Download ...the story of making proteins continued… After transcription occurs

...the story of making proteins continued…
After transcription occurs in the ___________________, the ______________ that has been
made moves to the cytoplasm of the cell and finds a ___________________________ home.
Remember, this mRNA is our dictionary to help us translate the coded message! We need to
read the mRNA in 3’s. These 3­letter chunks are called ___________________________. Each
codon represents a specific _________________________________. Remember, amino acids
make up ________________________! We are going to take this nucleotide message (mRNA)
and use the coded dictionary to translate it into amino acid language (PROTEIN). This is called
_______________________________.
Once the mRNA enters the ribosome, the first codon the ribosome recognizes is called the
__________________________. This is an ____________ which codes for the amino acid
called ___________________________. The mRNA yells out to the cell ­ “where is my
methionine?” Amino acids are just floating around inside the cell, so they need to be carried or
______________________ to the ribosome. The molecule that transports or transfers the amino
acid is called _________________ (it even looks like a “ T ”). The tRNA carrying an amino acid
comes to the ribosome and must bind to the mRNA. In order to stick together, the sequences
need to be _______________________. If the start codon is AUG on the mRNA, the tRNA must
have ___________. This is called the ___________________ ­ it’s the opposite of the codon on
the mRNA.
The ribosome has three “sites” (like the 3 chairs at the front of the room). The first tRNA carrying
methionine sits inside the first site. The next codon shouts out to the cell and says, “where is my
matching tRNA?” The first tRNA shifts down a seat and the next tRNA comes in to the ribosome
home carrying its ________________________. The two amino acids inside the ribosome are
then joined together ­ this is called a ________________________________. Both tRNA’s shift
down a seat and the next tRNA comes into the ribosome with it’s matching anticodon and amino
acid. This third amino acid gets bonded to the other two ­ a chain is starting to form! This keeps
continuing until we hit a _______________ codon. This ends the process and the mRNA gets
released. What we have left is a chain of amino acids = _______________________! This
protein says “El perro comio su sombrero” ­ we have used our dictionary to translate the
message “The dog ate her hat” from English into Spanish! From nucleotide language into amino
acid language! This is the same __________________, just a different ____________________!
Codon Chart:
LET’S PRACTICE:
1.) What is the anticodon of CCA? = ___________, GUA? = ____________, ACG? = ________
2.) If the mRNA strand reads: AUGCGACUGGAUUAG, what is the amino acid sequence?
3.) If the mRNA strand reads: AUGGGAUCCGUAUAACGUUGU, what is the amino acid
sequence?
4.) Label this picture below:
5.) Write your own definition of translation below:
**KEY THINGS TO KNOW ABOUT TRANSLATION**
Happens inside the home of the ribosome
tRNA has anticodon to mRNA
Each tRNA carries a specific amino acid
Amino acids joined together through peptide bonds to make protein
Review of how we get proteins from DNA
Starts with: __________________________
______________________________
Needs: _____________________________
______________________________
_____________________________
______________________________
_____________________________
______________________________
Ends with: __________________________
______________________________
1.) Below represents the beginning and end products of what process that occurs in the nucleus
of a cell? GTTCCGATCCAAGGCTAG → GUUCCGAUC
A. recombination
B. replication C. transcription
D. translation
2.) A laboratory technique called polymerase chain reaction (PCR) produces millions of copies
of a DNA molecule in only a few hours. PCR is most similar to which of the following cellular
processes?
A. mitosis
B. replication
C. transcription
D. translation
3.) An RNA sequence is: AUGCCGAAACGU ­ Which of the following statements describes
how the RNA sequence specifies the production of an amino acid chain?
A. Each individual RNA base codes for a single amino acid.
B. Each group of three RNA bases codes for a single amino acid.
C. Each group of three RNA bases codes for an enzyme that helps join amino acids
together.
D. Each individual RNA base codes for the ribosome location where amino acids are
assembled.
4.) A sequence of three nitrogenous bases in a messenger­RNA molecule is know as a:
A. codon
B. gene
C. polypeptide
D. nucleotide
5.) In the synthesis of proteins, what is the function of messenger­RNA?
A. They act as a template for the synthesis of DNA.
B. They carry information that determines the sequence of amino acids.
C. They remove amino acids from the nucleus