Download A Role for Mitochondria in the Establishment and

A Role for Mitochondria in the Establishment and
Maintenance of the Maize Root Quiescent Center
Keni Jiang, Tracy Ballinger, Daisy Li, Shibo Zhang, and Lewis Feldman*
Department of Plant and Microbial Biology, University of California, Berkeley, California 94720
Mitochondria in the oxidizing environment of the maize (Zea mays) root quiescent center (QC) are altered in function, but
otherwise structurally normal. Compared to mitochondria in the adjacent, rapidly dividing cells of the proximal root tissues,
mitochondria in the QC show marked reductions in the activities of tricarboxylic acid cycle enzymes. Pyruvate dehydrogenase
activity was not detected in the QC. Use of several mitochondrial membrane potential (DCm) sensing probes indicated a
depolarization of the mitochondrial membrane in the QC, which suggests a reduction in the capacity of QC mitochondria to
generate ATP and NADH. We postulate that modifications of mitochondrial function are central to the establishment and
maintenance of the QC.
Embedded in all angiosperm root apices is a population of slowly dividing cells that together form a
region known as the quiescent center (QC). Depending
on the species, the QC varies in size from four cells in
Arabidopsis (Arabidopsis thaliana) to upward of 1,000
cells in the root apex of maize (Zea mays). On a biochemical level, one of the few known properties of the
QC is its relatively oxidized redox status, which is
reflected by the low concentrations in the QC of the
reduced forms of glutathione and ascorbic acid, the
two principal redox-regulating compounds in living
systems (Jiang et al., 2003).
Cells comprising the QC spend a prolonged period
in G1, dividing, on average, about once every 200 h
(Clowes, 1961). Because divisions are infrequent and
result in both a self-renewed QC cell and a sister cell
that leaves the QC and repopulates the initial pool, a
number of workers suggest that QC cells should be
viewed as stem cells (Barlow, 1997; Ivanov, 2004; Jiang
and Feldman, 2005). How this balance between selfrenewing divisions and differentiation is regulated is
not understood. However, recent work with animal
stem cells points to redox state as having a central role
in modulating this equilibrium (Smith et al., 2000).
We have hypothesized that the QC is established
and maintained as a consequence of auxin that is
polarly transported to the root tip, where it can accumulate to relatively high levels leading to the oxidized
state in the QC (Jiang and Feldman, 2003, 2005). How
auxin influences redox status is not known. But what is
clear is that oxidative stress can compromise many
* Corresponding author; e-mail [email protected];
fax 510–642–4995.
The author responsible for distribution of materials integral to the
findings presented in this article in accordance with the policy
described in the Instructions for Authors (www.plantphysiol.org) is:
Lewis Feldman ([email protected]).
Article, publication date, and citation information can be found at
www.plantphysiol.org/cgi/doi/10.1104/pp.105.071977.
1118
cellular activities, including, as has been reported,
mitochondrial function (Jiménez et al., 1998). Depending on the severity of the oxidized stress, mitochondria
can respond in different ways, including a reduction in
the flux capacities of the tricarboxylic acid (TCA) cycle,
thereby affecting the synthesis of ATP and NADH/
NADPH and, as a consequence, affecting energydependent activities, including cell division. Stressinduced reductions in mitochondrial function have
been visualized through the use of dyes whose extent
of accumulation in mitochondria reflects mitochondrial activity (Smith et al., 2000).
Thus, given the known oxidized redox status of the
QC and reports of compromised mitochondrial functioning under conditions of oxidative stress, we investigated whether alterations in mitochondrial activity
occur in the QC. Here we report differences between
mitochondria in the slowly dividing QC cells compared to mitochondria in the adjacent, rapidly dividing cells of the proximal meristem (PM). We suggest
that these changes in mitochondrial function may underlie the establishment and maintenance of the QC
and, as well, link auxin and oxidative stress.
RESULTS
Three approaches were taken to characterize mitochondria in the QC: (1) examining mitochondrial ultrastructure; (2) evaluating mitochondrial physiological
activity; and (3) evaluating the levels, status, and
processing of specific mitochondrial transcripts (either
nuclear or mitochondrial encoded).
QC Mitochondria Show Normal Structure
Mitochondria in the QC were characterized and
compared to like organelles in the adjacent, rapidly
dividing cells bordering on the proximal face of the
QC (the PM; Jiang and Feldman, 2005; Fig. 1, A and B).
QC mitochondria are egg-to-oval shaped, numerous,
Plant Physiology, March 2006, Vol. 140, pp. 1118–1125, www.plantphysiol.org Ó 2006 American Society of Plant Biologists
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Mitochondria and Maize Root Quiescent Center Establishment
oxidized in the presence of peroxides (Collins et al.,
2000) and that we previously used to assess QC redox
status (Jiang et al., 2003). QCs are treated with the
reduced form of H2DCFDA, which when supplied is
colorless. As the dye is oxidized, it fluoresces in UV
light and thereby points to a relatively oxidizing microenvironment in the QC (Fig. 2A).
Mitochondrial Membrane Potential Differs in the QC
Figure 1. Longitudinal sections of the maize root tip. A, Light
micrograph indicating the locations of the QC, PM, and root cap
(RC). B to F, Transmission electron micrographs of the maize root tip. B,
Longitudinal section of the maize root tip/QC at low magnification. The
RC was removed just prior to fixation. QC cells marked with an asterisk
(*) were examined further at higher magnification (C and D). Note cell
files converging in the QC. C, QC cell in longitudinal section. Note
large number of round-to-oval-shaped mitochondria (arrow) encircling
the nucleus (N). D, High-power view of C showing that QC mitochondria (arrow) have intact double membranes and cristae. E and F, Cells
from the PM. Note the relatively thin walls (indicative of a relatively
high rate of mitosis), and dumbbell-shaped mitochondria (arrow)
clustered about the nuclei.
and encircle the nucleus (Fig. 1, C and D). A continuously intact, double membrane is evident, as are cristae
(Fig. 1D). As in the QC, mitochondria in the PM encircle
the nucleus (Fig. 1E). However, in contrast to QC mitochondria, PM mitochondria frequently assumed a
dumbbell shape (in approximately two-thirds [eight] of
the roots examined ultrastructurally), and this is interpreted as indicative of their capacity to divide (Fig. 1, E
and F). A delimiting double membrane is evident, as are
cristae that extend inward, about one-third to one-half
of the diameter of the mitochondrion (Fig. 1F, arrow).
