Download Mammals Differences between the Chicken and Antagonist in the

This information is current as
of June 17, 2017.
Identification, Cloning, and Functional
Characterization of the IL-1 Receptor
Antagonist in the Chicken Reveal Important
Differences between the Chicken and
Mammals
Mark S. Gibson, Mark Fife, Steve Bird, Nigel Salmon and
Pete Kaiser
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2012/06/11/jimmunol.110320
4.DC1
This article cites 50 articles, 18 of which you can access for free at:
http://www.jimmunol.org/content/189/2/539.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2012 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2012; 189:539-550; Prepublished online 11 June
2012;
doi: 10.4049/jimmunol.1103204
http://www.jimmunol.org/content/189/2/539
The Journal of Immunology
Identification, Cloning, and Functional Characterization of
the IL-1 Receptor Antagonist in the Chicken Reveal
Important Differences between the Chicken and Mammals
Mark S. Gibson,* Mark Fife,* Steve Bird,† Nigel Salmon,* and Pete Kaiser*,1
T
he IL-1 gene family in humans comprises 11 members
(IL-1F1–F11) that act as either functional agonists or
antagonists of inflammation. Historically, this family of
cytokines has been central to the innate immune response; however, more recent evidence indicates that IL-1 family members can
modulate adaptive immune responses in several lymphocyte subsets (1).
IL-1a and IL-1b are classical proinflammatory cytokines whose
principal function is to prime the innate immune response (2).
Their functional effects are exerted through a common, shared
receptor, IL-1R type I (IL-1RI), which complexes with the IL-1R
accessory protein (IL-1RAcP), an essential signal transducing
*Institute for Animal Health, Compton, Berkshire RG20 7NN, United Kingdom; and
†
Department of Biological Sciences, School of Science and Engineering, University
of Waikato, Hamilton 3240, New Zealand
1
Current address: The Roslin Institute and the Royal (Dick) School of Veterinary
Sciences, University of Edinburgh, Midlothian, United Kingdom.
Received for publication November 11, 2011. Accepted for publication May 4, 2012.
This work was supported by the Biotechnology and Biological Sciences Research
Council (Doctoral Training Account to the Institute for Animal Health and Institute
Strategic Programme Grants to the Institute for Animal Health and the Roslin Institute).
The sequences presented in this article have been submitted to the European Molecular Biology Laboratory Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/)
under accession numbers HE601788–HE601793 and HE608245.
Address correspondence and reprint requests to Dr. Mark S. Gibson, Institute for
Animal Health, High Street, Compton, Newbury, Berkshire RG20 7NN, U.K. E-mail
address: [email protected]
The online version of this article contains supplemental material.
Abbreviations used in this article: BAC, bacterial artificial chromosome; BLAST, basic
local alignment search tool; CDS, coding sequence; Ct, cycle threshold; dpi, days
postinfection; EST, expressed sequence tag; IBDV, infectious bursal disease virus; ic,
intracellular; ic1, the first exon of the icIL-1R antagonist transcript; icIL-1RN, intracellular IL-1R antagonist; IL-1RI, IL-1R type I; IL-1RN, IL-1R antagonist; iNOS,
inducible NO synthase; qRT-PCR, real-time quantitative RT-PCR; s, secretory; s1,
the first exon of the sIL-1R antagonist transcript; sIL-1RN, secretory IL-1R antagonist;
SPF, specific pathogen-free; SV, splice variant; UTR, untranslated region.
Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1103204
component of the functional IL-1R (3). The two ligands have
extremely potent biological activity and therefore their production
at both mRNA and protein levels is precisely controlled. Additionally, a naturally occurring antagonist, IL-1R antagonist (IL1RN), reduces the IL-1 effects by physically occupying IL-1RI.
This prevents signal transduction, and consequently gene transcription, as IL-1RN lacks the specific residues required to engage
IL-1RAcP (4, 5).
In mammals, there are two major structural variants of IL-1RN:
secretory (sIL-1RN) and intracellular (icIL-1RN). The sIL-1RN
variant contains a 25-aa signal sequence that is cleaved to permit
posttranslational modification and secretion of the protein via the
well-characterized secretory pathway (6, 7). As the name suggests,
icIL-1RN is retained within the cell as it lacks a signal sequence.
Three different isoforms of icIL-1RN (8–10) have been described
in mammals. icIL-1RN1 is formed through intricate alternative
splicing of an upstream exon into the 59 end of the sIL-1RN mRNA.
A farther upstream exon is spliced in between exons 1 and 2 of
icIL-1RN1 to form icIL-1RN2. The protein product of this variant
has yet to be identified in vivo. The third intracellular variant, icIL1RN3, is created through use of an alternative translation initiation
site located in exon 2 of the sIL-1RN transcript (11).
Whereas the role of sIL-1RN appears to be limited to blocking
IL-1RI on the cell surface, the icIL-1RN isoforms may function
through any of three possible mechanisms. First, icIL-1RN may
exert intracellular effects in a nonclassical (non-IL-1R–dependent)
manner. For instance, when keratinocytes are cultured in the presence of IL-1a, icIL-1RN1 binds to the third component of the
COP9 signalosome, an important protein kinase involved in signal transduction. This causes inhibition of downstream proinflammatory cytokine production (12). Second, icIL-1RN1 may act
within the nucleus to inhibit the effects of IL-1a. Briefly, either
full-length IL-1a or its N-terminal propiece increased the motility
of ECV304 cells following stable transfection. This effect was significantly attenuated when icIL-1RN was coexpressed with either
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
The human IL-1 family contains 11 genes encoded at three separate loci. Nine, including IL-1R antagonist (IL-1RN), are present at
a single locus on chromosome 2, whereas IL-18 and IL-33 lie on chromosomes 11 and 9, respectively. There are currently only two
known orthologs in the chicken, IL-1b and IL-18, which are encoded on chromosomes 22 and 24, respectively. Two novel chicken
IL-1 family sequences were identified from expressed sequence tag libraries, representing secretory and intracellular (icIL-1RN)
structural variants of the IL-1RN gene, as seen in mammals. Two further putative splice variants (SVs) of both chicken IL-1RN
(chIL-1RN) structural variants were also isolated. Alternative splicing of human icIL-1RN gives three different transcripts; there
are no known SVs for human secretory IL-1RN. The chicken icIL-1RN SVs differ from those found in human icIL-1RN in terms
of the rearrangements involved. In mammals, IL-1RN inhibits IL-1 activity by physically occupying the IL-1 type I receptor. Both
full-length structural variants of chIL-1RN exhibited biological activity similar to their mammalian orthologs in a macrophage
cell line bioassay. The four SVs, however, were not biologically active. The chicken IL-1 family is more fragmented in the genome
than those of mammals, particularly in that the large multigene locus seen in mammals is absent. This suggests differential
evolution of the family since the divergence of birds and mammals from a common ancestor, and makes determination of the full
repertoire of chicken IL-1 family members more challenging. The Journal of Immunology, 2012, 189: 539–550.
540
Materials and Methods
Identification of chicken IL-1 family members
A search of the National Center for Biotechnology Information chicken
genome resources expressed sequence tag (EST) database (http://www.
ncbi.nlm.nih.gov/genome/?term=gallus%20gallus) identified EST sequences
that corresponded to putative chicken IL-1 orthologs. For all members of
the human IL-1 family yet to be identified in the chicken, the full gene
sequence, full amino acid sequence, and the amino acid signature motif
were analyzed with the basic local alignment search tool (BLAST) against
the chicken genome sequence using the Ensembl genome browser. The
chicken IL-1 receptor family was identified by examining conserved synteny
between the human IL-1R cluster on chromosome 2 and the chicken genome
using the Ensembl genome browser.
Two EST sequences corresponding to novel chicken IL-1 family genes
were translated and analyzed by TBLASTN against all eukaryotic animal
genomes in Ensembl to confirm putative identities. Sequences (positive hits)
from species containing orthologous genes were aligned using ClustalX
v1.83 (27).
