM NaCl, 1 mM phenylmethylsulfonylfluoride, 10 mM NaF, 0.5 mM sodium vanadate, leupeptine
(10 mg/ml), aprotinin (10 mg/ml), 1% (v/v) NP-40 and 10%
(v/v) glycerol) were diluted with salt-free NP-40 buffer to a
final NaCl concentration of 150 mM. Extracts were either
directly analysed by Western blotting or immunoprecipitated
following preclearance with protein A/G sepharose and 2 mg of
a control IgG. A volume of 2 mg of precipitating antibodies
and 25 ml of protein A/G sepharose were added to the
precleared lysate and rotated 6 h on a spinning wheel at 41C.
The immunoprecipitates were washed 5 in lysis buffer and
eluted by boiling in 1 SDS sample buffer. Following
separation by SDS–PAGE, proteins were blotted to a
polyvinylidene difluoride (PVDF) membrane (Millipore). The
membrane was blocked and then incubated in TBST containing the primary antibody and 2% (w/v) milk powder. The
respective proteins were incubated with an appropriate
secondary antibody coupled to horseradish peroxidase, and
visualized by enhanced chemiluminescence according to the
instructions of the manufacturer (NEN).
Acknowledgements
Our work was supported by grants from the Deutsche
Forschungsgemeinschaft (Schm 1417/3-1), Fonds der chemischen Industrie, EU project (QLK3-CT-2000-00463) sponsored by the Schweizerisches Bundesamt für Bildung und
Wissenschaft, Oncosuisse, Schweizerischer Nationalfonds,
Association for International Cancer Research, ‘Stiftung zur
Förderung der wissenschaftlichen Forschung an der Universität Bern’ and a grant from the Roche Research Foundation
awarded to AM and MLS. The work of HS, TGH, HS and
HW was supported by grants from the ‘Stiftung zur
Bekämpfung Neuroviraler Erkrankungen’, the Deutsche
Krebshilfe (Wi2-10-1624) and the Deutsche Forschungsgemeinschaft (HO 2438/2-1; WI664/6-2). The Heinrich-PetteInstitut is supported by the Freie und Hansestadt Hamburg
and the Bundesministerium für Gesundheit.
References
Bloch DB, Nakajima A, Gulick T, Chiche JD, Orth D,
de La Monte SM and Bloch KD. (2000). Mol. Cell. Biol., 20,
6138–6146.
Borden KL. (2002). Mol. Cell. Biol., 22, 5259–5269.
Oncogene
Brummelkamp TR, Bernards R and Agami R. (2002). Science,
296, 550–553.
Choi CY, Kim YH, Kwon HJ and Kim Y. (1999). J. Biol.
Chem., 274, 33194–33197.
Sp100 is important for stimulatory effect
A Möller et al
8737
D’Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y,
Saito S, Gostissa M, Coen S, Marchetti A, Del Sal G,
Piaggio G, Fanciulli M, Appella E and Soddu S. (2002). Nat.
Cell Biol., 4, 11–19.
Ecsedy JA, Michaelson JS and Leder P. (2003). Mol. Cell.
Biol., 23, 950–960.
el Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R,
Trent JM, Lin D, Mercer WE, Kinzler KW and Vogelstein
B. (1993). Cell, 75, 817–825.
Engelhardt OG, Boutell C, Orr A, Ullrich E, Haller O and
Everett RD. (2003). Exp. Cell Res., 283, 36–50.
Eskiw CH and Bazett-Jones DP. (2002). Biochem. Cell Biol.,
80, 301–310.
Greenwood E. (2002). Nat. Rev. Cancer, 2, 5.
Guldner HH, Szostecki C, Grotzinger T and Will H. (1992).
J. Immunol., 149, 4067–4073.
Hofmann TG, Moller A, Sirma H, Zentgraf H, Taya Y, Droge
W, Will H and Schmitz ML. (2002). Nat. Cell Biol., 4, 1–10.
Kern SE, Pietenpol JA, Thiagalingam S, Seymour A, Kinzler
KW and Vogelstein B. (1992). Science, 256, 827–830.
Kim EJ, Park JS and Um SJ. (2002). J. Biol. Chem., 277,
32020–32028.
Kondo S, Lu Y, Debbas M, Lin AW, Sarosi I, Itie A,
Wakeham A, Tuan J, Saris C, Elliott G, Ma W, Benchimol
S, Lowe SW, Mak TW and Thukral SK. (2003). Proc. Natl.
Acad. Sci. USA, 100, 5431–5436.
Lehming N, Le Saux A, Schuller J and Ptashne M. (1998).
Proc. Natl. Acad. Sci. USA, 95, 7322–7326.
Möller A, Sirma H, Hofmann TG, Rueffer S, Klimczak E,
Dröge W, Will H and Schmitz ML. (2003). Cancer Res., 63,
4310–4314.
Negorev D, Ishov AM and Maul GG. (2001). J. Cell Sci., 114,
59–68.
Negorev D and Maul GG. (2001). Oncogene, 20, 7234–7242.
Rogalla P, Kazmierczak B, Flohr AM, Hauke S and
Bullerdiek J. (2000). Genomics, 63, 117–122.
Salomoni P and Pandolfi PP. (2002). Cell, 108, 165–170.
Seeler JS and Dejean A. (2001). Oncogene, 20, 7243–7249.
Seeler JS, Marchio A, Sitterlin D, Transy C and Dejean A.
(1998). Proc. Natl. Acad. Sci. USA, 95, 7316–7321.
Sourvinos G and Everett RD. (2002). EMBO J., 21,
4989–4997.
Sternsdorf T, Jensen K, Reich B and Will H. (1999). J. Biol.
Chem., 274, 12555–12566.
Szostecki C, Guldner HH, Netter HJ and Will H. (1990).
J. Immunol., 145, 4338–4347.
Vogel
A,
Strassburg
CP,
Obermayer-Straub
P,
Brabant G and Manns MP. (2002). J. Mol. Med., 80,
201–211.
Wasylyk C, Schlumberger SE, Criqui-Filipe P and Wasylyk B.
(2002). Mol. Cell. Biol., 22, 2687–2702.
Weis K, Rambaud S, Lavau C, Jansen J, Carvalho T,
Carmo-Fonseca M, Lamond A and Dejean A. (1994). Cell,
76, 345–356.
Zong RT, Das C and Tucker PW. (2000). EMBO J., 19,
4123–4133.
Oncogene