Reconfirmation of the Oxidized Status of the QC
We reconfirmed the relatively oxidized redox status
of the QC through the use of H2DCFDA, a dye that is
JC-9 and MitoTracker Orange are two mitochondrial
membrane potential (DCm) sensing probes that are
used to indicate the cellular energy levels of mitochondria (Duchen et al., 1993; Sureau et al., 1993;
Cossarizza et al., 1994; Castedo et al., 1996). Both probes
accumulate in mitochondria that maintain a membrane potential. MitoTracker Orange is particularly
useful because once it enters the mitochondrion it
reacts with thiols on proteins and peptides to form an
aldehyde-fixable conjugate. An absence or low fluorescence of the dye in the mitochondrion indicates a
depolarization of the inner mitochondrial membrane
and thereby suggests a reduction in the capacity of
these mitochondria to generate ATP (Waterhouse et al.,
2001). When QCs are treated with these probes, mitochondria in cells at the margins of the QC accumulate
the dye and fluoresce, whereas mitochondria in central
QC cells show no fluorescence (Fig. 2, B–E). The
pattern of mitochondrial staining is nearly identical
for both probes and thereby points to an absence or
marked reduction of mitochondrial membrane potential (DCm) in central QC cells and suggests, therefore, a
decrease in the capacity of these cells to generate
energy-rich reductants.
TCA Cycle Enzyme Activities and Substrates Are
Lowered in the QC
We assayed the activities of a number of TCA cycle
enzymes, including pyruvate dehydrogenase (PDH),
a-ketoglutarate dehydrogenase (KDH), succinate dehydrogenase (SDH), malate dehydrogenase (MDH),
and malic enzyme (ME). Except for PDH, activities for
all other enzymes are detected in both QC and PM
extracts. When normalized to total protein per milligram of tissue, individual enzymes were 3 to 10 times
more active in the PM compared to the QC (Table I).
Notable is the absence of any measurable PDH activity
in the QC. Pyruvate concentrations also differed between the two tissues; pyruvate was approximately 8
to 10 times more concentrated in the PM (12 6 2 mM
mg21) compared to the QC (1.5 6 0.7 mM mg21).
Expression of Nuclear-Encoded Transcripts for
Mitochondrial Proteins Is Reduced in the QC
Based on the observation that nuclear-encoded
transcripts of mitochondrial proteins may be altered
by stress (Giegé et al., 2005), we investigated whether
the reduced activities in the QC of TCA cycle enzymes (Table I) could be related to reductions in
Plant Physiol. Vol. 140, 2006
1119
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Jiang et al.
Figure 2. Whole mounts of QCs treated with various
probes. Scale bar 5 100 mm (except in C where the
scale bar 5 25 mm). A, Treated with carboxyH2DCFDA (C-400). Bright staining in the center of
the QC points to the relatively oxidized redox status
of this region. B and C, Whole mounts of a QC
treated with the mitochondrial marker dye, Mitotracker Orange. Fluorescing mitochondria occur at
the margins, but not in the center, of the QC. C, Highmagnification view of B showing a strip of cells
extending from the outside edge of the QC to the
center (*). Fluorescing mitochondria are evident
clustered around nuclei (arrow). D and E, Whole
mounts of two different QCs treated with the dye
JC-9. Fluorescing mitochondria (numerous small
white dots) occur in cells at the margins, but not in
the center (*), of the QC. Bright, diffuse staining is
artifact.
transcription. We measured the levels of transcripts
in the QC for three nuclear-encoded TCA cyclerelated proteins (or protein subunits; PDH, SDH,
and ME) and compared their levels to those in the
adjacent PM. We found that all three transcripts show
a 20% to 30% reduction in expression in the QC
(relative to the total mRNA) compared to their levels
in the adjacent PM (Table II).
QC and PM Cells Have a Similar Editing Status for
Mitochondrial mRNAs
Mitochondrial transcripts (mtRNA) are typically
extensively edited, which involves the conversion of
cytidines to uridines (Gagliardi and Gualberto, 2004).
We investigated the status of mtRNA editing in the QC
by examining specific mitochondrial transcripts for
which editing has already been reported in maize,
namely, ribosomal protein S13 (RSP13; GenBank accession no. AF079549; Williams et al., 1998) and ATP
synthase subunit 9 (ATP9; GenBank accession no.
AF390542; Grosskopf and Mulligan, 1996). In both
the QC and PM, ATP9 is completely edited, as has
previously been reported for this transcript in other
maize tissues (suspension-cultured cells and seedlings; Grosskopf and Mulligan, 1996). We sequenced
five QC cDNA ATP9 clones; all showed complete
editing at the seven editing sites characterized in
maize by Grosskopf and Mulligan (1996). In contrast
to ATP9, RSP13 was incompletely edited (Table III).
This gene has six C-to-U editing sites, of which
Williams et al. (1998) report that 70% of the examined
30 cDNA clones were edited in all six sites, and 3%
Table I. Comparison of TCA enzyme activities in the QC and PM
Activities are measured spectrophotometrically (see ‘‘Materials and
Methods’’ for specifics on each enzyme) and normalized to 100 mg of
total protein. Values are means 6 SD (n 5 3). For each enzyme, mean
values of the QC and PM were compared using Student’s t test and
found to be significant at the 95% confidence level (P , 0.05).
