* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download AP Biology
RNA interference wikipedia , lookup
Molecular cloning wikipedia , lookup
Gene regulatory network wikipedia , lookup
List of types of proteins wikipedia , lookup
Community fingerprinting wikipedia , lookup
RNA silencing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Biochemistry wikipedia , lookup
Polyadenylation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Expanded genetic code wikipedia , lookup
Point mutation wikipedia , lookup
Synthetic biology wikipedia , lookup
Molecular evolution wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Genetic code wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding RNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Messenger RNA wikipedia , lookup
Division Ave. High School Ms. Foglia AP Biology From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? n How does DNA code for cells & bodies? u how are cells and bodies made from the instructions in DNA DNA proteins cells bodies AP Biology The “Central Dogma” n Flow of genetic information in a cell u How do we move information from DNA to proteins? DNA replication RNA protein trait DNA gets all the glory, but proteins do all the work! AP Biology 1 Division Ave. High School Ms. Foglia AP Biology Metabolism taught us about genes n Inheritance of metabolic diseases u suggested that genes coded for enzymes u each disease (phenotype) is caused by non-functional gene product Am I just the sum of my proteins? lack of an enzyme Tay sachs n PKU (phenylketonuria) n albinism n n metabolic pathway û A disease disease disease disease B C D E AP Biology enzyme 1 û enzyme 2 û enzyme 3 û enzyme 4 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" AP Biology Beadle & Tatum X rays or ultraviolet light Wild-type Neurospora create mutations asexual spores Minimal medium spores Growth on complete medium positive control Select one of the spores Test on minimal medium to confirm presence of mutation negative control Grow on complete medium Minimal media supplemented only with… experimentals Choline Pyridoxine Riboflavin Minimal Nucleic Arginine control Niacin amino acid p-Amino Inositol acid Folic supplements acid benzoic acid Thiamine AP Biology 2 Division Ave. High School Ms. Foglia AP Biology a a From gene to protein nucleus DNA cytoplasm transcription mRNA a a translation a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 RNA n n ribose sugar N-bases uracil instead of thymine U:A uC : G u u n n single stranded lots of RNAs u DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA 3 Division Ave. High School Ms. Foglia AP Biology Transcription n Making mRNA u transcribed DNA strand = template strand untranscribed DNA strand = coding strand u synthesis of complementary RNA strand u enzyme u n n n same sequence as RNA transcription bubble coding strand RNA polymerase 5¢ C DNA G 3¢ AP Biology ¢® ¢ build RNA 5 3 A G T A T C T A G C A G C T C G T 5¢ A 3¢ G C A U C G U C G T A G C A rewinding mRNA A T T A T RNA polymerase A C T A G C T G A T unwinding 3¢ 5¢ template strand RNA polymerases n 3 RNA polymerase enzymes u RNA polymerase 1 n n only transcribes rRNA genes makes ribosomes u RNA polymerase 2 u RNA polymerase 3 n n u transcribes genes into mRNA only transcribes tRNA genes each has a specific promoter sequence it recognizes AP Biology Which gene is read? n Promoter region binding site before beginning of gene TATA box binding site u binding site for RNA polymerase & transcription factors u u n Enhancer region u binding site far upstream of gene n turns transcription on HIGH AP Biology 4 Division Ave. High School Ms. Foglia AP Biology Transcription Factors n Initiation complex transcription factors bind to promoter region u n n n suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA u AP Biology Matching bases of DNA & RNA n Match RNA bases to DNA bases on one of the DNA strands G A C U A G G U U C A AG C G A U U C A C 5' RNA A U 3' A C C polymerase G T GG T A C A G C T A G T C A T CG T A C CG T AP Biology Eukaryotic genes have junk! n Eukaryotic genes are not continuous u exons = the real gene n u expressed / coding DNA introns come out! introns = the junk n inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology 5 Division Ave. High School Ms. Foglia AP Biology mRNA splicing n Post-transcriptional processing u u u u eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing n edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript AP Biology ~1,000 bases mature mRNA transcript spliced mRNA Discovery of exons/introns Richard Roberts CSHL AP Biology pre-mRNA Philip Sharp MIT 1977 | 1993 adenovirus common cold beta-thalassemia Splicing must be accurate n No room for mistakes! u a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| 6 Division Ave. High School Ms. Foglia AP Biology Whoa! I think we