Following amplification and cloning, two novel chIL-1RN amino acid
sequences were analyzed for the presence of a signal peptide using the
SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP/) (28, 29). Novel
chIL-1RN protein sequences were analyzed for structural similarity to known
protein domains present in the ProDom database (http://prodom.prabi.fr/
prodom/current/html/form.php). The chicken sequences were BLASTP
queried against all families of protein domains. Phylogenetic analysis
was carried out using MEGA v5.0 (30) with bootstrap analysis with 500
bootstrap datasets. The secondary structures of the chIL-1RN proteins
were predicted using PSIPRED v3.0 (http://bioinf.cs.ucl.ac.uk/psipred/).
Cloning and sequencing of cDNA
Chicken icIL-1RN cDNA was amplified from RNA from HD11 cells (31)
stimulated with LPS for 6 h, by one-step RT-PCR using sequence-specific
primers (see Table I) and Ready-to-Go RT-PCR beads (GE Healthcare,
Bucks, U.K.). Thermal cycling conditions were 42˚C for 30 min, 95˚C for
5 min, and 40 cycles of 95˚C for 1 min, 60˚C for 2 min, and 72˚C for 2
min. For secretory sIL-1RN, cDNA was synthesized from the same template using 1 ml (200 U) SuperScript II (Invitrogen, Paisley, U.K.). Amplification of the cDNA encoding the mature peptide was conducted using
sequence-specific primers (see Table I) and 0.625 U GoTaq DNA polymerase (Promega, Southampton, U.K.) in a 25 ml total volume. Thermal
cycling conditions were 95˚C for 5 min, 5 cycles of 95˚C for 30 s, 68˚C for
30 s (decrease by 1˚C/cycle), 72˚C for 2 min, and 30 cycles of 95˚C for
30 s, 63˚C for 30 s, and 72˚C for 2 min. Sequence-verified products were
directionally cloned into the His-tagged expression vector pHLSec (provided by James Birch, Institute for Animal Health; vector details are in
Ref. 32) between AgeI and KpnI restriction sites. All splice variant clones
were directionally subcloned into pCI-neo (Promega) using EcoRI and
MluI restriction sites. The complete amplified cDNA sequences of both
variants and all isoforms were submitted to the European Molecular Biology Laboratory Nucleotide Sequence Database (accession nos. HE601788–
HE601793).
Chicken tissues and cells
Tissues were removed from 6- to 9-wk-old specific pathogen-free (SPF) line
72 chickens, specifically thymus, spleen, bursa of Fabricius, Harderian
gland, caecal tonsil, Meckel’s diverticulum, bone marrow, brain, muscle,
heart, liver, kidney, lung, and skin. Cell populations were either unstimulated, stimulated (splenocytes, 1 mg/ml Con A [Sigma-Aldrich, Gillingham, U.K.]; bursal cells, 500 ng/ml PMA [Sigma-Aldrich]; thymocytes, 25 mg/ml PHA [Sigma-Aldrich], all for 18 h), or separated into
specific subsets (splenocytes). Lymphocyte subsets (CD4+, CD8a+, CD8b+,
TCR1+, TCR2+, TCR3+, Bu-1+, and KUL01+ cells) were isolated from total
splenocytes as previously described (33).
Bone marrow-derived dendritic cells, bone marrow-derived macrophages, and blood-derived monocytes were isolated from 4- to 8-wk-old
SPF line 72 chickens and stimulated with LPS (200 ng/ml) or CD40L (3
mg/ml) for 1, 2, 4, 8, 12, 24, or 48 h as described (33). RNA from
unstimulated and LPS-stimulated (10 mg/ml for 1 h) heterophils was a gift
from Dr. Mike Kogut (U.S. Department of Agriculture, College Station,
TX).
Six-week-old SPF Rhode Island Red chickens were orally challenged
with 2.8 3 108 CFU/ml Salmonella typhimurium strain F98 NalR or
Luria-Bertani medium (control). Birds were killed at 3, 7, 14, 21, and
27 d postinfection (dpi), and whole spleens were removed.
Three-week-old resistant (line 61) and susceptible (Brown Leghorn)
SPF chickens were challenged intranasally with either 101.3 50% egg infectious dose infectious bursal disease virus (IBDV) strain 52/70 (in 0.1 ml
PBS) or PBS. Birds were killed at 2, 3, and 4 dpi, and spleens and bursae
of Fabricius were removed.
Total RNA isolation and real-time quantitative RT-PCR
analysis of chicken IL-1RN expression
RNA from the tissues and cells described above was extracted using an
RNeasy Mini kit (Qiagen, Crawley, U.K.) following the manufacturer’s
instructions. TaqMan real-time quantitative RT-PCR (qRT-PCR) was used
to quantify the mRNA levels of chicken IL-1RN. Primers and probes
specific to different splice variants of chicken IL-1RN (Table I) were
designed using Primer Express (Applied Biosystems, Warrington, U.K.).
Assays were performed using the TaqMan Fast Universal PCR Master Mix
and One-Step RT-PCR Master Mix reagents (Applied Biosystems). Data
are expressed in terms of the cycle threshold (Ct) value, normalized for
each sample using the Ct value of 28S rRNA product for the same sample,
as described previously (34, 35). Final results are shown either as corrected
DCt, using the normalized value, or as fold difference from levels in un-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
(13). Third, icIL-1RN isoforms may be released from cells and
act in a similar way to sIL-1RN by antagonizing membrane-bound
IL-1RI (14–17).
Other, more recently discovered IL-1 family members (IL-1F5–
F11) have been less extensively studied. However, functional roles
for most of these are beginning to emerge. IL-1F5 (recently renamed IL-36Ra) (18) and IL-1F10 (recently renamed IL-38) (18)
suppress inflammation through their common role as receptor antagonists of IL-1RL2 (IL-1Rrp2). This prevents the agonists IL-1F6
(IL-36a), IL-1F8 (IL-36b), and IL-1F9 (IL-36g) from binding this
receptor to initiate gene transcription via NF-kB and MAPKs (1,
19, 20). IL-1F7 (IL-37) has also been comprehensively characterized as an endogenous inhibitor of the innate immune response
(21). The role of IL-1F11 (IL-33) has been described in numerous
disease states, central to which is its ability to generate Th2-type
immune responses (22).
In humans, nine of the IL-1 genes are clustered in a region of
∼370 kb on chromosome 2q13. The two other members, IL-18
and IL-1F11 (IL-33), reside on chromosomes 11 and 9, respectively. The IL-1 cluster is largely conserved across most mammalian species except in the mouse, where IL-1b and IL-1a have
become separated from the rest of the cluster (IL-1RN, IL-1F5–
F10) following chromosomal rearrangement.
The chicken has been extensively studied as a model organism
for immune function. Although our understanding of its immunobiology lags behind mammalian species, significant progress
has been made over the past decade to elucidate its repertoire of
immune function genes (23). In particular, our knowledge of its
different cytokine families has grown rapidly, accelerated by the
availability of the genome sequence (24).
At present, only two members of the chicken IL-1 family have
been cloned and functionally characterized: IL-1b (25) and IL-18
(26). The biological activity of both cytokines resembles that of
their mammalian orthologs. Despite the apparent lack of IL-1
ligands, all members of the mammalian IL-1R family have been
identified in the chicken (our unpublished observations). This suggests that the chicken may contain further, as yet undiscovered,
ligand genes. The current build of the chicken genome sequence
does not provide any evidence of additional IL-1 genes, as the
nine-member IL-1 cluster found on human chromosome 2 is not
present. A limited degree of conserved synteny between these two
species at this locus, however, does exist. The region of the chicken
genome containing IL-1b includes orthologs of the two genes
(SLC20A1 and CKAPL2) that flank the human IL-1 cluster, but
all other IL-1 genes are absent.
In this study we report the discovery and characterization of IL1RN for the first time, to our knowledge, in an avian species.