OD/100 mg Total Protein
TCA Enzyme
ME
MDH
PDH
KDH
SDH
PM
0.113
1.37
0.005
0.058
0.035
6
6
6
6
6
QC
0.026
0.12
0.002
0.008
0.007
1120
0.030 6 0.006
0.185 6 0.014
None detected
0.005 6 0.002
0.006 6 0.001
PM/QC
3.8
7.4
–
10
5.8
Plant Physiol. Vol. 140, 2006
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Mitochondria and Maize Root Quiescent Center Establishment
Table II. Comparison of transcript levels between the QC and PM
using quantitative reverse transcription-PCR
Ratio of Transcript
Level (QC/PM)a
Gene Name
Iron sulfur subunit of SDH precursor
NAD-dependent ME, mitochondrial precursor
PDH E1 a-subunit
AUX1
0.77
0.70
0.8
2.21
6
6
6
6
0.02
0.04
0.02
0.23
a
After normalizing all samples to the Kan 1.2 gene. All ratios are
averages of two independent experiments (n 5 2) 6SD.
were completely unedited. We sequenced six RSP13
cDNA clones from both the QC and PM (a total of 12).
Two of the six (33%), either from the PM or the QC,
were incompletely edited (none showed no editing),
whereas four of the six (66%) were completely edited
in both the QC and PM. Thus, we conclude that the
mtRNA editing process is similar in both the QC and
PM and is consistent with other reports of the editing
status of these mitochondrial transcripts in maize
(Grosskopf and Mulligan, 1996; Williams et al., 1998).
DISCUSSION
The maize QC is composed of cells that spend an
extended period of time (.180 h) in G1. The reasons
for this prolonged G1 are not known, but because
these cells are under oxidative stress (Jiang et al., 2003;
Fig. 2A), we considered the possibility that reactive
oxygen species may mediate the induction of G1 cell
cycle arrest, as has been reported for other systems
(Hutter et al., 1997; Reichheld et al., 1999; Smith et al.,
2000; Boonstra and Post, 2004). In mice, sublethal
doses of hydrogen peroxide induce a rapid, transient
growth arrest in fibroblasts by activating cell cycle
checkpoints at G1 and S (Barnouin et al., 2002), and in
human colonic CaCo-2 cells, Noda et al. (2001) report
that mild intracellular redox imbalance can inhibit the
G1-S transition. Toward elucidating the mechanism of
G1 arrest in the QC, we considered reports noting that
mitochondria are very sensitive to oxidative stress (Fujie
et al., 1993), which can cause damage to mitochondrial
components (Valls et al., 1994; Beyer et al., 1996; Brady
et al., 2004), leading to a disruption of mitochondrial
membrane potential (DCm), an attendant impairment
in mitochondrial function, and cell cycle arrest (Yoon
et al., 2005). Based on this scenario, we investigated
whether G1 cell cycle arrest in the QC is associated
with an alteration in mitochondrial function, including
alterations in membrane potential (DCm), mitochondrial physiology, and perhaps even structure.
An Absence of Membrane Potential Suggests That QC
Mitochondria Are Compromised in Their Capacity to
Generate ATP
The absence of uptake and/or oxidation of mitochondrial membrane marker dyes (JC-9 and Mito-
Tracker Orange) into the central region of the QC (Fig.
2, B–E) points to a reduction in mitochondrial membrane potential (DCm; Duchen et al., 1993; Sureau et al.,
1993; Cossarizza et al., 1994; Castedo et al., 1996) and
thereby suggests a reduced capacity of these mitochondria to generate ATP and NADH (Duchen, 2004).
These conclusions are supported by earlier work reporting a lower energy status of the QC compared to
cells in the adjacent PM (Jiang et al., 2003). Because
dividing cells generally must maintain a minimal ATP
content to satisfy the G1-S checkpoint energy requirement (Sweet and Singh, 1995), redox regulation of ATP
production in the mitochondria may be central to the
maintenance of the QC; less ATP/NADH could underlie the decrease in cell division in the QC.
An Oxidized Redox Status Correlates with Lower TCA
Enzyme Activities in the QC
Our data (Table I) showing reductions in the activities
of TCA cycle enzymes in QC mitochondria compared to
mitochondria in more rapidly dividing, adjacent root
meristem cells (PM) support the view that an oxidized
environment can correlate with changes in activities of
mitochondrial proteins (Sweetlove et al., 2002). In Arabidopsis, Sweetlove et al. (2002) have investigated the
impact of oxidative stress on mitochondria and have
shown that, under oxidizing conditions, proteins associated with the TCA cycle were less abundant and that
oxygen consumption was significantly decreased, suggesting less ATP/NADH production. Based on the key
role that PDH plays in providing the entry substrate
(acetyl-CoA) for the TCA cycle, we suggest that the
decrease in PDH activity (none detected in the QC; Table
I) may be central to an overall reduction in TCA cycle
activities in the QC. Exactly how PDH activity might be
reduced is not known. However, the complexity and
multiple subunits of PDH and its specific cofactor requirements make it a possible target in the QC for oxidative inactivation, as has already been demonstrated
Table III. Editing status of ribosomal protein 13 (RSP13) mitochondrial
transcripts in the QC and PM
1, C-to-T change at the editing site; 2, no editing at that position in
the cDNA.
Clone ID
QC-1
QC-2
QC-3
QC-4
QC-5
QC-6
PM-1
PM-2
PM-3
PM-4
PM-5
PM-6
Reported Edited Site
44
65
95
139
295
326
2
1
1
1
1
1
2
2
1
1
1
1
1
1
1
1
1
1
2
2
1
1
1
1
2
1
1
1
1
1
2
2
1
1
1
1
2
1
1
1
1
1
2
2
1
1
1
1
2
1
1
1
1
1
2
2
1
1
1
1
2
2
1
1
1
1
2
2
1
1
1
1
Plant Physiol. Vol. 140, 2006
1121
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Jiang et al.
for PDH in other systems (Cabiscol et al., 2000; Holness
and Sugden, 2003; Garg et al., 2004; Martin et al., 2005).
