* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download ...the story of making proteins continued… After transcription occurs
Butyric acid wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
RNA silencing wikipedia , lookup
Citric acid cycle wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Protein adsorption wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Molecular evolution wikipedia , lookup
Polyadenylation wikipedia , lookup
Protein (nutrient) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
List of types of proteins wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Proteolysis wikipedia , lookup
Peptide synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Point mutation wikipedia , lookup
Protein structure prediction wikipedia , lookup
Bottromycin wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Biochemistry wikipedia , lookup
...the story of making proteins continued… After transcription occurs in the ___________________, the ______________ that has been made moves to the cytoplasm of the cell and finds a ___________________________ home. Remember, this mRNA is our dictionary to help us translate the coded message! We need to read the mRNA in 3’s. These 3letter chunks are called ___________________________. Each codon represents a specific _________________________________. Remember, amino acids make up ________________________! We are going to take this nucleotide message (mRNA) and use the coded dictionary to translate it into amino acid language (PROTEIN). This is called _______________________________. Once the mRNA enters the ribosome, the first codon the ribosome recognizes is called the __________________________. This is an ____________ which codes for the amino acid called ___________________________. The mRNA yells out to the cell “where is my methionine?” Amino acids are just floating around inside the cell, so they need to be carried or ______________________ to the ribosome. The molecule that transports or transfers the amino acid is called _________________ (it even looks like a “ T ”). The tRNA carrying an amino acid comes to the ribosome and must bind to the mRNA. In order to stick together, the sequences need to be _______________________. If the start codon is AUG on the mRNA, the tRNA must have ___________. This is called the ___________________ it’s the opposite of the codon on the mRNA. The ribosome has three “sites” (like the 3 chairs at the front of the room). The first tRNA carrying methionine sits inside the first site. The next codon shouts out to the cell and says, “where is my matching tRNA?” The first tRNA shifts down a seat and the next tRNA comes in to the ribosome home carrying its ________________________. The two amino acids inside the ribosome are then joined together this is called a ________________________________. Both tRNA’s shift down a seat and the next tRNA comes into the ribosome with it’s matching anticodon and amino acid. This third amino acid gets bonded to the other two a chain is starting to form! This keeps continuing until we hit a _______________ codon. This ends the process and the mRNA gets released. What we have left is a chain of amino acids = _______________________! This protein says “El perro comio su sombrero” we have used our dictionary to translate the message “The dog ate her hat” from English into Spanish! From nucleotide language into amino acid language! This is the same __________________, just a different ____________________! Codon Chart: LET’S PRACTICE: 1.) What is the anticodon of CCA? = ___________, GUA? = ____________, ACG? = ________ 2.) If the mRNA strand reads: AUGCGACUGGAUUAG, what is the amino acid sequence? 3.) If the mRNA strand reads: AUGGGAUCCGUAUAACGUUGU, what is the amino acid sequence? 4.) Label this picture below: 5.) Write your own definition of translation below: **KEY THINGS TO KNOW ABOUT TRANSLATION** Happens inside the home of the ribosome tRNA has anticodon to mRNA Each tRNA carries a specific amino acid Amino acids joined together through peptide bonds to make protein Review of how we get proteins from DNA Starts with: __________________________ ______________________________ Needs: _____________________________ ______________________________ _____________________________ ______________________________ _____________________________ ______________________________ Ends with: __________________________ ______________________________ 1.) Below represents the beginning and end products of what process that occurs in the nucleus of a cell? GTTCCGATCCAAGGCTAG → GUUCCGAUC A. recombination B. replication C. transcription D. translation 2.) A laboratory technique called polymerase chain reaction (PCR) produces millions of copies of a DNA molecule in only a few hours. PCR is most similar to which of the following cellular processes? A. mitosis B. replication C. transcription D. translation 3.) An RNA sequence is: AUGCCGAAACGU Which of the following statements describes how the RNA sequence specifies the production of an amino acid chain? A. Each individual RNA base codes for a single amino acid. B. Each group of three RNA bases codes for a single amino acid. C. Each group of three RNA bases codes for an enzyme that helps join amino acids together. D. Each individual RNA base codes for the ribosome location where amino acids are assembled. 4.) A sequence of three nitrogenous bases in a messengerRNA molecule is know as a: A. codon B. gene C. polypeptide D. nucleotide 5.) In the synthesis of proteins, what is the function of messengerRNA? A. They act as a template for the synthesis of DNA. B. They carry information that determines the sequence of amino acids. C. They remove amino acids from the nucleus