IDENTIFICATION OF IL-1RN IN THE CHICKEN
The Journal of Immunology
541
Table I. Primers and probes
Target for Amplification
Sequence (59→39)
sIL-1RN F
IL-1RN R
sIL-1RNpHL F
sIL-1RNpHL R
icIL-1RN F
icIL-1RNpHL F
icIL-1RNpHL R
IL-1RN ex5 F
IL-1b/1
IL-1b/2
IL-1RN Int2–3 F
IL-1RN Int2–3 R
IL-1RN Int3–4 F
IL-1RN Iint3–4 R
IL-1RN Int1–2 F
IL-1RN 130bp R
IL-1RN 59RACE R
T3
pHLSec F
pHLSec R
IL-1RN TM F
IL-1RN TM R
IL-1RN probe
IL-1RN TM SV1 F
IL-1RN TM SV1 R
IL-1RN SV1 probe
IL-1RN TM SV2 F
IL-1RN TM SV2 R
IL-1RN SV2 probe
IL-1b F
IL-1b R
IL-1b
iNOS F
iNOS R
iNOS
28S F
28S R
28S
sIL-1RN cDNA
sIL-1RN/icIL-1RN cDNA
Mature sIL-1RN. Includes AgeI site
Includes KpnI site
icIL-1RN cDNA
Includes AgeI site
Includes KpnI site
IL-1RN
IL-1b
IL-1b
IL-1RN intron 2
IL-1RN intron 2
IL-1RN intron 3
IL-1RN intron 3
IL-1RN intron 4
IL-1RN intron 4
IL-1RN
Sequencing
Sequencing
Sequencing
TaqMan F primer
TaqMan R primer
TaqMan probe
TaqMan F primer
TaqMan R primer
TaqMan probe
TaqMan F primer
TaqMan R primer
TaqMan probe
TaqMan F primer
TaqMan R primer
TaqMan probe
TaqMan F primer
TaqMan R primer
TaqMan probe
TaqMan F primer
TaqMan R primer
TaqMan probe
ATGGCGCTCACCATCGCCCT
GCTCAGCACAGCTGGAAGTA
GAGAGAaccggtGTGCCGTGCCGCGCGCCCGC
GAGAGAggtaccGCACAGCTGGAAGTAGAAAT
GGCATCTCATGGGTGAGG
GAGAGAaccggtGGTGAGGCTGCCGGATCGGT
GAGAGAggtaccGCACAGCTGGAAGTAGAAAT
TCACCTTCTTCCGCACCTAT
CTTCACCTTCAGCTTTCACG
GCACGTCCACTGTGGTGTGC
GCTGCAAACCAAAGTCTTCA
GCGACTGCTGGTTCATATCC
AACCAGCAGTCGCTGTACCT
GCAGCTCGTGCTTGAAGAAG
CTCCATTGGGGCATCTCAT
GGGCAGCTCCGTGATGTC
ACAGCCCGTCCTTATAGGTGCGGAAGA
ATTAACCCTCACTAAAGGGA
GCTGGTTGTTGTGCTGTCTCATC
CACCAGCCACCACCTTCTGATAG
CGCTGGAGGAGAAGGTGTTTT
GATGTCGGCGTCCTGGAG
CCCAACCGCTTCTTCAAGCACGA
ACCAAAGTCTTCAAATACCGAGAAGGT
GCGGATGCCCATGATGAC
CGCTTCTTCAAGCACGAG
CCCACAGCCCACCCT
GGAGGTGCAGAGGAACCAT
CCGTCCTGGAGCTGC
GCTCTACATGTCGTGTGTGATGAG
TGTCGATGTCCCGCATGA
CCACACTGCAGCTGGAGGAAGCC
TTGGAAACCAAAGTGTGTAATATCTTG
CCCTGGCCATGCGTACAT
TCCACAGACATACAGATGCCCTTCCTCTTT
GGCGAAGCCAGAGGAAACT
GACGACCGATTTGCACGTC
AGGACCGCTACGGACCTCCACCA
F, Forward; R, reverse.
infected control birds. Bioassay results are expressed as a percentage following conversion from corrected DCt values.
Structural analysis of the IL-1RN gene
For the amplification of introns, chicken IL-1 cDNA sequences were aligned
with orthologous mammalian cDNA sequences (derived from Ensembl), enabling intron locations for the chicken genes to be predicted. Primers were
designed against the known chicken cDNA sequences based on these predictions (Table I). The resulting chicken IL-1RN gene sequence was submitted
to the European Molecular Biology Laboratory Nucleotide Sequence Database
(accession no. HE608245). Putative promoter regions were analyzed using
Softberry (http://linux1.softberry.com/berry.phtml). 59 RACE was carried out
using the SMARTer RACE cDNA amplification kit (Clontech) following the
manufacturer’s instructions. 59 RACE-ready cDNA was prepared from HD11
cells stimulated with LPS for 6 h. 59 RACE PCR used a gene-specific reverse
primer (Table I) and the supplied Universal Primer A Mix forward primer.
Thermal cycling conditions were 5 cycles of 94˚C for 30 s, 72˚C for 3 min,
5 cycles of 94˚C for 30 s, 70˚C for 30 s, 72˚C for 3 min, and 25 cycles of 94˚C
for 30 s, 68˚C for 30 s, and 72˚C for 3 min.
growth medium was changed for 2% serum-containing DMEM and the
DNA-polyethylenimine mixture was added. After 3 d growth at 37˚C, 5%
CO2, culture supernatants were harvested and concentrated in a stirred
ultrafiltration cell using YM10 ultrafiltration membranes (NMWL 10000)
(both from Millipore, Watford, U.K.) followed by a buffer exchange with
PBS. Concentrated sIL-1RN and icIL-1RN proteins were purified under
native conditions using HIS-Select high-flow cartridges (Sigma-Aldrich).
Purified proteins were detected by SDS-PAGE using Mini-PROTEAN
TGX gels (Bio-Rad, Hemel Hempstead, U.K.), followed by Western blotting using a PentaHis monoclonal primary Ab (Qiagen) and a polyclonal
rabbit anti-mouse IgG HRP-conjugated secondary Ab (Dako, Ely, U.K.).
Expression of recombinant protein in COS-7 and
HEK293T cell lines
The different IL-1RN variants and isoforms were expressed in COS-7 cells
(ex-COS) using a well-described DEAE-dextran transfection method (36,
37).
HEK293T cells were routinely cultured in DMEM with 10% FCS at
37˚C, 5% CO2. For transfection, 50 mg endotoxin-free plasmid DNA
(pHLSec-sIL-1RN or pHLSec-icIL-1RN) was added to 5 ml serum-free
medium and mixed. Polyethylenimine (75 ml of 1 mg/ml) was added,
briefly mixed, and then incubated at room temperature for 10 min to permit
DNA–polyethylenimine association. During this incubation, HEK293T
FIGURE 1. Amplification of full-length and splice variants of (A) icIL1RN and (B) sIL-1RN CDS cDNAs. For both, two splice variants were
cloned from the smaller bands (of ∼420 and 450 bp, respectively). Templates for RT-PCR were RNA from Con A-stimulated splenocytes (S) or
LPS-stimulated HD11 cells (M).
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Primer
542
IDENTIFICATION OF IL-1RN IN THE CHICKEN
The signal was detected by ECL (GE Healthcare Life Sciences, Little
Chalfont, U.K.).
Characterization of IL-1RN bioactivity
HD11 cells were cultured for 24 h at 41˚C, 5% CO2, in the presence
of either serial dilutions of recombinant chicken (rch) IL-1b (provided
by Dr. Benjamin Schusser, University of Munich, Munich, Germany) with
or without 30 ml neat anti–IL-1b polyclonal Ab (also provided by
Dr. Schusser) or media only. Activation of the HD11 cells was measured
using a macrophage activation factor assay as previously described (36,
38). This assay measures activation through the induction of inducible NO
synthase (iNOS), which produces nitrite in the culture medium, measured
by a Griess assay. IL-1b and iNOS mRNA levels were quantified from
RNA isolated from the same samples by qRT-PCR.
To determine the antagonistic properties of chIL-1RN, HD11 cells were
cultured with either serial dilutions of rchIL-1RN (ex-COS; supernatant or
cell lysate), purified rsIL-1RN or ricIL-1RN, ex-COS pCI-neo (negative
control), or media alone. After 4 h incubation at 41˚C, 5% CO2, 250 ml 40
ng/ml recombinant chicken IL-1b (synthesized by AMSBio, Abingdon, U.K.)
was added with further incubation for 12 h. Activation of the cells and IL-1b
and iNOS mRNA expression levels were quantified as previously described.