Moreover, the significant reduction in available pyruvate in the QC (8–10 times less in QC compared to PM)
strengthens our contention that alterations in PDH
activity could account for a diminution in mitochondrial
functioning in the QC. As well, these differences in
enzyme activities between mitochondria in the QC and
PM support the notion that mitochondria can be primary intracellular targets for the initiation of changes in
cell function (Fujie et al., 1993; Smith et al., 2000).
depending on its severity, can lead to different developmental pathways (Arimura et al., 2003) including
apoptosis, this suggests that the QC may avoid the
apoptotic pathway by actively modulating the levels
of oxidative stress, as recently suggested for other
plant tissues (Dutilleul et al., 2003). The specific mechanisms underlying this tolerance are not completely
known but likely involve up-regulation of the antioxidant system at the transcript level (Dutilleul et al.,
2003). And because many of these genes are nuclear
encoded, this implies cross talk between the mitochondria and other organelles. In this way, redox acclimation can extend far beyond the mitochondria.
QC Mitochondria Are Undamaged and Have
Normal Structure
Oxidative stress and a reduction in mitochondrial
membrane potential (DCm) are often associated with
apoptosis (Mancini et al., 1997). However, in the QC,
an oxidizing environment does not lead to cell death.
Rather, the overall cellular ultrastructure of the QC,
including that of the mitochondria, is fairly typical of
that found in a variety of unstressed plant cells (Fig. 1,
B–D). Cristae are present, but small, as has been previously reported for other maize root cells (Clowes
and Juniper, 1964). The intactness of the mitochondria
in the QC contrasts with what is observed in like organelles in tissues undergoing senescence in which there
is a loss of mitochondrial membrane integrity and organization (Pastori and del Rı́o, 1994). Thus, the observation that mitochondria number and ultrastructure in
the QC are normal and unchanged from that in adjacent, dividing cells implies that these redox-sensitive
organelles are not undergoing apoptosis/senescence
in the QC. This also implies that, in the QC, as has been
reported for other plant systems (Millar et al., 2001;
Møller, 2001; Dutilleul et al., 2003), there must be some
mechanism for ameliorating the effects of oxidative stress on these characteristically reactive oxygen
species-sensitive organelles. In this regard, the fact that
reduced glutathione and ascorbate are still present in
the QC (Jiang et al., 2003) suggests a possible mechanism for protecting against severe oxidative stress and
thus may provide insight about why QC mitochondria
are apparently undamaged and do not undergo apoptosis, namely, that reduced forms of redox regulators
(e.g. glutathione, ascorbate) are never absent or are
maintained in a ratio with their oxidized forms so as to
preclude apoptosis. Thus, because oxidative stress,
Expression of Nuclear-Encoded Mitochondrial
Transcripts Is Down-Regulated in the QC
The levels of nuclear-encoded transcripts for TCA
cycle-related proteins (PDH, SDH, and ME) are reduced in the oxidized microenvironment of the QC
(Table II), paralleling the reduction in measurable activity in the QC of the respective proteins (Table I). This
suggests that a reduction in levels of nuclear-encoded
mitochondrial transcripts could underlie the changed
physiology of mitochondria in the QC, including a reduction in mitochondrial membrane potential (DCm).
Giegé et al. (2005) advanced similar ideas to account
for the decrease in mitochondrial biogenesis and function in Suc-starved Arabidopsis cell cultures. In this
system, nutrient deprivation resulted in a decrease in
transcripts for nuclear-encoded mitochondrial proteins, leading to the suggestion that the availability
of nuclear-encoded subunits could be a limiting factor
in mitochondrial function. Of particular relevance in
that work is the down-regulation of genes for pyruvate
metabolism, including PDH and ME, leading Giegé
et al. (2005) to suggest that, in Suc-starved cells, ‘‘the
abundance of nuclear transcripts could become the
limiting factor in the synthesis and assembly of functional mitochondrial complexes’’ (p. 1507). Although
we have no evidence that reduced mitochondrial
transcript abundance leads to impairment in mitochondrial function in the QC, we, however, can conclude that a reduction in mitochondrial transcript
levels does not result in any changes to organelle
structure, which is different from what happens
to mitochondria in Suc-stressed cells (Giegé et al.,
2005).
Table IV. Oligonucleotides used for quantitative reverse transcription-PCR
Gene Name
Iron sulfur subunit of
SDH precursor
NAD-dependent ME,
mitochondrial
precursor
PDH E1 a-subunit
AUX1
GenBank No.
Forward Primer
Reverse Primer
AJ012374
cgctgccccacatgttcgtcgtca
ggtggagcagcaggcgcagaggat
AW037138
ttctgtctggtgctcgggttatctctg
atcctctgctactgcctccctcacaac
AF069911
AJ011794
cacttaccgcaccagggatgagat
gaggttcgccggagggtggacag
atgctgccaacctacggaagagaa
ccggcggggcagcagtgagat
1122
Plant Physiol. Vol. 140, 2006
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Mitochondria and Maize Root Quiescent Center Establishment
Mitochondrial Transcripts in the QC Are
Edited Normally
RNA editing of mitochondrial transcripts is required to produce a functional gene product (Lupold
et al., 1999; Giegé et al., 2000; Nakajima and Mulligan,
2001). Thus because aberrant, incompletely edited transcripts can disrupt the function of the organelle gene
expression system and compromise the metabolic
processes of mitochondria, we investigated the status
of RNA editing in QC mitochondria. From examining several already well-characterized maize mitochondrial transcripts (Grosskopf and Mulligan, 1996;
Williams et al., 1998), we conclude that any differences
between mitochondria in the QC and PM are not due
to differences in editing, which is the same in both
tissues. This again supports our view that mitochondria in the QC are undamaged and are not undergoing
apoptosis. Moreover, the similarities between our data
for RSP13 of edited versus not edited (66% versus 33%)
agree well with that reported earlier by Williams et al.
(1998) for maize, and thus again emphasize the point
that mitochondria in the QC are not altered in their
processing of mRNA.