just broke a biological “rule”! RNA splicing enzymes n snRNPs small nuclear RNA exon proteins u u n Spliceosome intron u n exon 5' 3' several snRNPs recognize splice site sequence u snRNPs snRNA spliceosome 5' 3' cut & paste gene lariat No, not smurfs! “snurps” 5' mature mRNA AP Biology exon 5' 3' exon 3' excised intron Alternative splicing n Alternative mRNAs produced from same gene u u when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene! AP Biology More post-transcriptional processing n Need to protect mRNA on its trip from nucleus to cytoplasm u enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5¢ GTP cap n add poly-A tail n n w longer tail, mRNA lasts longer: produces more protein 3' mRNA 5' P G P A P AP Biology 7 Division Ave. High School Ms. Foglia AP Biology a a From gene to protein nucleus DNA cytoplasm transcription mRNA a a translation a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Translation from nucleic acid language to amino acid language AP Biology 2007-2008 How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC 4 ATCG 4 AUCG protein ? Met Arg Val Asn Ala Cys Ala 20 AP Biology How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 8 Division Ave. High School Ms. Foglia AP Biology mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? protein Met Arg Val Asn Ala Cys Ala AP Biology 1960 | 1968 Cracking the code n Nirenberg & Khorana Crick u determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT n Nirenberg (47) & Khorana (17) u u determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids n n created artificial UUUUU… mRNA found that UUU coded for phenylalanine AP Biology Marshall Nirenberg 1960 | 1968 Har Khorana AP Biology 9 Division Ave. High School Ms. Foglia AP Biology The code n Code for ALL life! strongest support for a common origin for all life u n Code is redundant several codons for each amino acid 3rd base “wobble” u u Why is the wobble good? Start codon n u u AUG methionine Stop codons n AP Biology u UGA, UAA, UAG How are the codons matched to amino acids? DNA mRNA 3¢ 5¢ 5¢ 3¢ TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 3¢ tRNA amino acid UAC Met codon 5¢ GCA Arg CAU anti-codon Val AP Biology a a From gene to protein nucleus DNA cytoplasm transcription mRNA a a translation a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology 10 Division Ave. High School Ms. Foglia AP Biology Transfer RNA structure n “Clover leaf” structure u anticodon on “clover leaf” end u amino acid attached on 3¢ end AP Biology Loading tRNA n Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy u u ATP ® AMP bond is unstable so it can release amino acid at ribosome easily n n n Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes n Facilitate coupling of tRNA anticodon to mRNA codon n Structure u u u organelle or enzyme? ribosomal RNA (rRNA) & proteins 2 subunits n n large small E P A AP Biology 11 Division Ave. High School Ms. Foglia AP Biology Ribosomes n n n A site (aminoacyl-tRNA site) u holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) u holds tRNA carrying growing polypeptide chain Met E site (exit site) u empty tRNA leaves ribosome 5' from exit site U A C A U G E AP Biology P 3' A Building a polypeptide n Initiation u n Elongation u n brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination u 3 2 1 end codon Leu Val Met Met Met Met Leu release factor Ser Ala Leu Leu Trp tRNA U AC 5' GC U G A A U mRNA A U 3' E P A 5' UAC GAC A U G C U GA A U 5' 3' U A C GA C A U G C U G AA U 3' 5' U A C G A C AA U AU G C UG 3' A CC U GG U A A 3' AP Biology Protein targeting n Signal peptide u address label Destinations: n n n n n n start of a secretory pathway n secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… AP Biology 12 Division Ave. High School Ms. Foglia AP Biology RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A AP Biology ribosome The Transcriptional unit (gene?) enhancer 1000+b 3' translation start 20-30b TAC RNA TATA polymerase DNA transcriptional unit (gene) UTR promoter translation stop exons UTR introns transcription start transcription stop 5' pre-mRNA AP Biology 5' DNA ACT 3' 5' GTP mature mRNA 3' AAAAAAAA Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008 13 Division Ave. High School Ms. Foglia AP Biology Prokaryote vs. Eukaryote genes n Prokaryotes u DNA in cytoplasm circular chromosome naked DNA u no introns u u n Eukaryotes u u u u DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology Translation in Prokaryotes n Transcription & translation are simultaneous in bacteria DNA is in cytoplasm u no mRNA editing u ribosomes read mRNA as it is being transcribed u AP Biology Translation: prokaryotes vs. eukaryotes n Differences between prokaryotes & eukaryotes u time & physical separation between processes n u takes eukaryote ~1 hour from DNA to protein no RNA processing AP Biology 14