Statistical analysis
Results
Identification and characterization of chicken IL-1RN, its
different variants, and alternatively spliced isoforms
FIGURE 2. (A) Partial nucleotide sequence of chicken IL-1RN, showing
putative transcriptional control elements (underlined and labeled Sp1, NFIL-6, PU.1, and TATA box, respectively), exons (uppercase; exons ic1, s1,
2, 3, and part of 4), and upstream and intronic sequences (lowercase). The
59 UTR of icIL-1RN is in italicized uppercase in exon ic1. Chicken icIL1RN is formed between a splicing event between the end of exon ic1 and
the splice acceptor site indicated by the arrow in the middle of exon s1. In
full-length IL-1RN of either structural variant, intron 2 is usually spliced at
the GT splice donor site at its beginning, whereas intron 3 is typically
spliced at the AG splice acceptor site at the end of this intron. In the SV1
transcripts, these identical splice donor and acceptor sites are also used
(splice sites are marked by arrows). Although these two introns are spliced
at the same nucleotide positions in SV1 transcripts as they are in fulllength IL-1RN, skipping exon 2 changes the reading frame, which introduces a premature stop codon and significantly truncates the predicted SV1
amino acid sequence. Several motifs associated with exon skipping in
mammals are underlined in italics in introns 2 and 3. Intron 4 is usually
spliced at the AG splice acceptor site at the end of the intron. In the SV2
transcripts, it is spliced 72 nucleotides later at an alternative AG (splice site
marked by the arrow within exon 4), making GA the first nucleotides in the
continuing coding sequence. (B) Comparison of the amino acid sequences
of full-length, SV1, and SV2 icIL-1RN. The alternative splicing events that
generate SV1 result in the predicted protein sequence being out of frame
and significantly truncated compared with the full-length sequence. SV2 is
formed through the use of an alternative splice acceptor site within exon 4,
A TBLASTN search of the National Center for Biotechnology
Information EST database identified several chicken ESTs representing putative IL-1 family genes (Supplemental Table I). Two of
these ESTs (accession nos. CK613932 and BX257557) were
combined to create a 554-bp sequence with potential start and stop
codons as well as a polyadenylation signal (AATAAA). The predicted protein sequence contained the IL-1 family signature motif
(consensus: [FC]-x-S-[ASLV]-x(2)-P-x(2)-[FYLIV]-[LI]-[SCA]T-x(7)-[LIVM]) (39) had 33% identity with chIL-1b, but was absent from v2.1 of the chicken genome sequence. Using this predicted sequence, TBLASTN analysis against all other genomes in
Ensembl identified IL-1RN as the best hit in 22 other species (data
not shown).
A reciprocal BLASTP analysis of the National Center for
Biotechnology Information EST database with chIL-1RN identified 10 further ESTs with significant homology (Supplemental
Table I). One of these sequences (CK615408.1) was essentially
identical to the original sequences. Another EST (BU214831.1)
was similar but clearly differed at the 59 end. This 669-bp sequence
also lacked a potential start codon. A TBLASTN search against
the most recently available genome sequence reads (Galgal 3.0;
removed data) provided an additional 59 end sequence containing
a single start codon.
The two predicted chIL-1RN protein sequences did not align
at the 59 end, indicating that different isoforms may exist in the
chicken. They were therefore analyzed for the presence of a signal
peptide using SignalP. The reciprocal BLAST-mined EST (supplemented with 59 end sequence) contained a 17-aa signal peptide
and was designated sIL-1RN. The combined chIL-1RN EST, however, did not contain a signal sequence and was therefore named
icIL-1RN to reflect its likely identity.
located 72 bp from the 59 end of the exon. The predicted protein from SV2
is in frame but shorter by 24 aa.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Statistical analyses were carried out using the Mann–Whitney U test within
the GraphPad Prism software package. Tests compared the rchIL-1b plus
IL-1RN treatment groups to the rchIL-1b only treatment within the HD11
bioassay. For gene expression analyses, tests were performed between
groups of birds of different infection status. Statistical significance was
determined as *p , 0.05 (significant) or **p , 0.01 (highly significant).
The Journal of Immunology
FIGURE 3. Alignment of the amino acid sequences
of chicken sIL-1RN and icIL-1RN with those of human (secretory and intracellular ic1), mouse, cow, and
platypus IL-1RN sequences. Shaded areas represent
conservation of amino acid similarity; the darker the
shading, the greater the conservation. The secondary
structure of IL-1 family proteins contains 12 b-strands.
The specific amino acid residues that comprise these
12 b-strands in humans (5) are indicated by open bars
beneath the sequence. Their locations in the chicken,
predicted by PSIPRED, are indicated by closed bars.
Conserved cysteines are identified by an asterisk above
the alignment and the chicken potential N-glycosylation site by +++ below the alignment.
identity with the respective human and mouse sequences, a predicted
molecular mass of 18.299 kDa, with an identical isoelectric point to
sIL-1RN of 8.68.
The secondary structures of human and mouse IL-1 proteins have
been resolved as b-trefoil folds comprised of 12 b-strands. Using
PSIPRED, the secondary structures of both chIL-1RN variants
were predicted to have the same three-dimensional configuration,
with the 12 b-strands located in almost identical regions to those in
the human IL-1RN amino acid sequence (Fig. 3). These regions are
the most highly conserved between species, reflecting their likely
functional importance. Of the five cysteine residues in the chIL1RN sequences, three of these are conserved in mammals, are
located in b-strands 6 and 10, and two will presumably form a
disulfide bond. A single potential N-glycosylation site (NGT) is
found in chicken, as in mammals, but the site locations are not
conserved.
Both chIL-1RN variants were analyzed for structural similarity
to known protein domains in the ProDom database. Sequences were
most closely related to domains PDA1I6T8 (domain ID, IL-1Ra;
closest domain, rat IL-1Ra [to chicken icIL-1RN] and rabbit IL1Ra [to chicken sIL-1RN]; e values, 2 3 1029 and 4 3 1029
for residues 2–62 and 15–69, with 49 and 52% amino acid identity, respectively) and PD002536 (IL-1; mouse IL-1F10; 2 3 10218;
32–161/42–171, 37%).
Phylogenetic analysis of the chIL-1RN cDNA and protein sequences showed that the gene is most closely grouped with the
mammalian IL-1 receptor antagonist genes (IL-1RN, IL-1F5, and
IL-1F10) (40, 41) (Fig. 4). However, the chIL-1RN variants did
not group separately with their direct mammalian orthologs, but
formed a separate branch, suggesting they share a distant evolutionary relationship.
Genomic location of IL-1RN
The chicken genome sequence (v2.1) places chIL-1b on chromosome 22, in a locus with a limited degree of conserved synteny with the IL-1 family gene cluster on human chromosome
2 (Supplemental Fig. 1). The avian orthologs of two genes
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Several pairs of primers were designed against the sIL-1RN and
icIL-1RN sequences. A full-length 492-bp icIL-1RN coding sequence
(CDS) cDNA was amplified by RT-PCR using RNA from LPSstimulated HD11 cells and splenocytes as template. Gel electrophoresis of the products also revealed an additional smaller band (Fig.
1A). Once both bands had been gel purified, cloned, and sequenced,
the smaller band was unexpectedly found to contain two distinct
splice variants of the full length, termed SV1 and SV2 (Fig. 2).
Upon closer examination of the splice variant sequences, SV1
lacks exon 2 of the full-length IL-1RN gene and although it is
formed through the use of typical splice donor (GT) and acceptor
(AG) sites (Fig. 2A), the predicted protein sequence is out of frame
and significantly truncated compared with the full-length sequence
(Fig. 2B). Analysis of the intron sequences flanking this missing
exon identified several conserved sequence motifs associated with
exon skipping in mammals (45).
The SV2 transcript sequence was formed through use of an
alternative splice acceptor site (AG) within exon 4 located 72 bp
from its 59 end (Fig. 2A). In contrast to SV1, removal of this short
stretch of nucleotides did not introduce a frameshift in the predicted protein sequence.
A 522-bp full-length sIL-1RN CDS cDNA was amplified by
PCR using cDNA generated from LPS-stimulated HD11 RNA as
template (Fig. 1B). As with icIL-1RN, two splice variants of sIL1RN were identified in addition to the full-length clone. The sIL1RN splice variant sequences were identical to those of the icIL1RN variants at all of the splice sites, suggesting that the same
mechanism had led to their formation, and they were subsequently
termed sIL-1RN SV1 and SV2.