Reduced Mitochondrial Activity May Be Related to the
Stem Cell Nature of the QC
Because of their apparent ability for unlimited proliferation, self maintenance, and self renewal, a number of workers conclude that QC cells should be viewed
as stem cells (Barlow, 1997; Ivanov, 2004; Jiang and
Feldman, 2005). Here we raise the possibility that at
least some of this stemness may be related to reduced
mitochondrial activity. Reports that intracellular redox
state can influence the balance between self renewal
and differentiation in a variety of stem cell/precursor
cell populations (Smith et al., 2000; Noda et al., 2001;
Barros et al., 2004) imply a role for mitochondria in
determining the state of cell differentiation. Using the
dye rhodamine 123, which is reflective of mitochondrial
activity, Smith et al. (2000) showed a lesser extent of
mitochondrial labeling in hematopoietic stem cells
and in hepatic precursor cells. These workers thus suggested that ‘‘redox modulation functions in multiple
processes related to self renewal and differentiation’’
(Smith et al., 2000; p. 10037). As well, work showing that
mild mitochondrial uncoupling is able to increase both
the chronological and replicative life span of cells
(Barros et al., 2004) supports the contention that redox affects the state/level of cell differentiation via a
mechanism involving mitochondria. It is intriguing to
speculate here that the stem cell nature of QC cells could
also be related to their reduced mitochondrial activity.
CONCLUSION
Previously we provided evidence that auxin imposes an oxidative stress on the root tip and we
hypothesized that the formation of a QC is an inevitable developmental outcome of this oxidized microenvironment (Jiang et al., 2003; Jiang and Feldman,
2005). Here we elaborate on that scenario and suggest
that altered mitochondrial membrane potential and
changed TCA cycle biochemistry reflect responses of
mitochondria to oxidative stress and result in the establishment of a redox homeostasis that underlies the formation and maintenance of the QC.
MATERIALS AND METHODS
Plant Growth Conditions and Tissue Collection
Maize caryopses (Zea mays var. Merit; Asgrow Seed) were imbibed and
germinated in the dark at 25°C for 2 to 3 d. For experiments to measure TCA
cycle enzymes and cycle intermediates, QCs, and the adjacent zone of rapidly
dividing cells, the PM, were collected separately (as described in Feldman and
Torrey, 1976) and assayed as described below. In this cultivar, the QC is
separable from the PM as a consequence of a weak, thin-walled junction.
Extraction and Assay of Pyruvate and TCA Enzymes
The activities of five TCA cycle-associated enzymes were measured: KDH
(Nulton-Persson and Szweda, 2001), PDH (Randall, 1982), NAD1 ME (Geer
et al., 1980), MDH (Nunes-Nesi et al., 2005), and SDH (Strain et al., 1998). For
each assay, 60 to 70 QCs (approximately 0.42 mg) and 20 PMs (approximately
11 mg) were homogenized in 70 or 150 mL, respectively, of the appropriate
extraction buffer. The final volume for each assay was 75 to 150 mL. For all
assays, more or less equal amounts of total protein were used and the activities
expressed on a basis of 100 mg total protein. All assays were replicated at least
three times and the results expressed as a mean 6 SD. For analysis limited
to two groups (QC and PM), Student’s t test was employed (P , 0.05).
Spectrophotometric measurements were made on a Shimadzu UV160U spectrophotometer using Eppendorf Uvette microcuvettes. The total amount of
pyruvate was determined as described by Millenaar et al. (1998).
Assaying Oxidative Activity (Oxidative Stress)
in Living Tissues
Assaying oxidative activity in living cells was assessed using a dye that is
colorless when chemically reduced (when freshly obtained) but, when oxidized, fluoresces in UV light (340-nm irradiation; 530-nm emission). For this
work, we used carboxy-H2DCFDA (C-400) dye (Molecular Probes; catalog no.
C–6827) as previously described (Jiang et al., 2003).
Assaying Mitochondrial Membrane Potential
(Mitochondrial Activity)
To ascertain the functional status of mitochondria in the QC, we used two
mitochondria-selective dyes, JC-9 (3,3#-dimethyl-b-naphthoxazolium iodide;
Invitrogen; catalog no. D22421) and MitoTracker Orange (Invitrogen; catalog
no. M7510). Uptake of these dyes occurs in functioning mitochondria and is
dependent on the establishment and maintenance of mitochondrial membrane potential (DCm; Duchen et al., 1993; Sureau et al., 1993; Cossarizza et al.,
1994; Castedo et al., 1996). Because of the cell wall, entry of these dyes into the
plant protoplasts is usually retarded. Thus, to increase dye uptake, QCs were
first excised and placed on a glass slide in a drop of solution containing
protoplasting enzymes (3% cellulase, 1%–3% pectinase; Onazuka) in 10 mM
potassium-phosphate buffer, pH 5.7. Treatments were brief, usually 15 to
30 min. Following this limited enzyme exposure, the QCs were washed several times with plain buffer and then incubated for 2 h in 0.012 mM JC-9 dissolved in 10 mM potassium-phosphate buffer, pH 5.7, or for 1 to 2 h in 0.1 to
0.25 nM Mitotracker Orange dissolved in 10 mM potassium-phosphate buffer,
pH 5.7. Following incubation with the dyes, the QCs were washed several
times in plain buffer and then observed under UV light using a Leica DM
microscope.
Plant Physiol. Vol. 140, 2006
1123
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Jiang et al.
Electron Microscopy
All solutions were made with 0.05 M sodium cacodylate buffer, pH 7.2. Just
before fixation, root caps were excised from the root tips so as to permit more
rapid entrance of the fixative into the QC. Immediately after decapping, root
tips (1 mm) were fixed at room temperature for 6 h in 6% glutaraldehyde,
rinsed three times for 15 min in buffer, followed by postfixation and staining
with 1% osmium tetroxide for 1 to 2 h. Following three 5-min rinses with
buffer and distilled water (three 10-min rinses), the tissues were dehydrated
through a graded ethanol series. After dehydration, the tissues were embedded in Spurr’s resin. Approximately 60-nm-thick longitudinal sections were
cut using a RMC MT6000 microtome placed on slot grids and stained for
10 min in 2% uranyl acetate followed by a 5-min staining in either Reynold’s
lead citrate or Sato’s lead. The stained sections were viewed using a FEI Tecnai
12 120-kV transmission electron microscope. A total of 12 roots tips, representing three separate fixations, were examined ultrastructurally.
RNA Editing
RNA Isolation
an additional control reaction was carried out in which the reverse transcriptase was omitted, thereby allowing for assessment of genomic DNA contamination. The cDNA solutions and the controls were diluted to 40 mL with
DNase-free water before PCR.
Quantitative PCR was performed as previously described (Jiang et al.,
2006). In each experiment, two standard curves, one for the target gene and
one for the Kan 1.2, were prepared from root-tip tissue using a cDNA dilution
series (1 3 , 0.5 3 , 0.3 3 , 0.25 3 , and 0.15 3 ). All samples were assayed in
triplicate. For each standard curve, the linearity (Pearson correlation coefficient) was higher than 0.900. Target cDNAs were normalized to Kan 1.2.
Differences in transcript levels between the QC and PM are expressed as a
ratio (QC:PM; Table II). The results are presented as the means of two independent PCR experiments. A positive control was run on AUX1 (GenBank
accession no. AJ011794), which is up-regulated in the QC (Hochholdinger
et al., 2000), and a negative control was run on GAPC4, which is downregulated in the QC, as determined by virtual northern blots (data not shown).
Virtual northern blots (SMART kit; CLONTECH) were performed as previously described (Jiang et al., 2006). All gene-specific primers are indicated in
Table IV, except for GAPC4 and Kan 1.2, which have both been previously
described by Jiang et al. (2006) and McMaugh and Lyon (2003), respectively.
For each experiment, pooled tissues (approximately 180–200 PMs or 1,400–
1,500 QCs) were homogenized in liquid nitrogen and total RNA extracted
using the RNAwiz kit (Ambion) according to the manufacturer’s protocol.
Sequence data from this article can be found in the GenBank/EMBL data
libraries under accession numbers AF069911, AF079549, AF390542, AJ011794,
AJ012374, and AW037138.
Dnase I-Treated RNA
ACKNOWLEDGMENTS
Total RNA (15–17 mg) was digested in a 100-mL reaction volume with
10 units of RNAse-free DNase I (Gibco BRL) for 1 h at 37°C, followed by two
extractions: the first with 100 mL of phenol:chloroform:isoamyl alcohol
(25:24:1, v/v) and the second with 100 mL of chloroform:isoamyl alcohol
(24:1, v/v). The RNA was then precipitated by adding 10 mL of 3 M NaOAc
plus 275 mL of ethanol (100%), and incubated for 30 min at 280°C followed by
centrifuging for 30 min at 10,000g. The resulting pellet was washed with
200 mL of 80% ethanol and resuspended in 20 mL of diethylpyrocarbonatetreated water. RNA integrity was assessed by examining the rRNA band after
electrophoresis on a 1% agarose gel.
We are grateful for the assistance of the staff of the University of
California, Berkeley, Electron Microscopy Facility, with special thanks to
Reena Zalpuri.
Reverse Transcription-PCR and Sequencing to Determine
the Editing Status of mtRNA
For detecting the editing status of the mtRNA, 1 mg of total RNA from either
PM or QC tissue was reverse transcribed using SuperScript RNase H2 reverse
transcriptase (Invitrogen) with a gene-specific 3# antisense oligonucleotide in a
10-mL reaction volume. For RSP13, we used the oligonucleotide designated
MMM2 (Williams et al., 1998) and for ATP9 we used the oligonucleotide
designated ZmATP9-3# (Grosskopf and Mulligan, 1996) as previously described
(Williams et al., 1998). For each sample, a negative control was carried out in
which the reverse transcriptase was omitted, allowing for assessment of
genomic DNA contamination. Then, the reactions were diluted four times and
1 mL of this product was amplified by PCR using gene-specific primers for
RSP13 (MMM1 and MMM2; Williams et al., 1998) and for ATP9 (ZmATP9-3#
and ZmATP9-5#; Grosskopf and Mulligan, 1996). Amplification was performed
for 25 cycles of 20 s at 94°C, 30 s at 60°C, and 45 s at 72°C. PCR products were
isolated from the gel and cloned in the pGEM vector (Promega), which was
used to transform Escherichia coli. Following transformation, six colonies from
either the QC or PM were randomly selected and the plasmids were isolated
and sequenced.
Measuring the Levels of Selected Nuclear-Encoded
Mitochondrial Transcripts Using Real-Time
Quantitative Reverse Transcription-PCR
Total RNA was quantified spectrophotometrically. As an internal standard
for normalization, we added approximately 150 pg of kanamycin 1.2-kb
control RNA (Kan 1.2; Promega) per 30 mg of total RNA in a total volume of
60 mL to give a final Kan 1.2 concentration of 2.5 pg mL21, as described by
McMaugh and Lyon (2003). The first strand of cDNA was synthesized from
2 mL of the Kan 1.2-spiked total RNA using an oligo dT(18) primer and
SuperScript II RNase H2 reverse transcriptase (Invitrogen). For each sample,
Received September 27, 2005; revised January 15, 2006; accepted January 17,
2006; published January 27, 2006.