Further characterization of both chIL-1RN sequences was carried
out in silico. When aligned with mammalian IL-1RN sequences (Fig.
3), both chIL-1RN variants show relatively high amino acid identity
for avian cytokines with their mammalian orthologs. Chicken sIL1RN is very similar in length to human and mouse sIL-1RN, sharing
38.3 and 37.9% amino acid sequence identity, respectively. Its predicted molecular mass is 19.372 kDa with a theoretical isoelectric
point of 8.68. Chicken icIL-1RN has 38.2 and 40.4% amino acid
543
544
IDENTIFICATION OF IL-1RN IN THE CHICKEN
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. Phylogenetic analysis of chIL1RN amino sequences using MEGA v5.0.
Analysis was performed using the neighborjoining method with bootstrap analysis with
500 bootstrap datasets. ch, Chicken; hu, human; IC, intracellular; lz, lizard; m, mouse; pl,
platypus; SEC, secretory; zf, zebra finch.
(SLC20A1 and CKAP2L) that are located adjacent to the human
cluster flank chicken IL-1b, although no other genes are shared by
the two loci.
A TBLASTN analysis of the chicken genome (v2.1) with both
chIL-1RN sequence variants returned no positive hits. Similar
analysis of the new chicken genome build (v3.0, unassembled) with
chicken icIL-1RN identified two contigs (81757.1 and 113837.1)
containing most of the coding sequence of the gene. These contigs,
however, were mined from “removed data” sequence reads and are
thus unplaced in the assembled genome, so the genomic location
of chicken IL-1RN remains unknown.
Closer examination of the locus containing chIL-1b in chicken
genome build v2.1 revealed four sequence gaps (estimated at 489,
100, 445, and 100 bp, respectively) immediately adjacent to the 59
end of the chIL-1b gene. Further chIL-1 family members could be
encoded in those gaps. The chicken bacterial artificial chromosome (BAC) map shows that BAC clone TAM32-21N6 covers the
entire locus. We attempted to amplify both IL-1b and IL-1RN
from BAC clone TAM32-21N6 (and genomic DNA as a positive
control) by PCR. Both were readily amplifiable from genomic
DNA, but only IL-1b could be amplified from the BAC clone
(data not shown), again suggesting that IL-1RN is encoded at
a different locus in the chicken genome and not in one of the
sequence gaps.
A new, as yet unannotated, assembly (v3.0) of the chicken
genome is available and was searched using 8.2 kb sequence from
chromosome 22 in v2.1, which included IL-1b and the adjacent
sequence gaps. At present, the sequence from this locus in v2.1 is
spread across several contigs in v3.0. It does not, therefore, appear
that the sequence gaps in v2.1 will be closed in v3.0.
The Journal of Immunology
Structural analysis of IL-1RN
FIGURE 5. Exon/intron structure of the IL1RN gene, and the various splice variants
thereof, in humans and chickens. Both genes
contain the first exon (s1) for the sIL-1RN
transcript. Upstream of this is the first exon
(ic1) for the icIL-1RN1 transcript. The ic1
exons are spliced into the middle of exon s1 to
form the intracellular structural variants. The
human gene also contains a further upstream
exon (ic2), which is present in the icIL-1RN2
transcript, located between exons ic1 and s1.
PCR amplification of intron 4 indicated it is
∼750 bp in length; however, the complete
sequence was not determined.
were identified upstream of the icIL-1RN start codon: a PU.1 site
at 241 (relative to the icIL-1RN start codon) in the 59 UTR in the
reverse orientation, an NF-IL-6 site at 269, and an Sp1 site at
288 (both in the forward orientation). Both Sp1 and NF-IL-6
binding sites are present in the human icIL-1RN promoter (42).
With limited sequence available upstream of exon ic1, it is unclear
whether these elements control only expression of sIL-1RN, or
whether those upstream of exon ic1 play a role in controlling expression of icIL-1RN, either uniquely or as well as that of sIL1RN. Further upstream genomic sequence is required for a thorough analysis of the potential promoter(s).
Expression of IL-1RN in tissues and sorted cell subsets
The expression profile of IL-1RN was examined in a broad range
of tissues and cells by qRT-PCR (Fig. 6). Three sets of primers and
probes were designed to quantify expression of full-length IL1RN, SV1, and SV2, but it was not possible to design qRT-PCR
assays that could differentiate between the two structural variants
of chIL-1RN, regardless of the splice variant. Expression of fulllength IL-1RN was ubiquitous, with highest levels in lymphoid
tissues in the bone marrow and blood, and highest levels in nonlymphoid tissues in the brain (Fig. 6A).
Constitutive expression of full-length IL-1RN was detected in
the entire lymphocyte subset cell panel. Of the 20 different populations investigated, KUL01+ cells (macrophages) and bloodderived monocytes (with or without LPS stimulation) showed
the highest expression levels (Fig. 6B). Stimulation of cell subsets
with LPS led to an increase in expression levels only in the
monocyte population. In both bone marrow-derived dendritic cells
and bone marrow-derived macrophages, LPS-stimulation significantly decreased expression of full-length IL-1RN, whereas LPS
stimulation of heterophils had no effect on expression levels.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
A combination of PCR and in silico analyses allowed the genomic
structure of chIL-1RN to be determined. cDNA alignments between the human and chicken orthologs of IL-1RN were used to
predict the locations of introns in the chicken gene and primers
were designed from the flanking sequences to amplify the predicted
introns. Sequencing of the resulting PCR-amplified products from
chicken genomic DNA showed that the gene structure of chIL-1RN
was very similar to its human ortholog. Although readily amplifiable from genomic DNA, the exceptionally high GC content of
intron 4 meant it was not completely sequenced. The coding region
is comprised of five exons, of similar size to the corresponding
human exons. The introns of chIL-1RN, however, are significantly
smaller than their human counterparts, resulting in the overall size
of the chicken gene being around a 10th of the size of the human
ortholog (Fig. 5).
In humans, the first exons of the intracellular and secretory
variants (ic1 and s1, respectively) are separated by 9.6 kb DNA.
Expression of the two variants is controlled by large promoters of
4525 and 1680 bp, respectively (42, 43), which precede ic1 and
s1, respectively (Fig. 5). In the chicken, however, examination of
contig 81757.1 (from genome sequence v3.0, the only genomic
sequence information so far available upstream of exon ic1) shows
the genomic organization at the corresponding region of the chIL1RN gene differs markedly, with only 129 bp separating ic1 and
s1. Attempts to determine the length of the 59 untranslated region
(UTR) of chicken sIL-1RN by 59 RACE were unsuccessful. The
59 UTR of chicken icIL-1RN was determined by 59 RACE to be
50 nt in length, giving a total length of 57 bp for exon ic1 (Fig.
2A). There is a TATA (TATAAA) box 40 nt upstream of the sIL1RN start codon. Three potential transcription factor binding sites
545
546
IDENTIFICATION OF IL-1RN IN THE CHICKEN
Expression of IL-1RN is increased in response to bacterial and
viral challenge
In both a viral (IBDV) and bacterial (S. typhimurium) challenge
model, IL-1RN mRNA expression levels were statistically significantly increased, in bursal cells and splenocytes, respectively, in
infected birds compared with levels in uninfected, age-matched
controls at certain time points after infection (Fig. 7).
At 4 d after IBDV infection, full-length and SV2 IL-1RN mRNA
expression levels were statistically significantly increased 4- and
2.5-fold in bursal cells from chickens of a resistant (61) line.
Differences in IL-1RN SV1 mRNA expression levels in all groups
at all time points were not statistically significant (Fig. 7A).
The expression of full-length, SV1, and SV2 IL-1RN transcripts
was also assessed in splenocytes from outbred Rhode Island Red
birds following infection with S. typhimurium strain F98. Fulllength IL-1RN mRNA expression levels were statistically significantly upregulated 2-fold in comparison with levels in splenocytes from uninfected, age-matched controls, at 3 dpi (Fig. 7B).
By 7 dpi, however, mRNA expression levels in both infected and
control birds were not significantly different and remained so for
the duration of the experiment. IL-1RN SV1 mRNA expression
levels were not statistically significantly different between infected and control birds throughout the experiment.
Full-length rsIL-1RN and icIL-1RN are bioactive but splice
variants of both are not
Recombinant chicken sIL-1RN and icIL-1RN were expressed in
HEK293T cells and purified (data not shown). The ability of purified rchIL-1RN to inhibit the biological activity of chIL-1b was
assessed in an HD11 cell bioassay. The antagonistic activity of
both chIL-1RN variants was determined by their ability to inhibit
the IL-1b–mediated upregulation of IL-1b and iNOS. The ability
of HD11 cells to respond to IL-1b was first tested (Fig. 8A). HD11
cells were either stimulated for 24 h with rchIL-1b with or without
anti–IL-1b Ab or cultured in media only. IL-1b and iNOS mRNA
expression levels were upregulated in rchIL-1b–stimulated cells
compared with levels in unstimulated cells. In cells cultured in the
presence of rchIL-1b and anti–IL-1b Ab, the Ab was able to
neutralize the biological activity of IL-1b at all but the two highest
concentrations, with resulting IL-1b and iNOS mRNA expression
levels being similar to those in unstimulated cells.
In HD11 cells preincubated for 4 h with either purified sIL-1RN
or purified icIL-1RN prior to the addition of rchIL-1b, upregulation of IL-1b and iNOS mRNA expression levels was effectively
inhibited (Fig. 8B). In cells stimulated with IL-1b alone, IL-1b
and iNOS mRNA expression levels increased significantly compared with levels in unstimulated cells. Differences in expression
between the rchIL-1b plus rIL-1RN groups and the rchIL-1b only
treatment group were statistically significant up to two and four
doubling dilutions of sIL-1RN and icIL-1RN, respectively (Fig.
8B). The antagonistic effect of both chIL-1RN variants gradually
declined as they were titrated out in the presence of a fixed concentration of rIL-1b. The induction of iNOS was also measured
through the production of nitrite in the culture medium, quantified
via a Griess assay. These results correlated with the qRT-PCR
data throughout the experiment (Fig. 8C).
The bioactivity of ex-COS icIL-1RN was also tested in the same
bioassay (Supplemental Fig. 2). Lysate from COS-7 cells trans-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 6. Expression profiles of full-length chIL1RN mRNA, as measured by real-time qRT-PCR
(TaqMan), with results expressed as corrected DCt
values 6 SE of three to six independent experiments.
(A) Lymphoid tissues (open bars) and nonlymphoid
tissues (filled bars). (B) Chicken lymphocyte subsets.
BL-Mo, Blood-derived monocytes; BM-DCs, bone marrow-derived dendritic cells; BM-MF, bone marrow-derived macrophages.
The Journal of Immunology
547
fected with a vector expressing icIL-1RN inhibited the IL-1b–
induced upregulation of IL-1b and iNOS mRNA expression. Supernatant from the same cells, however, exhibited significantly
less bioactivity and was only able to antagonize the effect of IL-1b
at its highest concentrations. This result is consistent with this
variant being the intracellular form and correlates with results
from a similar study carried out in mammals (8).
The biological activities of the four identified splice variants of
chIL-1RN were tested in the same assay. The bioactivities of cell
supernatants and lysates from COS-7 cells transfected with plasmids expressing each splice variant were compared with mocktransfected controls (supernatants and cell lysates from COS-7
cells transfected with pCI-neo lacking a cDNA insert). At their
highest concentration, ex-COS lysates containing either icIL-1RN
SV1 or SV2 demonstrated greater inhibition of IL-1b–mediated
upregulation of IL-1b and iNOS mRNA levels than their respective supernatants, but these were not statistically significantly
different from levels with ex-COS lysates of pCI-neo controls
(Supplemental Fig. 3). Lysates and supernatants (ex-COS) of both
sIL-1RN splice variants, similarly, showed no bioactivity when
compared with pCI-neo controls. These results indicate that all
four splice variants of chIL-1RN do not act as functional antagonists of IL-1b in this assay.
Discussion
Given the potency of IL-1b in immune responses, its regulation is
essential to avoid damage to the host through excessive inflammation. In part, this role is fulfilled by the biological activities of
IL-1RN. Humans either lacking or possessing mutations in the IL1RN gene can die prematurely in the absence of treatment with
synthetic IL-1RN (44). The identification of IL-1b in the chicken
(25) suggested that IL-1RN should also be present, but it is not
identifiable in either the existing annotated genome build (v2.1) or
the new, yet-to-be-annotated build (v3.0). In this study, we describe the identification and characterization of both secretory
and intracellular variants of IL-1RN in the chicken, as are present
in mammals. Although obvious similarities between the chicken
gene and its mammalian orthologs exist, a number of notable differences were identified.
The chicken has differently spliced isoforms of both the secretory and intracellular variants (differently spliced isoforms have
only been described for the intracellular variant in mammals),
both structural variants show the same differently spliced isoforms (SV1 and SV2), and the rearrangements generating those
isoforms differ between the chicken and mammals. Both SV1
transcripts appear to be formed by exon-skipping, whereas the
SV2 transcripts use an alternative splice acceptor site in the final
exon of the gene. A number of conserved sequence motifs synonymous with exon skipping (45) were identified in the introns adjacent to the spliced exon in SV1, indicating this gene may be
predisposed to splicing at the pre-mRNA stage. This exon-skipping
event, however, causes the predicted amino acid sequence to become out of frame, introducing a premature stop codon and considerably truncating any translated protein. Although the predicted
SV2 amino acid sequences are in frame, potentially important residues corresponding to two b-sheets of the secondary structure are
removed by this splicing event.
Both full-length chicken sIL-1RN and icIL-1RN recombinant
proteins antagonized IL-1b–mediated upregulation of IL-1b and
iNOS, and as such exhibited biological activity analogous to their
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 7. Fold change in IL-1RN
mRNA expression levels in (A) bursal
cells from IBDV-infected chickens and
(B) splenocytes from S. typhimuriuminfected chickens, compared with levels in
uninfected, age-matched controls. *p ,
0.05, **p , 0.01 compared with controls.
Five birds were sampled per time point.
61, Resistant line 61 chickens; BrL, susceptible Brown Leghorn chickens; dpi,
days postinfection.
548
IDENTIFICATION OF IL-1RN IN THE CHICKEN
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 8. Bioassays to determine bioactivity of chIL-1RN. (A) rchIL-1b stimulates HD11 cells to upregulate expression of IL-1b and iNOS mRNA, as
measured by qRT-PCR, and this activity is blocked by neutralizing Ab. (B and C) Both secretory and intracellular variants of purified rchIL-1RN antagonize
the stimulatory effects of rchIL-1b in the same bioassay, in a dose-dependent manner, as measured by (B) inhibition of mRNA expression levels of IL-1b
and iNOS and (C) inhibition of iNOS upregulation, as measured by the induction of nitrite in the culture supernatant, quantified by the Griess assay.
Doubling dilutions of recombinant proteins from initial concentrations (x-axis, data point 1) of 480 and 562 mg/ml sIL-1RN and icIL-1RN, respectively.
The data are expressed as percentage inhibition of IL-1b or iNOS mRNA expression (A, B) or NO22 production (C) (from 100% activity in the absence of
sIL-1RN or icIL-1RN). Results shown are from three independent experiments. U, Unstimulated cells.
mammalian orthologs. The analysis above of the four splice variants suggested they would be functionally redundant and this
proved to be the case. These results suggest that a possible control
mechanism exists to regulate chIL-1RN expression, and hence its
bioactivity, by generating transcripts that encode functionally redundant proteins.
Apart from IL-1b genes, very little is known regarding the
existence of IL-1 family genes in nonmammalian species, with
only a single report characterizing a novel IL-1 family member in
the rainbow trout (46). Genome sequences are now available for
three other avian species: the zebra finch, turkey, and duck. IL-1b
is present in all three, but no other IL-1 family members are
identifiable, including IL-1RN. Outside of other avian species, the
anole lizard is the most closely related species to the chicken for
which a genome sequence is available. A search of its genome
revealed three IL-1 family genes adjacent to one another in a
single locus. None of these genes has been assigned an identity
but all contain the IL-1 family signature motif. BLAST analysis
(data not shown) indicated they are most likely IL-1F5, IL-1F10,
and IL-1RN. However, they form a completely separate clade
when analyzed phylogenetically (Fig. 4), and therefore their identities cannot be determined with confidence.