LITERATURE CITED
Arimura T, Kojima-Yuasa A, Watanabe S, Suzuki M, Kennedy DO,
Matsui-Yuasa I (2003) Role of intracellular reactive oxygen species and
mitochondrial dysfunction in evening primrose extract-induced apoptosis in Ehrlich ascites tumor cells. Chem Biol Interact 145: 337–347
Barlow PW (1997) Stem cells and founder zones in plants, particularly their
roots. In CS Potten, ed, Stem Cells. Academic Press, London, pp 29–57
Barnouin K, Dubuisson ML, Child ES, Fernandez de Mattos S, Glassford
J, Medema RH, Mann DJ, Lam EW (2002) H2O2 induces a transient
multi-phase cell cycle arrest in mouse fibroblasts through modulating
cyclin D and p21Cip1 expression. J Biol Chem 277: 13761–13770
Barros MH, Bandy B, Tahara EB, Kowaltowski AJ (2004) Higher respiratory activity decreases mitochondrial reactive oxygen release and increases life span in Saccharomyces cerevisiae. J Biol Chem 279: 49883–49888
Beyer RE, Segura-Aguilar J, Di Bernardo S, Cavazzoni M, Romana F,
Fiorentini D, Galli MC, Setti M, Landi L, Lenaz G (1996) The role of DTdiaphorase in the maintenance of the reduced antioxidant form of coenzyme
Q in membrane systems. Proc Natl Acad Sci USA 93: 2528–2532
Boonstra J, Post JA (2004) Molecular events associated with reactive oxygen
species and cell cycle progression in mammalian cells. Gene 337: 1–13
Brady NR, Elmore SP, van Beek JJHGM, Krab K, Courtoy PJ, Hue L,
Westerhoff HV (2004) Coordinated behavior of mitochondria in both
space and time: a reactive oxygen species-activated wave of mitochondrial depolarization. Biophys J 87: 2022–2034
Cabiscol E, Piulats E, Echave P, Herrero E, Ros J (2000) Oxidative stress
promotes specific protein damage in Saccharomyces cerevisiae. J Biol
Chem 35: 27393–27398
Castedo M, Hirsch T, Susin SA, Zamzami N, Marchetti P, Macho A,
Kroemer G (1996) Sequential acquisition of mitochondrial and plasma
membrane alterations during early lymphocyte apoptosis. J Immunol
157: 512–521
Clowes FAL (1961) Apical Meristems. Blackwell Scientific Publications,
Oxford
Clowes FAL, Juniper BE (1964) The fine structure of the quiescent centre
and neighbouring tissues in root meristems. J Exp Bot 15: 622–630
1124
Plant Physiol. Vol. 140, 2006
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Mitochondria and Maize Root Quiescent Center Establishment
Collins TJ, Lipp P, Berridge MJ, Li W, Bootman MD (2000) Inositol 1,4,5trisphosphate-induced Ca21 release is inhibited by mitochondrial depolarization. Biochem J 347: 593–600
Cossarizza A, Kalashnikova G, Grassilli E, Chiappelli F, Salvioli S, Capri
M, Barbieri D, Troiano L, Monti D, Franceschi C (1994) Mitochondrial
modifications during rat thymocyte apoptosis: a study at the single cell
level. Exp Cell Res 214: 323–330
Duchen MR (2004) Roles of mitochondria in health and disease. Diabetes
53: S96–S102
Duchen MR, McGuinness O, Brown LA, Crompton M (1993) On the
involvement of a cyclosporin A sensitive mitochondrial pore in myocardial reperfusion injury. Cardiovasc Res 27: 1790–1794
Dutilleul C, Garmier M, Noctor G, Mathieu C, Chétrit P, Foyer CH, de
Paepe R (2003) Leaf mitochondria modulate whole cell redox homeostasis, set antioxidant capacity, and determine stress resistance through
altered signaling and diurnal regulation. Plant Cell 15: 1212–1226
Feldman LJ, Torrey JG (1976) The isolation and culture in vitro of the
quiescent center of Zea mays. Am J Bot 63: 345–355
Fujie M, Kuroiwa H, Suzuki T, Kwano S, Kuroiwa T (1993) Organelle
DNA synthesis in the quiescent centre of Arabidopsis thaliana (Col.).
J Exp Bot 44: 689–693
Gagliardi D, Gualberto JM (2004) Gene expression in higher plant mitochondria. In DA Fay, AH Millar, J Whelan, eds, Plant Mitochondria:
From Genome to Function. Kluwer Academic Publishers, Dordrecht,
The Netherlands, pp 55–82
Garg N, Gerstner A, Bhatia V, DeFord J, Papaconstantinou J (2004) Gene
expression analysis in mitochondria from chagasic mice: alterations in
specific metabolic pathways. Biochem J 381: 743–752
Geer BW, Krochko D, Oliver MJ, Walker VK, Williamson JH (1980) A
comparative study of the NADP-malic enzymes from Drosophila and
chick liver. Comp Biochem Physiol 65: 25–34
Giegé P, Hoffmann M, Binder S, Brennicke A (2000) RNA degradation
buffers asymmetries of transcription in Arabidopsis mitochondria.
EMBO Rep 1: 164–170
Giegé P, Sweetlove LJ, Cognat V, Leaver CJ (2005) Coordination of nuclear
and mitochondrial genome expression during mitochondrial biogenesis
in Arabidopsis. Plant Cell 17: 1497–1512
Grosskopf D, Mulligan RM (1996) Developmental- and tissue-specificity
of RNA editing in mitochondria of suspension-cultured maize cells and
seedlings. Curr Genet 29: 556–563
Hochholdinger F, Wulff D, Reuter K, Park WJ, Feix G (2000) Tissue
specific expression of AUX1 in maize roots. J Plant Physiol 157: 315–319
Holness MJ, Sugden MC (2003) Regulation of pyruvate dehydrogenase
complex activity by reversible phosphorylation. Biochem Soc Trans 31:
1143–1151
Hutter DE, Till BG, Greene JJ (1997) Redox state changes in densitydependent regulation of proliferation. Exp Cell Res 232: 435–438
Ivanov VB (2004) Meristem as a self-renewal system: maintenance and
cessation of cell proliferation (a review). Russ J Plant Physiol 51: 834–847
Jiang K, Feldman LJ (2003) Root meristem establishment and maintenance:
the role of auxin. J Plant Growth Regul 21: 432–440
Jiang K, Feldman LJ (2005) Regulation of root apical meristem development. Annu Rev Cell Dev Biol 21: 485–509
Jiang K, Meng YL, Feldman LJ (2003) Quiescent center formation in maize
roots is associated with an auxin-regulated oxidizing environment.