The Journal of Immunology
Acknowledgments
We thank Lisa Rothwell, James Birch, and John Hammond for advice and
assistance in different aspects of this study.
Disclosures
The authors have no financial conflicts of interest.
References
1. Sims, J. E., and D. E. Smith. 2010. The IL-1 family: regulators of immunity. Nat.
Rev. Immunol. 10: 89–102.
2. Dinarello, C. A. 2009. Immunological and inflammatory functions of the
interleukin-1 family. Annu. Rev. Immunol. 27: 519–550.
3. Cullinan, E. B., L. Kwee, P. Nunes, D. J. Shuster, G. Ju, K. W. McIntyre,
R. A. Chizzonite, and M. A. Labow. 1998. IL-1 receptor accessory protein is an
essential component of the IL-1 receptor. J. Immunol. 161: 5614–5620.
4. Wang, D., S. Zhang, L. Li, X. Liu, K. Mei, and X. Wang. 2010. Structural
insights into the assembly and activation of IL-1b with its receptors. Nat.
Immunol. 11: 905–911.
5. Schreuder, H., C. Tardif, S. Trump-Kallmeyer, A. Soffientini, E. Sarubbi,
A. Akeson, T. Bowlin, S. Yanofsky, and R. W. Barrett. 1997. A new cytokinereceptor binding mode revealed by the crystal structure of the IL-1 receptor with
an antagonist. Nature 386: 194–200.
6. Walter, P., and A. E. Johnson. 1994. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu. Rev. Cell Biol. 10: 87–119.
7. Eisenberg, S. P., R. J. Evans, W. P. Arend, E. Verderber, M. T. Brewer,
C. H. Hannum, and R. C. Thompson. 1990. Primary structure and functional
expression from complementary DNA of a human interleukin-1 receptor antagonist. Nature 343: 341–346.
8. Haskill, S., G. Martin, L. Van Le, J. Morris, A. Peace, C. F. Bigler, G. J. Jaffe,
C. Hammerberg, S. A. Sporn, S. Fong, et al. 1991. cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with
epithelium. Proc. Natl. Acad. Sci. USA 88: 3681–3685.
9. Malyak, M., J. M. Guthridge, K. R. Hance, S. K. Dower, J. H. Freed, and
W. P. Arend. 1998. Characterization of a low molecular weight isoform of IL-1
receptor antagonist. J. Immunol. 161: 1997–2003.
10. Muzio, M., N. Polentarutti, M. Sironi, G. Poli, L. De Gioia, M. Introna,
A. Mantovani, and F. Colotta. 1995. Cloning and characterization of a new
isoform of the interleukin 1 receptor antagonist. J. Exp. Med. 182: 623–628.
11. Arend, W. P., G. Palmer, and C. Gabay. 2008. IL-1, IL-18, and IL-33 families of
cytokines. Immunol. Rev. 223: 20–38.
12. Banda, N. K., C. Guthridge, D. Sheppard, K. S. Cairns, M. Muggli, D. BechOtschir, W. Dubiel, and W. P. Arend. 2005. Intracellular IL-1 receptor antagonist
type 1 inhibits IL-1-induced cytokine production in keratinocytes through
binding to the third component of the COP9 signalosome. J. Immunol. 174:
3608–3616.
13. Merhi-Soussi, F., M. Berti, B. Wehrle-Haller, and C. Gabay. 2005. Intracellular
interleukin-1 receptor antagonist type 1 antagonizes the stimulatory effect of
interleukin-1a precursor on cell motility. Cytokine 32: 163–170.
14. Corradi, A., A. T. Franzi, and A. Rubartelli. 1995. Synthesis and secretion of
interleukin-1a and interleukin-1 receptor antagonist during differentiation of
cultured keratinocytes. Exp. Cell Res. 217: 355–362.
15. Evans, I., S. K. Dower, S. E. Francis, D. C. Crossman, and H. L. Wilson. 2006.
Action of intracellular IL-1Ra (Type 1) is independent of the IL-1 intracellular
signalling pathway. Cytokine 33: 274–280.
16. Levine, S. J., T. Wu, and J. H. Shelhamer. 1997. Extracellular release of the type I
intracellular IL-1 receptor antagonist from human airway epithelial cells: differential
effects of IL-4, IL-13, IFN-g, and corticosteroids. J. Immunol. 158: 5949–5957.
17. Yoon, H. J., Z. Zhu, J. M. Gwaltney, Jr., and J. A. Elias. 1999. Rhinovirus
regulation of IL-1 receptor antagonist in vivo and in vitro: a potential mechanism
of symptom resolution. J. Immunol. 162: 7461–7469.
18. Dinarello, C., W. Arend, J. Sims, D. Smith, H. Blumberg, L. O’Neill,
R. Goldbach-Mansky, T. Pizarro, H. Hoffman, P. Bufler, et al. 2010. IL-1 family
nomenclature. Nat. Immunol. 11: 973.
19. Towne, J. E., B. R. Renshaw, J. Douangpanya, B. P. Lipsky, M. Shen,
C. A. Gabel, and J. E. Sims. 2011. Interleukin-36 (IL-36) ligands require processing for full agonist (IL-36a, IL-36b, and IL-36g) or antagonist (IL-36Ra)
activity. J. Biol. Chem. 286: 42594–42602.
20. van de Veerdonk, F. L., A. K. Stoeckman, G. Wu, A. N. Boeckermann, T. Azam,
M. G. Netea, L. A. Joosten, J. W. van der Meer, R. Hao, V. Kalabokis, and
C. A. Dinarello. 2012. IL-38 binds to the IL-36 receptor and has biological
effects on immune cells similar to IL-36 receptor antagonist. Proc. Natl. Acad.
Sci. USA 109: 3001–3005.
21. Nold, M. F., C. A. Nold-Petry, J. A. Zepp, B. E. Palmer, P. Bufler, and
C. A. Dinarello. 2010. IL-37 is a fundamental inhibitor of innate immunity. Nat.
Immunol. 11: 1014–1022.
22. Liew, F. Y., N. I. Pitman, and I. B. McInnes. 2010. Disease-associated functions
of IL-33: the new kid in the IL-1 family. Nat. Rev. Immunol. 10: 103–110.
23. Kaiser, P. 2010. Advances in avian immunology—prospects for disease control:
a review. Avian Pathol. 39: 309–324.
24. International Chicken Genome Sequencing Consortium. 2004. Sequence and
comparative analysis of the chicken genome provide unique perspectives on
vertebrate evolution. [Published erratum appears in 2005 Nature 433: 777.]
Nature 432: 695–716.
25. Weining, K. C., C. Sick, B. Kaspers, and P. Staeheli. 1998. A chicken homolog
of mammalian interleukin-1b: cDNA cloning and purification of active
recombinant protein. Eur. J. Biochem. 258: 994–1000.
26. Schneider, K., F. Puehler, D. Baeuerle, S. Elvers, P. Staeheli, B. Kaspers, and
K. C. Weining. 2000. cDNA cloning of biologically active chicken interleukin18. J. Interferon Cytokine Res. 20: 879–883.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Expression of full-length IL-1RN is ubiquitous and constitutive
in the range of cells and tissues investigated, although the
TaqMan assay used does not differentiate between sIL-1RN and
icIL-1RN mRNA. Global studies of IL-1RN mRNA expression in
mice (47) and rabbits (48) showed it was not constitutive in all
tissues. Those analyses, however, used RNase protection assays
and Northern blotting, respectively, which lack sensitivity compared with TaqMan. Expression of the full-length chicken IL1RN was increased in vivo following bacterial or viral infection,
as is seen in similar disease models in mammalian species.
Perhaps most interesting from an evolutionary standpoint, in
humans the locus encoding IL-1b and IL-1RN on chromosome 2
also encodes seven other IL-1 family members. There is conservation of synteny with the locus encoding chicken IL-1b on
chromosome 22, in that two genes that are adjacent to the human
IL-1 family locus flank chicken IL-1b. However, we can find no
evidence at this locus for chicken IL-1RN. As most multigene
families at a single locus are conserved between chickens and
mammals, although the precise numbers of members of those
families may differ and orthologous relationships may be difficult
to ascribe (49), it is surprising that the chicken IL-1 family appears
to be more fragmented than the mammalian IL-1 family. Multigene families at a single locus tend to evolve through duplication
events from a single ancestral gene. So how can we explain the
apparent dissonant genomic location of IL-1RN between the
chicken and mammals?
It is possible that human IL-1RN and chIL-1RN represent the
results of species-specific convergent evolution. Alternatively, the
two molecules evolved from a common ancestor followed by sequence divergence in the two lineages. We think that the latter is
most likely, given the number of structural and functional similarities between the chicken and human genes. Cytokine genes in
all species are under extreme selective pressure and tend to evolve
rapidly, so not surprisingly avian cytokines exhibit limited sequence homology with their mammalian orthologs.
Assuming that the three loci in humans that encode the IL-1
family members represent paralogous regions of the genome,
arising from successive duplications of a single ancestral region,
one possible explanation is that a common ancestor of chickens
and mammals contained both IL-1b and IL-1RN at a single locus. Eisenberg et al. (50) predicted IL-1RN and IL-1b evolved
from a common ancestral gene ∼350 million years ago and the
chicken and human are thought to have evolved separately for
∼310 million years (51). Genome duplication events after the
original gene duplication could then have generated paralagous
regions encoding copies of both genes. In humans, one locus
encoding both genes could have been maintained and duplicated
further to give the current nine gene locus, whereas the other
locus could have been lost or mutated, perhaps leaving only
IL-33. In the chicken, one locus could have undergone mutation/
deletion in the IL-1RN gene, to leave only IL-1b, while similar
events in the other locus might have removed IL-1b and left
IL-1RN. Alternatively, a single ancestral locus in the chicken
might have become fragmented by an unknown mechanism,
although, as stated above, the vast majority of multigene immune
families at single loci remain conserved between chickens and
mammals. We will continue to try to determine the genomic
location of chIL-1RN and to identify the full repertoire of IL-1
family genes in this species.
549
550
39. Bird, S., J. Zou, T. Wang, B. Munday, C. Cunningham, and C. J. Secombes.
2002. Evolution of interleukin-1b. Cytokine Growth Factor Rev. 13: 483–502.
40. Nicklin, M. J., J. L. Barton, M. Nguyen, M. G. FitzGerald, G. W. Duff, and
K. Kornman. 2002. A sequence-based map of the nine genes of the human
interleukin-1 cluster. Genomics 79: 718–725.
41. Taylor, S. L., B. R. Renshaw, K. E. Garka, D. E. Smith, and J. E. Sims. 2002.
Genomic organization of the interleukin-1 locus. Genomics 79: 726–733.
42. Jenkins, J. K., R. F. Drong, M. E. Shuck, M. J. Bienkowski, J. L. Slightom,
W. P. Arend, and M. F. Smith, Jr. 1997. Intracellular IL-1 receptor antagonist
promoter: cell type-specific and inducible regulatory regions. J. Immunol. 158:
748–755.
43. Smith, M. F., Jr., D. Eidlen, M. T. Brewer, S. P. Eisenberg, W. P. Arend, and
A. Gutierrez-Hartmann. 1992. Human IL-1 receptor antagonist promoter: cell
type-specific activity and identification of regulatory regions. J. Immunol. 149:
2000–2007.
44. Aksentijevich, I., S. L. Masters, P. J. Ferguson, P. Dancey, J. Frenkel, A. van
Royen-Kerkhoff, R. Laxer, U. Tedgård, E. W. Cowen, T. H. Pham, et al. 2009.
An autoinflammatory disease with deficiency of the interleukin-1-receptor antagonist. N. Engl. J. Med. 360: 2426–2437.
45. Miriami, E., H. Margalit, and R. Sperling. 2003. Conserved sequence elements
associated with exon skipping. Nucleic Acids Res. 31: 1974–1983.
46. Wang, T., S. Bird, A. Koussounadis, J. W. Holland, A. Carrington, J. Zou, and
C. J. Secombes. 2009. Identification of a novel IL-1 cytokine family member in
teleost fish. J. Immunol. 183: 962–974.
47. Gabay, C., B. Porter, G. Fantuzzi, and W. P. Arend. 1997. Mouse IL-1 receptor
antagonist isoforms: complementary DNA cloning and protein expression of
intracellular isoform and tissue distribution of secreted and intracellular IL-1
receptor antagonist in vivo. J. Immunol. 159: 5905–5913.
48. Apostolopoulos, J., S. Ross, P. Davenport, A. Matsukawa, M. Yoshinaga, and
P. G. Tipping. 1996. Interleukin-1 receptor antagonist: characterisation of its
gene expression in rabbit tissues and large-scale expression in eucaryotic cells
using a baculovirus expression system. J. Immunol. Methods 199: 27–35.
49. Kaiser, P., T. Y. Poh, L. Rothwell, S. Avery, S. Balu, U. S. Pathania, S. Hughes,
M. Goodchild, S. Morrell, M. Watson, et al. 2005. A genomic analysis of chicken
cytokines and chemokines. J. Interferon Cytokine Res. 25: 467–484.
50. Eisenberg, S. P., M. T. Brewer, E. Verderber, P. Heimdal, B. J. Brandhuber, and
R. C. Thompson. 1991. Interleukin 1 receptor antagonist is a member of the
interleukin 1 gene family: evolution of a cytokine control mechanism. Proc.
Natl. Acad. Sci. USA 88: 5232–5236.
51. Hedges, S. B., P. H. Parker, C. G. Sibley, and S. Kumar. 1996. Continental breakup
and the ordinal diversification of birds and mammals. Nature 381: 226–229.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
27. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins.
1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876–
4882.
28. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved
prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340: 783–795.
29. Emanuelsson, O., S. Brunak, G. von Heijne, and H. Nielsen. 2007. Locating
proteins in the cell using TargetP, SignalP and related tools. Nat. Protoc. 2: 953–
971.
30. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar. 2011.
MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:
2731–2739.
31. Beug, H., A. von Kirchbach, G. Döderlein, J. F. Conscience, and T. Graf. 1979.
Chicken hematopoietic cells transformed by seven strains of defective avian
leukemia viruses display three distinct phenotypes of differentiation. Cell 18:
375–390.
32. Aricescu, A. R., W. Lu, and E. Y. Jones. 2006. A time- and cost-efficient system
for high-level protein production in mammalian cells. Acta Crystallogr. D Biol.
Crystallogr. 62: 1243–1250.
33. Wu, Z., T. Hu, C. Butter, and P. Kaiser. 2010. Cloning and characterisation of the
chicken orthologue of dendritic cell-lysosomal associated membrane protein
(DC-LAMP). Dev. Comp. Immunol. 34: 183–188.
34. Eldaghayes, I., L. Rothwell, A. Williams, D. Withers, S. Balu, F. Davison, and
P. Kaiser. 2006. Infectious bursal disease virus: strains that differ in virulence
differentially modulate the innate immune response to infection in the chicken
bursa. Viral Immunol. 19: 83–91.
35. Poh, T. Y., J. Pease, J. R. Young, N. Bumstead, and P. Kaiser. 2008. Reevaluation of chicken CXCR1 determines the true gene structure: CXCLi1
(K60) and CXCLi2 (CAF/interleukin-8) are ligands for this receptor. J. Biol.
Chem. 283: 16408–16415.
36. Lawson, S., L. Rothwell, and P. Kaiser. 2000. Turkey and chicken interleukin-2
cross-react in in vitro proliferation assays despite limited amino acid sequence
identity. J. Interferon Cytokine Res. 20: 161–170.
37. Lawson, S., L. Rothwell, B. Lambrecht, K. Howes, K. Venugopal, and P. Kaiser.
2001. Turkey and chicken interferon-g, which share high sequence identity, are
biologically cross-reactive. Dev. Comp. Immunol. 25: 69–82.
38. Kaiser, P., L. Rothwell, E. E. Galyov, P. A. Barrow, J. Burnside, and P. Wigley.
2000. Differential cytokine expression in avian cells in response to invasion by
Salmonella typhimurium, Salmonella enteritidis and Salmonella gallinarum.
Microbiology 146: 3217–3226.
IDENTIFICATION OF IL-1RN IN THE CHICKEN