Development 130: 1429–1438
Jiang K, Zhang S, Lee S, Tsai G, Kim K, Huang H, Zhu T, Feldman LJ
(2006) Transcription profile analyses identify genes and pathways
central to root cap functions in maize. Plant Mol Biol 60: 343–363
Jiménez A, Hernández JA, Pastori G, del Rı́o LA, Sevilla F (1998) Role of
the ascorbate-glutathione cycle of mitochondria and peroxisomes in the
senescence of pea leaves. Plant Physiol 118: 1327–1335
Lupold SD, Caoile AGFS, Stern DB (1999) Polyadenylation occurs at
multiple sites in maize mitochondrial cox2 mRNA and is independent of
editing status. Plant Cell 11: 1565–1578
Mancini M, Anderson BO, Caldwell E, Sedghinasab M, Paty PB,
Hockenbery DM (1997) Mitochondrial proliferation and paradoxical
membrane depolarization during terminal differentiation and apoptosis
in a human colon carcinoma cell line. J Cell Biol 138: 449–469
Martin E, Rosenthal RE, Fiskum G (2005) Pyruvate dehydrogenase complex: metabolic link to ischemic brain injury and target of oxidative
stress. J Neurosci Res 79: 240–247
McMaugh SJ, Lyon BR (2003) Real-time quantitative RT-PCR assay of gene
expression in plant roots during fungal pathogenesis. Biotechniques 34:
982–986
Millar H, Considine MG, Day DA, Whelan J (2001) Unraveling the role of
mitochondria during oxidative stress in plants. IUBMB Life 51: 201–205
Millenaar FF, Benschop JJ, Wagner AM, Lambers H (1998) The role of the
alternative oxidase in stabilizing the in vivo reduction state in the
ubiquinone pool and the activation state of the alternative oxidase. Plant
Physiol 118: 599–607
Møller IM (2001) Plant mitochondria and oxidative stress: electron transport, NADPH turnover, and metabolism of reactive oxygen species.
Annu Rev Plant Physiol Plant Mol Biol 52: 561–591
Nakajima Y, Mulligan MR (2001) Heat stress results in incomplete C-to-U
editing of maize chloroplast mRNAs and correlates with changes in
chloroplast transcription rate. Curr Genet 40: 209–213
Noda T, Iwakiri R, Fujimoto K, Aw TY (2001) Induction of mild intracellular redox imbalance inhibits proliferation of CaCo-2 cells. FASEB J 15:
2131–2139
Nulton-Persson AC, Szweda LI (2001) Modulation of mitochondrial function by hydrogen peroxide. J Biol Chem 276: 23357–23361
Nunes-Nesi A, Carrari F, Lytovchenko A, Smith AMO, Loureiro ME,
Ratcliffe RG, Sweetlove LJ, Fernie AR (2005) Enhanced photosynthetic
performance and growth as a consequence of decreasing mitochondrial
malate dehydrogenase activity in transgenic tomato plants. Plant
Physiol 137: 611–622
Pastori GM, del Rı́o LA (1994) An activated oxygen-mediated role for
peroxisomes in the mechanism of senescence of Pisum sativum L. leaves.
Planta 193: 385–391
Randall DR (1982) Pyruvate dehydrogenase complex from broccoli and
cauliflower. In WA Wood, ed, Carbohydrate Metabolism: Methods in
Enzymology, Part D, Vol 89. Academic Press, New York, pp 408–414
Reichheld J-P, Vernoux T, Lardon F, Van Montagu M, Inzé D (1999)
Specific checkpoints regulate plant cell cycle progression in response to
oxidative stress. Plant J 17: 647–656
Smith J, Ladi E, Mayer-Pröschel M, Noble M (2000) Redox state is a central
modulator of the balance between self-renewal and differentiation in a
dividing glial precursor cell. Proc Natl Acad Sci USA 97: 10032–10037
Strain J, Lorenz CR, Bode J, Garland S, Smolen GA, Ta DT, Vickery LE,
Culotta VC (1998) Suppressors of superoxide dismutase (SOD1) deficiency in Saccharomyces cerevisiae. J Biol Chem 273: 31138–31144
Sureau F, Moreau F, Millot JM, Manfait M, Allard B, Aubard J, Schwaller
MA (1993) Microspectrofluorometry of the protonation state of ellipticine, an antitumor alkaloid, in single cells. Biophys J 65: 1767–1774
Sweet S, Singh G (1995) Accumulation of human promyelocytic leukemic
(HL-60) cells at two energetic cell cycle checkpoints. Cancer Res 55:
5164–5167
Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver
CJ, Millar AH (2002) The impact of oxidative stress on Arabidopsis
mitochondria. Plant J 32: 891–904
Valls V, Castelluccio C, Fato R, Genova ML, Bovina C, Saez G, Marchetti
MG, Parenti Castelli G, Lenaz G (1994) Protective effect of exogenous
coenzyme q against damage by adriamycin in perfused rat liver.
Biochem Mol Biol Int 33: 633–642
Waterhouse NJ, Goldstein JC, von Ahsen O, Schuler M, Newmeyer DD,
Green DR (2001) Cytochrome c maintains mitochondrial transmembrane
potential and ATP generation after outer mitochondrial membrane permeabilization during the apoptotic process. J Cell Biol 153: 319–328
Williams MA, Tallakson WA, Phreaner CG, Mulligan RM (1998) Editing
and translation of ribosomal protein S13 transcripts: unedited translation
products are not detectable in maize mitochondria. Curr Genet 34: 221–226
Yoon Y-S, Lee J-H, Hwang S-C, Choi KS, Yoon G (2005) TGF beta1 induces
prolonged mitochondrial ROS generation through decreased complex
IV activity with senescent arrest in Mv1Lu cells. Oncogene 24: 1895–1903
Plant Physiol. Vol. 140, 2006
1125
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.